Abstract
Human cytomegalovirus (HCMV) is a ubiquitous betaherpesvirus with a broad spectrum of infectivity, as documented by the several different cell types that can be infected in vitro and by the multiple organ tropism observed during infection in vivo. Differences in tissue tropism, severity of clinical manifestations and ability to establish persistent or latent HCMV infections are thought to be related to genomic variability among strains (Brown et al., 1995 ; Fries et al., 1994 ; Meyer-Konig et al., 1998a , b ). The sequence similaritybetween different isolates varies depending on the region analysed (Bale et al., 1993 ); highly variable regions have been found in the HCMV genome.
HCMV genomic variants have been detected for a variety of genes, such as UL4 (Bar et al., 2001 ), UL144 (Lurain et al., 1999 ), gH (Chou, 1992a ) and gB. The HCMV genes that have been most studied for their polymorphism are those encoding the structural surface glycoproteins gB and gH, mainly because they are the target proteins for neutralizing antibodies, which are usually produced in a strain-specific pattern (Klein et al., 1999 ), and/or because they are involved in virus entry and cell-to-cell virus spread (Navarro et al., 1993 ; Rasmussen et al., 1997 ).
As far as gB is concerned, four genotypes (gB-1, gB-2, gB-3 and gB-4) have been identified (Chou & Dennison, 1991 ; Chou, 1992b ; Fries et al., 1994 ; Meyer-Konig et al., 1998a , b ), although rare non-prototypic variants have been described (Shepp et al., 1998 ; Trincado et al., 2000 ). The relationship between gB types and HCMV pathogenesis or virus cell/tissue tropism is under investigation, but the results are sometimes controversial (Binder et al., 1999 ; Chern et al., 1998 ; Gilbert et al., 1999 ).
Obviously, it is unlikely that one variant gene is the only factor that influences HCMV virulence, tropism and severity of clinical outcome. It seems more realistic that a cooperation of multiple gene variants associates in determining the virulence of each strain.
In this context, our study performed a detailed analysis of genomic variants of a new HCMV polymorphic locus, open reading frame (ORF) UL73, which is highly conserved among members of the family Herpesviridae. The protein homologues of ORF UL73 are EpsteinBarr virus (EBV) BLRF1, pseudorabies virus UL49.5, herpes simplex virus (HSV) Saimiri ORF 53, human herpesvirus-6 (HHV-6) U46 and murine CMV UL73. ORF UL73 encodes the envelope glycoprotein gpUL73 (gN) (Dal Monte et al., 2001 ). This glycoprotein associates in a high molecular mass complex with gM and is able to induce neutralizing antibodies in the host (Dal Monte et al., 2001 ; Mach et al., 2000 ).
The entire UL73 ORF was amplified by PCR from 38 HCMV clinical isolates and 4 laboratory-adapted strains (AD169, Towne, Davis and Toledo) and sequenced directly to determine the extent of sequence variability. Strain source, clinical data, outcome of HCMV disease (when available) and genotyping results are summarized in Table 1.
Table 1. HCMV clinical samples
All virus strains were propagated in human embryonic lung fibroblasts (HELF). Virus infection and DNA extractions were performed as described previously (Dal Monte et al., 2001 ). Genomic DNA was used to amplify the UL73-coding sequence by PCR using the primers forward-U73, 5' TTCGGTCGGTCAACATCGTAAG 3', and reverse-L73, 5' CACCCACGTATGTAAACCTTAC 3'. The conditions for PCR were 35 cycles of 1 min at 96 °C, 1 min at 50 °C and 1 min at 72 °C. Both UL73 strands were sequenced by the dideoxynucleotide chain-termination method using the ABI PRISM BigDye Terminator Cycle Sequencing Ready Reaction kit (Applied Biosystems), according to the manufacturers protocol. Purified sequencing ladders were analysed using the ABI PRISM 377 sequencer (Applied Biosystems).
Using the AD169 strain as the arbitrary reference sequence, we provide evidence that the 5' half of the ORF (nt 1261) is highly polymorphic, although some changes occur throughout the remainder of the coding sequence. Furthermore, the identified variants are not randomly distributed, but are clearly clustered into four distinct groups. These four groups have been subjected to phylogenetic analysis to generate a tree (Fig. 1a) and a distance matrix. Phylogenetic analysis was performed using the method described by Hein & Stovlbaek (1996) , which is included in the Lasergene 1999 System package (DNASTAR). A detailed summary of the results is presented in Table 2. The four main groups demonstrate sequence identities in the range of 80100% among the 42 strains sequenced. The reference group comprising the AD169 strain was referred to as group 1 and includes the six strains DB, GR, HDs, LN, SB and HR, whose UL73 shares ≅100% sequence similarity to AD169. Group 2 (Can2, Can4, Can7, Can8 and DL) differs from group 1 because of three nucleotide deletions and 6062 nucleotide substitutions, of which 45% are non-synonymous. Strains B-AL, B-AS, BD, ML, TS, FL and PS belong to group 3, with 4951 nucleotide substitutions, of which 53% are non-synonymous with respect to group 1. As shown in Fig. 1(a), the branch identifying group 4 can be divided into three phylogenetically linked sub-groups. Sub-group 4a contains eight strains (BC, Can10, BO, LC, ZV, SR, HDu and MS), which diverge from AD169 by six nucleotide deletions and 5155 nucleotide substitutions, of which 69% are non-synonymous. The Towne and Davis laboratory strains plus the five clinical isolates BR, LV, RL, SE and CR belong to sub-group 4b, which, when compared to group 1, show six nucleotide deletions and 7679 nucleotide substitutions, of which 56% are non-synonymous. Strains RC, VL, PM, PN, GJ, MN, BN and Toledo form group 4c and show nine nucleotide deletions and 7879 nucleotide substitutions, of which 58% are non-synonymous with respect to AD169.
|
Table 2. UL73 genotype frequency and nucleotide/amino acid substitutions
The non-synonymous nucleotide substitutions lead to a wide spectrum of amino acid changes. A sequence alignment compiled using the MultiAlign software of the 42 gpUL73 amino acid sequences obtained from clinical and laboratory-adapted strains is shown in Fig. 1(b). Phylogenetic analysis of the proteins is consistent with results described for DNA, thus maintaining the division of HCMV strains into four main groups (tree not shown). As summarized in Table 2, a large number of amino acid substitutions was detected using group 1 as the arbitrary reference sequence. In particular, group 2 shows a single amino acid deletion and 2122 amino acid substitutions, of which 59% are non-conservative substitutions. Group 3 displays 2021 amino acid substitutions, of which 43% are non-conservative. Sub-group 4a shows two amino acid deletions and 21 amino acid substitutions, of which 52% are non-conservative, while sub-group 4b shows two amino acid deletions and 2628 amino acid substitutions, of which 6465% are non-conservative. Sub-group 4c presents three amino acid deletions and 2628 amino acid substitutions, of which 5664% are non-conservative.
The alignment also shows a high level of amino acid identity (96100%) among strains within each group, with occasional substitutions being maintained across the clusters. Genotypic frequencies of gpUL73 variants demonstrate that gN-4 is the most representative variant in our population (Table 2).
The clustered variants demonstrated polymorphism in the N-terminal region of the protein, with most of the DNA mutations in the C-terminal region resulting in silent mutations (Fig. 1b). This finding, together with data discovered recently on the biochemical properties of gpUL73 (Dal Monte et al., 2001 ; data not shown), the predicted features of this protein and its ability to induce neutralizing antibody (Britt & Auger, 1985 ), suggest that the polymorphic N-terminal domain is exposed at the external surface of the virus particle. This kind of polymorphic region is considered to be an important domain for the immune response during natural infection and usually represents a target for immunological selective pressure.
Furthermore, previous reports (Mach et al., 2000 ) demonstrated that gN associates with its glycosylated counterpart, gM, forming a highly immunogenic envelope complex, gCII (Kari et al., 1986 ). Considering that gM seems to be highly conserved (Lehner et al., 1991 ) and that our prototype strains AD169, Can4, PS, ZV, BR and RC (Table 2) have an almost identical gM sequence (data not shown), we can speculate that the polymorphic gpUL73 (gN) could be the main protein responsible for the immunogenicity of gCII. Thus, a detailed analysis of the in vivo immune response to gN and gM and to the gNgM complex is required to confirm this hypothesis and elucidate the role of gN in HCMV immunopathogenesis.
On the contrary, the high degree of conservation observed in the putative transmembrane region and in the C-terminal domain strongly suggest that these regions are not under immunological pressure and their functions have to be maintained for virus growth and/or virus integrity.
However, sequence variability does not seem to influence the expression of gN. In fact, an immunofluorescence assay was used to test the expression of gpUL73 in HELF infected with the prototype stains and stained using the rabbit polyclonal antibody PAbUL73, as described previously (Dal Monte et al., 2001 ); the protein was always detected.
UL73 encodes a structural glycoprotein, predicted to be a type I transmembrane protein, with 33 O-glycosylation sites and 18 phosphorylation sites, according to Meta-Predict-Protein server. A comparison of gpUL73 putative post-translational modifications from group-specific prototypes showed that, despite the observed hypervariability, the basic structural features, such as glycosylation/phosphorylation sites and transmembrane domains, are essentially shared by strains from all of the clusters. In particular, the putative transmembrane domain (aa 104122 relative to AD169) and two phosphorylation sites (Y86T134) are conserved in the prototype strains. However, O-glycosylation/phosphorylation sites can vary in number, although they do involve the same region (aa 1771), where non-synonymous nucleotide changes often convert one potential glycosylation site to another. Thus, sequence variability seems to affect only partially the conserved structural features of the putative gpUL73.
Comparison of gpUL73 with the counterpart proteins from other herpesviruses demonstrated that homologues encode for shorter polypeptides, with markedly lower putative post-translational modifications and, in some cases (HHV-6, HSV-Saimiri and EBV), an additional transmembrane domain. These data are in agreement with the finding that fully processed HCMV gpUL73 (gN) has a molecular mass of 3953 kDa (putative molecular mass of 15 kDa), while its homologues are lighter (814 kDa) and present a limited number of O- and N-linked sugars (Jons et al., 1996 ; Lake et al., 1998 ).
Since strains used in this study were passaged in cell culture, we verified that in vitro propagation did not modify or select variants present in the clinical specimen inoculum, as in vitro passaging of the virus is considered to be partly responsible for strain selection (Sinzger et al., 1999 ). The gpUL73 genotypes obtained from eight pairs of clinical isolates at low (37) and high (3033) passage number in cell culture were compared. No difference between gN variants passaged at low and high numbers was detected, indicating either that gN is stable during HCMV culture or that more in vitro passages are necessary for strain selection and/or adaptation.
We also determined whether different genotypes can be found in the same patient. For that purpose, the UL73 sequence was obtained from five patients over a follow-up period of 6 months or from the urine and saliva of two patients (ZV and HD). In the first case, identical gN sequences were obtained from all patients throughout follow-up, indicating either that these genotypes are stable during in vivo infection, as shown for HHV-8 latent nuclear antigen and ORF-K1 (Gao et al., 1999 ; Zong et al., 1999 ) and HCMV UL144 (Lurain et al., 1999 ), or that a longer period of time is needed for genotype change. In the second case, the same gN genotype was detected in both clinical specimens of ZV, while the other one (HD) displayed two different variants, gN-1 in saliva and gN-4 in urine, although the specimens showed the same gB-2 type (Table 1). The presence of multiple genotypes within the same patient will make difficult the determination of whether a correlation exists between a particular gN genomic variant and the degree of HCMV pathogenicity, as drawn previously for gH and gB (Vogelberg et al., 1996 ).
To determine whether gpUL73 variants correlate with gB groups, a 410 bp fragment encompassing the proteolytic cleavage site of gB was sequenced, as described previously (Lurain et al., 1999 ). As shown in Table 1, most of our strains showed a gB-1 (Towne prototype, 69% frequency) or a gB-2 (AD169 prototype, 28·5% frequency) genotype. Toledo and Davis laboratory-adapted strains, uncharacterized previously for gB hypervariability, showed a gB-3 and gB-1 genotype, respectively. No mixture of gB types was found. Neither was a correlation between gB type and gN type observed in our population.
The comparison between gpUL73 (gN) and gB variability shown in this study suggests two main points: (a) gB and gpUL73 (gN) sequence clusters are not phylogenetically linked, as reported recently for the UL144 and UL4 genotypes (Bar et al., 2001 ; Lurain et al., 1999 ) and (b) gpUL73 (gN) seems to be more polymorphic than gB. In fact, two predominant gB types (gB-1 and gB-2) were found in our population, while four main gN variants were detected in the same samples.
The hypothesis that gpUL73 is more variable than other surface glycoproteins stresses the need for an in-depth analysis of this protein, as it may play an important role as a stimulator of the host immune response or as a modulator of cell-specific virus tropism and could represent a useful marker to distinguish HCMV strains.
One gene variation may contribute to differences in HCMV pathogenicity depending on the function of its product. Envelope glycoproteins are highly conserved among herpesviruses because of their role in viruscell interaction and host immunological responses; thus, their variations could have strong effects on virus behaviour (Britt & Mach, 1996 ; Rajcani & Vojvodova, 1998 ). In the case of HSV-1, gB variation has been shown to influence pathogenicity (Goodman & Engel, 1991 ). Also, HCMV gB polymorphism has been related to cell tropism and virulence (McCarthy et al., 1991 ; Pulliam, 1991 ).
In conclusion, the precise definition of the genotypes of single viral glycoproteins present in clinical strains, their immunological properties and their role in virus cell tropism might be extremely useful to understand virus pathogenicity.
Footnotes
The UL73 sequences of the 38 clinical strains have been assigned GenBank accession nos AF309969AF310006.References
Bar, M., Shannon-Lowe, C. & Geballe, A. P. (2001). Differentiation of human cytomegalovirus genotypes in immunocompromised patients on the basis of UL4 gene polymorphisms. Journal of Infectious Diseases 183, 218-225.[Medline]
Binder, T., Siegert, W., Kruse, A., Oettle, H., Wilborn, F., Peng, R., Timm, H., Neuhaus, P. & Schmidt, C. A. (1999). Identification of human cytomegalovirus variants by analysis of single strand conformation polymorphism and DNA sequencing of the envelope glycoprotein B gene region-distribution frequency in liver transplant recipients. Journal of Virological Methods 78, 153-162.[Medline]
Britt, W. J. & Auger, D. (1985). Identification of a 65 000 dalton virion envelope protein of human cytomegalovirus. Virus Research 4, 31-36.[Medline]
Britt, W. J. & Mach, M. (1996). Human cytomegalovirus glycoproteins. Intervirology 39, 401-412.[Medline]
Brown, J. M., Kaneshima, H. & Mocarski, E. S. (1995). Dramatic interstrain differences in the replication of human cytomegalovirus in SCID-hu mice. Journal of Infectious Diseases 171, 1599-1603.[Medline]
Chern, K. H., Chandler, D. B., Martin, D. F., Kuppermann, B. D., Wolitz, R. A. & Margolis, T. P. (1998). Glycoprotein B subtyping of cytomegalovirus (CMV) in the vitreous of patients with AIDS and CMV retinitis. Journal of Infectious Diseases 178, 1149-1153.[Medline]
Chou, S. (1992a). Molecular epidemiology of envelope glycoprotein H of human cytomegalovirus. Journal of Infectious Diseases 166, 604-607.[Medline]
Chou, S. (1992b). Comparative analysis of sequence variation in gp116 and gp55 components of glycoprotein B of human cytomegalovirus. Virology 188, 388-390.[Medline]
Chou, S. & Dennison, K. M. (1991). Analysis of interstrain variation in cytomegalovirus glycoprotein B sequences encoding neutralization-related epitopes. Journal of Infectious Diseases 163, 1229-1234.[Medline]
Dal Monte, P., Pignatelli, S., Mach, M. & Landini, M. P. (2001). The product of human cytomegalovirus (HCMV) UL73 is a new polymorphic structural glycoprotein (gpUL73). Journal of Human Virology 4, 26-34.[Medline]
Fries, B. C., Chou, S., Boeckh, M. & Torok-Storb, B. (1994). Frequency distribution of cytomegalovirus envelope glycoprotein genotypes in bone marrow transplant recipients. Journal of Infectious Diseases 169, 769-774.[Medline]
Gao, S. J., Zhang, Y. J., Deng, J. H., Rabkin, C. S., Flore, O. & Jenson, H. B. (1999). Molecular polymorphism of Kaposis sarcoma-associated herpesvirus (Human herpesvirus 8) latent nuclear antigen: evidence for a large repertoire of viral genotypes and dual infection with different viral genotypes. Journal of Infectious Diseases 180, 1466-1476.[Medline]
Gilbert, C., Handfield, J., Toma, E., Lalonde, R., Bergeron, M. G. & Boivin, G. (1999). Human cytomegalovirus glycoprotein B genotypes in blood of AIDS patients: lack of association with either the viral DNA load in leukocytes or presence of retinitis. Journal of Medical Virology 59, 98-103.[Medline]
Goodman, J. L. & Engel, J. P. (1991). Altered pathogenesis in herpes simplex virus type 1 infection due to a syncytial mutation mapping to the carboxy terminus of glycoprotein B. Journal of Virology 65, 1770-1778.
Hein, J. & Stovlbaek, J. (1996). Combined DNA and protein alignment. Methods in Enzymology 266, 402-418.[Medline]
Huang, X. (1994). On global sequence alignment. Computer Applications in the Biosciences 10, 227-235.
Jons, A., Granzow, H., Kuchling, R. & Mettenleiter, T. C. (1996). The UL49.5 gene of pseudorabies virus codes for an O-glycosylated structural protein of the viral envelope. Journal of Virology 70, 1237-1241.[Abstract]
Kari, B., Lussenhop, N., Goertz, R., Wabuke-Bunoti, M., Rakeke, R. & Gehrz, R. C. (1986). Characterization of monoclonal antibodies reactive to several biochemically distinct human cytomegalovirus glycoprotein complexes. Journal of Virology 60, 354-362.
Klein, M., Schoppel, K., Amvrossiadis, N. & Mach, M. (1999). Strain-specific neutralization of human cytomegalovirus isolates by human sera. Journal of Virology 73, 878-886.
Lake, C. M., Molesworth, S. J. & Hutt-Fletcher, L. M. (1998). The EpsteinBarr virus (EBV) gN homolog BLRF1 encodes a 15-kilodalton glycoprotein that cannot be authentically processed unless it is coexpressed with the EBV gM homolog BBRF3. Journal of Virology 72, 5559-5564.
Lehner, R., Stamminger, T. & Mach, M. (1991). Comparative sequence analysis of human cytomegalovirus strains. Journal of Clinical Microbiology 29, 2494-2502.
Lurain, N. S., Kapell, K. S., Huang, D. D., Short, J. A., Paintsil, J., Winkfield, E., Benedict, C. A., Ware, C. F. & Bremer, J. W. (1999). Human cytomegalovirus UL144 open reading frame: sequence hypervariability in low-passage clinical isolates. Journal of Virology 73, 10040-10050.
McCarthy, M., Resnick, L., Taub, F., Stewart, R. V. & Dix, R. D. (1991). Infection of human neural cell aggregate cultures with a clinical isolate of cytomegalovirus. Journal of Neuropathology & Experimental Neurology 50, 441-450.
Mach, M., Kropff, B., Dal Monte, P. & Britt, W. J. (2000). Complex formation of human cytomegalovirus glycoprotein M (gpUL100) and N (gpUL73). Journal of Virology 74, 11881-11892.
Meyer-Konig, U., Vogelberg, C., Bongarts, A., Kampa, D., Delbruck, R., Wolff-Vorbeck, G., Kirste, G., Haberland, M., Hufert, F. T. & von Laer, D. (1998a). Glycoprotein B genotype correlates with cell tropism in vivo of human cytomegalovirus infection. Journal of Medical Virology 55, 75-81.[Medline]
Meyer-Konig, U., Haberland, M., von Laer, D., Haller, O. & Hufert, F. T. (1998b). Intragenic variability of human cytomegalovirus glycoprotein B in clinical strains. Journal of Infectious Diseases 177, 1162-1169.[Medline]
Navarro, D., Paz, P., Tugizov, Z., Topp, K., La Vail, J. & Pereira, L. (1993). Glycoprotein B of human cytomegalovirus promotes virion penetration into cells, transmission of infection from cell to cell and fusion of infected cells. Virology 197, 143-158.[Medline]
Pulliam, L. (1991). Cytomegalovirus preferentially infects a monocyte derived macrophage/microglial cell in human brain cultures: neuropathology differs between strains. Journal of Neuropathology & Experimental Neurology 50, 432-440.
Rajcani, J. & Vojvodova, A. (1998). The role of herpes simplex virus glycoproteins in the virus replication cycle. Acta Virologica 42, 103-118.[Medline]
Rasmussen, L., Hong, C., Zipeto, D., Morris, S., Sherman, D., Chou, S., Miner, R., Drew, W. L., Wolitz, R., Dowling, A., Warford, A. & Merigan, T. C. (1997). Cytomeglovirus gB genotype distribution differs in human immunodeficiency virus-infected patients and immunocompromised allograft recipients. Journal of Infectious Diseases 175, 179-184.[Medline]
Shepp, D. H., Match, M. E., Lipson, S. M. & Pergolizzi, R. G. (1998). A fifth human cytomegalovirus glycoprotein B genotype. Research in Virology 149, 109-114.[Medline]
Sinzger, C., Schmidt, K., Knapp, J., Kahl, M., Beck, R., Waldman, J., Hebart, H., Einsele, H. & Jahn, G. (1999). Modification of human cytomegalovirus tropism through propagation in vitro is associated with changes in the viral genome. Journal of General Virology 80, 2867-2877.
Trincado, D. E., Scott, G. M., White, P. A., Hunt, C., Rasmussen, L. & Rawlinson, W. D. (2000). Human cytomegalovirus strains associated with congenital and perinatal infections. Journal of Medical Virology 61, 481-487.[Medline]
Vogelberg, C., Meyer-Konig, U., Hufert, F. T., Kirste, G. & von Laer, D. (1996). Human cytomegalovirus glycoprotein B in renal transplant recipients. Journal of Medical Virology 50, 31-34.[Medline]
Zong, J. C., Ciufo, D. M., Alcendor, D. J., Wan, X., Nicholas, J., Browning, P. J., Rady, P. L., Tyring, S. K., Orenstein, J. M., Rabkin, C. S., Su, I. J., Powell, K. F., Croxson, M., Foreman, K. E., Nickoloff, B. J., Alkan, S. & Hayward, G. S. (1999). High-level variability in the ORF-K1 membrane protein gene at the left end of the Kaposis sarcoma-associated herpesvirus genome defines four major virus subtypes and multiple variants or clades in different human populations. Journal of Virology 73, 4156-4170.
Received 30 May 2001; accepted 25 July 2001.