Research Article

Antigenic variation among isolates of infectious salmon anaemia virus correlates with genetic variation of the viral haemagglutinin gene

Journal of General Virology 2001; 82(12):2869

PubMed

With thanks to our partners for supporting this archive.

Abstract

Infectious salmon anaemia virus (ISAV), an orthomyxovirus-like virus, is an important fish pathogen in marine aquaculture. Virus neutralization of 24 ISAV isolates in the TO cell line using rabbit antisera to the whole virus and comparative sequence analysis of their haemagglutinin (HA) genes have allowed elaboration on the variation of ISAV isolates. The 24 viruses were neutralized to varying degrees, revealing two major antigenic groups, one American and one European. Sequence analysis of the HA gene also revealed two groups of viruses (genotypes) that correlated with the antigenic groupings. The two HA subtypes had nucleotide sequence identity of only 79·4% and amino acid sequence identity of 84·5% whereas, within each subtype, the sequence identities were 90·7% or higher. This grouping was also evident upon phylogenetic analysis, which revealed two distinct phylogenetic families. Between the two groups, the amino acid sequence was most variable in the C-terminal region and included deletions of 416 amino acids in all isolates relative to ISAV isolate RPC/NB-980 280-2. In order to view the relationships among these sequences and the HA sequences of the established orthomyxoviruses, a second phylogenetic tree was constructed which showed the ISAV sequences to be more closely related to sequences from Influenzavirus A and Influenzavirus B than to sequences from Influenzavirus C and Thogotovirus. The extensive deletions in the gene of European ISAV isolates lead us to speculate that the archetypal ISAV was probably of Canadian origin.
Infectious salmon anaemia (ISA) virus (ISAV) is a new member of the family Orthomyxoviridae. It causes ISA in marine-farmed Atlantic salmon (Salmo salar), which is probably the most important virus disease of salmonids in the Northern hemisphere. The taxonomic position of ISAV at the genus level within the family Orthomyxoviridae has not yet been resolved. Comparison of the ISAV putative polymerase protein (PB1) and nucleoprotein (NP) with those of other orthomyxoviruses revealed amino acid identity values of <25% (Krossøy et al., 1999 ) and <13% (Snow & Cunningham, 2001 ), respectively, supporting the suggestion that ISAV be assigned to a new, fifth genus, Aquaorthomyxovirus, within the Orthomyxoviridae (Krossøy et al., 1999 ).

The structural viral protein profile of ISAV has not been determined conclusively, as the gene coding assignment of the ISAV genome is not clearly known. Metabolic radiolabelling of synthesized proteins coupled with immunoprecipitation, which allows detection of both structural and non-structural viral proteins, revealed up to 12 viral proteins (Kibenge et al., 2001 ), indicating that ISAV has a similar protein profile to that of influenza viruses (Cox et al., 2000 ). The ssRNA genome of ISAV consists of eight segments of negative polarity, ranging in size from 1·0 to 2·3 kb, with a total molecular size of approximately 14·5 kb (Mjaaland et al., 1997 ). Rimstad et al. (2001) described a genomic segment encoding the putative haemagglutinin (HA) of ISAV. The protein was shown to be an HA by demonstrating its haemadsorptive properties for salmon erythrocytes when expressed in a salmon cell line. Krossøy et al. (2001a ) identified the ISAV HA gene as RNA segment 6 and showed it to encode a 42·4 kDa protein that corresponds to the 4346 kDa protein detected previously in purified ISAV preparations (Falk et al., 1997 ; Kibenge et al., 2000 ). Peptide analysis of the ISAV 43 kDa protein also identified this protein as being the same as that encoded by RNA segment 6 (Griffiths et al., 2001 ). Sequence comparisons among different ISAV isolates have indicated the occurrence of a highly polymorphic region in this gene (Rimstad et al., 2001 ; Krossøy et al., 2001a ). Among influenza viruses, the HA gene is reported to be the most variable (Webster et al., 1992 ). However, the ISAV HA gene was shown to differ from that of influenza viruses A and B in that it is not cleaved post-translationally, and the fusion activity of ISAV may be associated with a protein encoded by a separate gene (Krossøy et al., 2001a ).

Orthomyxoviruses have the unique capacity to undergo a high degree of antigenic variation within a short period of time. Considerable variation occurs among the HA and neuraminidase (NA) antigens of influenza A viruses, whereas those of influenza B viruses exhibit less antigenic variation and antigenic variation is rarely observed among influenza C viruses (Matsuzaki et al., 2000 ). In the case of ISAV isolates, there is no information about antigenic variation.

ISAV isolates have been shown previously to fall into two phenotypic groups based on their ability to replicate in the CHSE-214 cell line (Kibenge et al., 2000 , 2001 ), i.e. two CHSE phenotypes. Previous attempts to explain the molecular basis for this variation have focused on the ISAV 43 kDa protein (Griffiths et al., 2001 ), the putative HA protein. Indeed, it was reported that the molecular mass of this protein was 38 kDa in CHSE-214-compatible isolates (CHSE-positive phenotype) and 40 kDa in a non-compatible isolate (CHSE-negative phenotype) and that this difference was explained by a 10 amino acid insertion in the CHSE-214-non-compatible isolate (Griffiths et al., 2001 ). In the present study, it was hypothesized that differences in the ability of different isolates of ISAV to replicate in CHSE-214 cells may be related to differences in the viral receptor-binding protein HA and, since HA is the major antigen responsible for serotype differences in influenza viruses, we wished to determine whether antigenic differences between ISAV isolates were correlated with the CHSE phenotypes. We also wished to add the HA sequences of many ISAV isolates from different geographical regions to the database of available HA sequences. The putative HA sequence was therefore examined to determine the level of sequence variation among different ISAV isolates. For these purposes, we compared 10 ISAV isolates that produce cytopathic effects (CPE) in CHSE-214 cells (CHSE-positive phenotype) with 14 that do not (CHSE-negative phenotype), for a total of 24 ISAV isolates, and analysed an additional eight previous HA entries in GenBank.

Cells and viruses.
Twenty-four ISAV isolates from different geographical regions and from both CHSE phenotypes (Kibenge et al., 2000 ) were chosen for the study. ISAV isolates were propagated and titrated in CHSE-214, SHK-1 and TO cell lines as described previously (Kibenge et al., 2000 , 2001 ). The ISAV isolates that were used in this study and their characteristics are listed in Table 1.


Table 1. VN titres of four rabbit anti-ISAV antisera against different ISAV isolates


Anti-ISAV rabbit antibodies.
Rabbit polyclonal antisera to purified ISAV were prepared as described previously (Kibenge et al., 2000 ) using ISAV isolates Back Bay 98, RPC/NB-980049, 7833-1 and RPC/NB-980 280-10. Briefly, for each virus isolate, one 250 g rabbit (Charles River Canada) was inoculated subcutaneously three times at 3-week intervals with 100 µg purified virus, once in Freunds complete adjuvant and twice in Freunds incomplete adjuvant. Pre-inoculation serum and sera collected every 3 weeks until after the last injection were tested for the presence of neutralizing antibodies in the virus-neutralization test.

Virus-neutralization (VN) test.
VN tests were carried out on TO cell monolayers in 48-well culture plates. Cell monolayers were grown at room temperature (22 °C) in HMEM (Eagles minimum essential medium containing Hanks salts; BioWhittaker) supplemented with 292 µg/ml L-glutamine (Sigma), 1% non-essential amino acids (NEAA; Sigma), 100 µg/ml gentamicin (Sigma) and 10% foetal bovine serum (FBS) (Wergeland & Jakobsen, 2001 ). For maintenance medium, FBS was reduced to 5%. To set up a VN test, serial 2-fold dilutions of ISAV antiserum and an equal volume of virus suspension containing 100 TCID50 were added to TO cell monolayers drained of medium and incubated at room temperature for 1 h before addition of 500 µl fresh maintenance medium to each well. After incubation for a further 10 days at 16 °C, cultures were examined microscopically for CPE to determine the VN test results.

RTPCR for ISAV.
Viral RNA was extracted from 250 µl cell culture lysate by using TRIZOL LS reagent (Canadian Life Technologies) following the manufacturers protocol. The PCR primer pair ISAV HA1F/ISAV HA1R was designed originally from the nucleotide sequence of ISAV isolate Glesvaer/2/90 (Rimstad et al., 2001 ) by using Primer Detective version 1.01 (Clontech). This sequence was subsequently shown to belong to the ISAV HA gene, RNA segment 6. The primer pairs used in this study consisted of either primers ISAV HA1F (nucleotides 7091; sense, 5' AAACTACCCTGACACCACCTGG 3') and ISAV HA1R (nucleotides 10611082; antisense, 5' ACAGAGCAATCCCAAAACCTGC 3') or primers ISAV SEG6FP (nucleotides 219; sense, 5' GCAAAGATGGCACGATTC 3') and ISAV SEG6RP (nucleotides 11731192; antisense, 5' CGTTGTCTTTCTTTCATAATC 3'). One-step RTPCR was carried out by using the Titan One Tube RTPCR System kit (Roche Molecular Biochemicals). RTPCR was performed in a PTC-200 DNA Engine Peltier thermal cycler (MJ Research Inc.). Cycling conditions consisted of one cycle of cDNA synthesis and pre-denaturation at 55 °C for 30 min and 94 °C for 2 min followed by 40 cycles, each consisting of denaturation at 94 °C for 30 s, annealing at 61 °C for 45 s and extension at 72 °C for 90 s, with a final extension at 72 °C for 10 min. PCR products were resolved by electrophoresis on a 1% agarose gel and visualized under 304 nm UV light after staining with ethidium bromide (Sambrook et al., 1989 ). The PCR products were then cloned into the pCRII vector using a TA cloning kit (Invitrogen Life Technologies) in preparation for sequencing.

DNA sequencing and analysis of sequence data.
Plasmid DNA for sequencing was prepared as described previously (Kibenge et al., 1991 ). Denatured plasmid DNA was sequenced using the DYEnamic ET terminator cycle sequencing kit (Amersham Pharmacia Biotech) and the PCR Express (Hybaid) thermal cycler. Sequencing reactions were resolved on a model 377 ABI Prism Automated DNA Sequencer (Applied Biosystems) using 36 lanes on a 36 cm plate. Amershams mobility file (US81072) that comes with the dye terminator kit was used to identify the bases correctly. The electrophoregrams were inspected and edited using the Sequencing Analysis 3.3 software provided with the 377 Prism by ABI. Sequence analysis used the Lasergene Biocomputing software for Windows (DNASTAR), the Sequence Manipulation suite (Stothard, 2000 ) and the FASTA program package for microcomputers (Pearson & Lipman, 1988 ).

Reference sequences were obtained from GenBank for representatives of the genera Influenzavirus A [A/parakeet/Narita/92A/98 (H9N2), accession no. AB049160], Influenzavirus B (B/Lee/40, accession no. K00423), Influenzavirus C (C/California/78, accession no. K01689) and Thogotovirus (Dhori/Indian/1313/61, accession no. M34002).

Phylogenetic analysis of ISAV.
Sequences were aligned by using CLUSTAL X with the default settings (Thompson et al., 1997 ). Phylogenetic trees were generated from the aligned sequences by using CLUSTAL X and the neighbour-joining method (Saitou & Nei, 1987 ). Alignment regions containing gaps were excluded from the analysis. The results were analysed by using the bootstrap method (1000 replicates) to provide confidence levels for the tree topology.

Two major antigenic groups of ISAV identified among various isolates from different geographic regions by virus neutralization
All viruses replicated to high titre and produced complete CPE in the TO cell line. The CPE, which consisted of cell rounding and lysis, appeared at 4 days p.i. and was complete by 10 days p.i. Table 1 summarizes the characteristics of the ISAV isolates used and the VN titres obtained against the four different rabbit antisera. Ten ISAV isolates produced CPE in CHSE-214 cells (CHSE-positive phenotype) and 14 were non-cytopathic in CHSE-214 cells (CHSE-negative phenotype). The viruses were neutralized to varying degrees, revealing two major antigenic groups, one American and one European (with the exception of isolate U5575-1 from Canada). The American group, which was generally neutralized well by the four antisera, particularly by rabbit antiserum to ISAV isolate RPC/NB-980 049-1, consisted of 12 isolates from Canada and one isolate from Chile. The European group, which was neutralized poorly by all four rabbit antisera, consisted of five isolates from Norway, five from Scotland and one from Canada. It is considered that the two groups delineated by the four rabbit antisera are sufficiently distinct to be recognized as separate serotypes (Table 1). However, VN results with specific antisera to viruses in the second group as well as the use of monospecific antisera will be necessary in order to demonstrate that there is no cross-neutralization between the two groups or even the existence of a third antigenic group.

Sequence variation of the ISAV HA gene among different ISAV isolates reveals two HA genotypes
RTPCR amplification with primer pairs ISAV HA1F/ISAV HA1R and ISAV SEG6FP/ISAV SEG6RP yielding PCR products of approximately 11·2 kbp (predicted sizes 1031 bp and 1204 bp, respectively). The sequences determined from the PCR products obtained with primer pair ISAV HA1F/ISAV HA1R ranged from 1013 bp in Scottish isolate 390/98 to 1061 bp in Canadian isolate RPC/NB-980 280-2. All se- quences were examined for authenticity by looking for open reading frames (ORFs) at least 30 residues long, starting with any amino acid codon, using the ORF Finder in the Sequence Manipulation suite (Stothard, 2000 ). All isolates contained a large ORF in reading frame 2 (ORF2) that spanned the whole sequence. In the Norwegian isolate Bremnes 98 (Nor-3), the HA ORF of which has been sequenced completely, this ORF (ORF2) spans nucleotide positions 81174 (Krossøy et al., 2001a ). ISAV isolates from Norway and Scotland also had a small ORF, 82 amino acids long, starting with a methionine codon in reading frame 1 (ORF1), which, in the Bremnes 98 isolate, spans nucleotide positions 358606. This ORF1 was not found in any of the Canadian isolates or in the Chilean isolate. Reading frame 3 had no viable ORF in any of the ISAV isolates studied. The 24 sequences have been deposited in GenBank under the accession numbers listed in Table 2 (isolates 124).


Table 2. GenBank accession numbers and the corresponding designations used in Figs 14


The ISAV HA sequence was analysed for similarity to published HA sequences of selected viruses from Influenzavirus A, Influenzavirus B, Influenzavirus C and Thogotovirus, the four established genera in the virus family Orthomyxoviridae (see Methods for details of reference sequences). There was no nucleotide sequence identity between the HA sequences from ISAV and these orthomyxoviruses. However, there was some identity at the amino acid level that ranged from 23·0% in a 61 amino acid overlap with the sequence from Thogotovirus to 22·0% in a 91 amino acid overlap with the sequence from Influenzavirus A. This sequence identity was in the N-terminal region, spanning amino acid residues 24140 of the ISAV HA for identities with the HA sequences from Influenzavirus A, Influenzavirus C and Thogotovirus, and amino acid residues 203264 of the ISAV HA for identity with the sequence from Influenzavirus B (Fig. 1).



(27K):

Fig. 1. Sequence identity between HA from ISAV and members of Influenzavirus A, Influenzavirus B, Influenzavirus C and Thogotovirus (see Methods for details of reference sequences). (a) ISAV isolate U5575-1 (Can-13) and Influenzavirus A (Inf.A). (b) ISAV isolate RPC/NB 980-280-2 (Can-1) and Influenzavirus C (Inf.C). (c) Can-13 and Thogotovirus (Dhori). (d) Can-13 and Influenzavirus B (Inf.B). Gaps introduced to optimize the alignment are indicated by dashes. Residues between viruses with strong and weak similarity predicted by FASTA program are indicated by colons (:) and full stops (.), respectively.

The FASTA program was used to perform pairwise comparisons between the nucleotide and deduced amino acid sequences from the 24 ISAV isolates sequenced in this study and the eight previous GenBank entries of ISAV putative HA nucleotide and deduced amino acid sequences (Krossøy et al., 2001a ; Rimstad et al., 2001 ). Pairwise nucleotide sequence identities among the 24 ISAV isolates sequenced in this study are listed above the diagonal in Table 3 in decreasing order in comparison to ISAV isolate RPC/NB-980 280-2. The corresponding pairwise deduced amino acid sequence identities of ORF2 are listed below the diagonal in Table 3. The sequence identity data revealed two groups of viruses (genotypes), an American genotype of 13 viruses (12 from Canada and one from Chile), and a European genotype of 11 viruses (five from Norway, five from Scotland and one from Canada). To correspond to nomenclature established for influenza virus NA and HA genes, the term subtype will be used to distinguish the two HA genotypes. The two HA subtypes had a nucleotide sequence identity of only 79·4% and amino acid sequence identity of 84·5% (Table 3) whereas, within each subtype, the sequence identities were 90·7% or higher (Table 3). Within the European subtype, ISAV isolates 390/98, 832/98 and 912/99 from Scotland were 100% identical (Table 3).


Table 3. Percentage nucleotide and deduced amino acid sequence identity of the putative viral HA gene of ISAV


All the available amino acid sequences of ORF2 were aligned using CLUSTAL W (Thompson et al., 1994 ). The full alignment is available as supplementary material at JGV Online (https://vir.sgmjournals.org/) and selected regions of the alignment are shown in Fig. 2. Between the American and European HA subtypes, there were twice as many amino acid changes in the second half of the protein as were found in the first half and most involved one or two residues distributed randomly. The change of N to S at position 155 resulted in loss of a potential glycosylation site, 155NPT157, in the European HA subtype (Fig. 2a); the American HA subtype therefore has three potential N-glycosylation sites compared with two in the European HA subtype. However, 155NPT157 is probably not used (Krossøy et al., 2001a ; Feldmann et al., 1988 ) and, since one of the N-glycosylation sites is located at the cytoplasmic side of the predicted transmembrane region, that leaves only the 333NIT335 potential N-glycosylation sites that is shared by all isolates (Fig. 2b). The longest stretch of amino acid changes between the two subtypes consisted of four residues, 320LEAQ323 in the American subtype and 320VALH323 in the European subtype. However, as shown in Fig. 2(b), the alignment also revealed a hypervariable region (residues 339354) in the C-terminal region that included a 416 amino acid deletion in all ISAV isolates relative to ISAV isolate RPC/NB-980 280-2 (Can-1). It is noteworthy that the only potential N-glycosylation site likely to be used, 333NIT335, lies between these two major mutations. The most extensive deletion, of 16 residues, 339NRVDAILGVNQVEQPS354, was seen between ISAV isolate RPC/NB-980 280-2 and Norwegian isolates Bremnes 98 (Nor-3), 810/9/99 (Nor-8) and 835/9/98 (Nor-9), and between the RPC/NB-980 280-2 isolate and the Scottish isolates 390/98 (Scot-1), Loch Nevis 98 (Scot-2), 832/98 (Scot-3), 301/98 (Scot-4) and 912/99 (Scot-6). The smallest deletion, of four residues, 344ILGV347, was seen between RPC/NB-980 280-2 and Norwegian isolates Hitra 99 (Nor-6) and 485/9/97 (Nor-7). Thus, the HA ORF in ISAV isolate RPC/NB-980 280-2 is estimated to be 404 amino acids long, in contrast to the shortest, of 388 amino acid residues, in Norwegian isolates Bremnes 98, 810/9/99 and 835/9/98 and Scottish isolates 390/98, Loch Nevis 98, 832/98, 301/98 and 912/99.


Table 2. The full alignment is available as supplementary material at JGV Online (https://vir.sgmjournals.org/).


Comparison of the ISAV Glesvaer/2/90 sequences between accession no. AF220607 of Rimstad et al. (2001) and accession no. AF283998 determined in the present study showed a nucleotide sequence identity of 96·5% and an amino acid sequence identity in ORF2 of 93·2%, with most sequence divergence occurring in the hypervariable region, as seen with the Canadian isolates, but without any deletion. This result was not unexpected, since most likely we sequenced a different clone to that sequenced by Rimstad et al. (2001) within the Glesvaer/2/90 quasispecies, but it does indicate to us that this region is highly mutable.

Evolutionary relationships of ISAV based on the putative HA gene
The viral cDNA sequences of 24 ISAV isolates determined in this study and the eight other putative ISAV HA gene entries in GenBank were subjected to phylogenetic analysis (Fig. 3). All the sequences of ISAV isolates from Norway and Scotland and Canadian isolate U5575-1 (Can-13) form a distinct phylogenetic family with strong bootstrap support. Within this family, Can-13 appears to have diverged from the common ancestor of the European isolates. All these isolates also belonged to one subtype (Table 3) and those that were tested in VN in the present study belonged to the European antigenic group (Table 1). The remaining sequences (Can-1 to Can-12, Can-14 to Can-16 and Chil-1), which belonged to the American antigenic group (Table 1) and subtype (Table 3), constitute a second family. The members of this second family are very similar to one another, as indicated by the short branch lengths separating them, and the majority of the sequences do not show significant subgrouping.



(14K):

Fig. 3. Phylogenetic tree showing the relationships between 32 different ISAV isolates. The available nucleotide sequences of the putative HA gene of ISAV were aligned and analysed using CLUSTAL X (Thompson et al., 1997 ). Percentage bootstrap values (1000 replicates) are shown for branch-points with greater than 60% bootstrap support. The high similarity of certain sequences makes some of the horizontal branches too short to display. Their absence causes crowded vertical branches in some cases (some lines look thicker than others). Bar, 0·1 expected substitutions per nucleotide site.

To view the relationships among the ISAV sequences and the HA sequences of the established orthomyxoviruses, a second phylogenetic tree was constructed. For simplicity, only two of the most diverged ISAV protein sequences, Can-1 and Can-13, were used in the analysis with sequences from Influenzavirus A, Influenzavirus B, Influenzavirus C and Thogotovirus (see Methods for details of reference sequences). As shown in Fig. 4, Can-1 and Can-13 showed significant grouping, as did the sequences from Influenzavirus A and Influenzavirus B. Although the ISAV sequences appear to be more closely related to members of Influenzavirus A and Influenzavirus B than to the other sequences, this grouping was often not observed using other alignment and tree-building techniques (data not shown). Overall, the HA sequences are very divergent, with Can-1 and Can-13 being the most closely related sequence pair.



(7K):

Fig. 4. Phylogenetic tree for the HAs of ISAV and members of the four established genera of the virus family Orthomyxoviridae. Protein sequences were aligned and analysed using CLUSTAL X (Thompson et al., 1997 ). Percentage bootstrap values (1000 replicates) are shown for branch-points with greater than 60% bootstrap support. ISAV isolates RPC/NB 980-280-2 (Can-1) and U5575-1 (Can-13) are two of the most diverged of the ISAV isolates. The other members of Orthomyxoviridae are denoted as HAA (Influenzavirus A), HAB (Influenzavirus B), HAC (Influenzavirus C) and HAD (Thogotovirus).
In the present study, 24 ISAV isolates from different geographical regions, and belonging to two CHSE phenotypes, were subjected to in-vitro neutralization with rabbit polyclonal antisera to ISAV and sequence analysis of the putative HA gene in order to gain further understanding of the nature of phenotypic variation of ISAV. We show here that the degree of virus neutralization by four different rabbit antisera separates ISAV into at least two major antigenic types, one American and one European. Sequence analysis of the putative ISAV HA gene also revealed two groups of viruses corresponding to the antigenic groups (HA subtypes). This grouping was supported by phylogenetic analysis, which revealed two distinct phylogenetic families. The putative HA gene of ISAV shows dramatic nucleotide and deduced amino acid changes within the Canadian isolates and between Canadian and European isolates, with the presence of a hypervariable region in the C-terminal region. Although sequence analysis of this gene has been reported by others (Rimstad et al., 2001 ; Krossøy et al., 2001a ), the present study included antigenic analysis, investigation of a possible association with CHSE phenotypes and the examination of many more ISAV isolates from different geographical regions than previously studied. We also add to the evidence supporting the conclusion that RNA segment 6 of ISAV encodes the HA protein by demonstrating limited amino acid sequence similarity between the HA of ISAV and of members of the four established genera of the family Orthomyxoviridae. Thus, we demonstrate here for the first time that ISAV isolates vary significantly antigenically and that this antigenic variation is correlated with genetic variation of the putative HA gene.

Previous molecular analyses have shown that ISAV isolates from Canada and Europe vary significantly on RNA segments 2 and 8 (Blake et al., 1999 ; Cunningham & Snow, 2000 ; Kibenge et al., 2000 , 2001 ; Inglis et al., 2000 ). It has been generally accepted that, because of the close geographical proximity of Scotland and Norway, the Scottish and Norwegian isolates are more closely related to each other than to the Canadian isolates (Cunningham & Snow, 2000 ). The antigenic analysis and sequence analysis of the putative HA gene of 24 isolates in the present study shows that the groupings based on the HA gene do not separate the viruses clearly along geographical regions of origin, since ISAV isolate U5575-1 (Can-13) groups with the European subtype.

The two HA subtypes had a nucleotide sequence identity of only 79·4% and amino acid sequence identity of 84·5% whereas, within each subtype, the sequence identities were 90·7% or higher. Between the two subtypes, there were twice as many amino acid changes in the second half of the protein as were found in the first half and most involved one or two residues distributed randomly. Mutations with the potential to influence the structure/function of the ISAV HA protein include the change at the potential glycosylation site, 155NPT157, in the European HA subtype, the four-residue mutation between the two subtypes, 320LEAQ323 in the American subtype and 320VALH323 in the European subtype, and the hypervariable region (residues 339354) in the C-terminal region, which included a 416 amino acid deletion in all ISAV isolates relative to ISAV isolate RPC/NB-980 280-2 (Can-1). In previous reports on the ISAV HA gene, only small numbers of isolates were analysed and no definite pattern emerged. Consequently, none of those reports identified the 10-residue deletion in the Canadian isolates relative to ISAV isolate RPC/NB-980 280-2 (Can-1) or the four-residue deletion, 344ILGV347, in Norwegian isolates Hitra 99 (Nor-6) and 485/9/97 (Nor-7) relative to isolate RPC/NB-980 280-2 (Can-1) reported in the present study. The putative ISAV HA has been suggested to have the same orientation as the influenza virus HA, with the first 334 amino acid residues making up the ectodomain and, depending on the virus strain, residues 351366 to 374388 making up the hydrophobic domain that could cross the virus envelope (Rimstad et al., 2001 ; Krossøy et al., 2001a ). Thus, given their location in the ISAV HA protein, the 320LEAQ323320VALH323 and the 416 residue deletion mutations between the two HA genotypes (Fig. 2b) might account for the two HA antigenic types identified in the present study.

It is interesting to note that isolate U5575-1 (Can-13) appears to have diverged recently from the common ancestor of the European isolates. This isolate is most similar to Norwegian isolate Gullesfjord 93 (Krossøy et al., 2001a ) (Nor-5) and the Scottish isolate 1490/98 (Scot-5) from the island of Skye (Figs 2 and 3). ISAV U5575-1 was isolated from a clinical ISA outbreak in Nova Scotia, Canada, whereas all other Canadian isolates are from New Brunswick. A previous report of ISAV similar to European isolates found in farmed Atlantic salmon in Nova Scotia was based on RTPCR-amplified sequences of segment 8 from apparently normal fish, and virus was never isolated from those fish (Ritchie et al., 2001 ). This is the first documentation of an ISAV isolate that confirms the presence of a European ISAV ancestor in North America. The extensive deletions in the HA gene of European ISAV isolates may suggest that the archetypal ISAV was probably of Canadian origin, for example the RPC/NB-980 280-2 (Can-1) isolate. Although the deletions described in this study may not necessarily infer a direction of evolution in this virus, previous phylogenetic analysis based on RNA segment 2 (PB1 gene) suggested that American and European ISAV isolates diverged around 1900, coincident with the introduction of rainbow trout, Oncorhynchus mykiss, to Europe from North America (Krossøy et al., 2001b ).

The putative HA gene of ISAV shows dramatic nucleotide changes within the Canadian isolates and between Canadian and European isolates. The putative archetypal ISAV, isolate RPC/NB-980 280-2, is found in Canada with the most complete amino acid sequence of the putative HA protein. Other isolates from Canada, Chile, Norway and Scotland have deletions relative to this isolate. This suggests that ISAV is still evolving and is yet to reach a state of adaptation where further nucleotide changes will not result in amino acid changes (i.e. when further changes will provide no selective advantage). While the sequence of the European isolates contained two ORFs, a small ORF1 and a large ORF2, all the Canadian isolates contained only the large ORF2. This indicated to us that ORF1 might not encode an essential protein, since it was absent in a significant group of ISAV isolates.

The interaction of a virus with its cellular receptor initiates a chain of dynamic events that will enable entry of the virus into the cell (Schneider-Schaulies, 2000 ). This interaction is critical, as it determines the host range of the virus, which may change with mutations in the virus. Whereas all the ISAV isolates studied to date are cytopathic in the SHK-1 and TO cell lines, only some of them cause CPE in the CHSE-214 cell line, allowing the grouping of ISAV into two phenotypes (Kibenge et al., 2000 ). In the present study, we used a total of 24 different ISAV isolates to demonstrate that this phenotype is associated neither with the antigenicity of ISAV nor with the sequence variation of the putative HA gene. The lack of correlation between the CHSE phenotypes and the HA subtypes may be due to the finding reported by Krossøy et al. (2001a ), that the ISAV HA does not appear to be cleaved post-translationally and therefore does not carry fusion activity. Among the established genera of Orthomyxoviridae, only members of the genus Thogotovirus have no requirement for glycoprotein cleavage; however, virions in this genus contain only six or seven genome segments (Cox et al., 2000 ). In influenza viruses, where the HA protein mediates virus entry into cells by a low pH-induced membrane-fusion event in endosomal vesicles, the fusion activity of the HA is dependent on its being cleaved and the susceptibility of cleavage of the HA has been correlated with virulence of virus in tissue culture and in animals (Palese & García-Sastre, 1999 ). Influenza virions with uncleaved HA are non-infectious (Klenk & Rott, 1988 ). It can therefore be speculated that the molecular basis for the ISAV CHSE phenotypes may be associated with the fusion protein encoded by a gene separate from the HA gene. However, there is anecdotal evidence as well of ISAV in both apparently normal and sick farmed Atlantic salmon that can be detected by RTPCR but not by virus isolation using presently available fish cell lines (Kibenge et al., 2001 ). The inference that the ISAV HA gene may not be correlated with virulence of the virus in tissue culture is further supported by observations that HA gene sequences directly amplified by RTPCR either from an apparently normal fish (Can-16, accession no. AF297551) or from diseased fish (Selje A12 sample; Rimstad et al., 2001 ) from which virus could not be isolated using SHK-1 cells were similar to the American and European HA subtypes, respectively. In fact, the Can-16 HA amino acid sequence differed from the American HA subtype only at residue 143, with the substitution of a serine for leucine (see full alignment available at https://vir.sgmjournals.org/). Thus, more in-depth analysis is necessary to clarify the molecular basis of the CHSE phenotypes of ISAV, particularly since, in many viruses, such tropism is associated with a single residue.

The limited amino acid sequence identity between the HA of ISAV and members of the four established genera of the family Orthomyxoviridae (Fig. 1) is interesting. For the sequences from Influenzavirus A, Influenzavirus C and Thogotovirus, the sequence similarity was due to the N-terminal region of ISAV HA, spanning amino acid residues 24140 while, in the sequence from Influenzavirus B, it spanned amino acid residues 203264 of the ISAV HA. The functional significance of these regions is not known. To view the relationships among the ISAV sequences and the HA sequences of the established orthomyxoviruses, we constructed a phylogenetic tree (Fig. 4). It is interesting that Can-1 and Can-13, which represent the two ISAV HA subtypes, showed significant grouping, as did Influenzavirus A and Influenzavirus B. Although the ISAV sequences appear to be related more closely to Influenzavirus A and Influenzavirus B than to the other sequences, this grouping was often not observed using other alignment and tree-building techniques and further supports the suggestion that ISAV be assigned to a new genus within Orthomyxoviridae.

In conclusion, we show that the ISAV isolates vary significantly in the putative HA gene and that this genetic variation is correlated with antigenic variation revealing two HA subtypes, one American and one European. The two HA subtypes have a nucleotide sequence identity of only 79·4% and amino acid sequence identity of 84·5% whereas, within each subtype, the sequence identities are 90·7% or higher.

We thank the following for supplying us with the ISAV isolates: Dr Steve Griffiths [Research and Productivity Council (RPC), Fredericton, New Brunswick, Canada], Dr Carmencita Yason (Regional Diagnostic Virology Laboratory, Atlantic Veterinary College, Charlottetown, PEI, Canada), Dr Heidrun Wergeland (Bergen High Technology Center, Bergen, Norway), Dr Knut Falk (National Veterinary Institute, Oslo, Norway), Dr Birgit Dannevig (National Veterinary Institute, Oslo, Norway) and Dr Alastair McVicar and Mrs Katrina Burnside (Fish Health Inspectorate, FRS Marine Laboratory, Aberdeen, UK). The authors wish to thank Dr Oystein Evensen (Alpharma AS) for giving access to the TO cell line. Financial support for this work was provided by a strategic grant from the Natural Sciences and Engineering Research Council of Canada, AVC Inc., Charlottetown, PEI, and Alpharma AS, Norway.

Footnotes

The GenBank accession numbers of the ISAV HA sequences reported in this paper are AF283995AF283998, AF294870AF294882, AF378179AF378181, AF388581, AF388582, AF391126 and AF395337.

References

Blake, S., Bouchard, D., Keleher, W., Optiz, M. & Nicholson, B. L. (1999). Genomic relationships of the North American isolate of infectious salmon anaemia virus (ISAV) to the Norwegian strain of ISAV. Diseases of Aquatic Organisms 35, 139-144.[Medline]

Cox, N. J., Fuller, F., Kaverin, N., Klenk, H.-D., Lamb, R. A., Mahy, B. W. J., McCauley, J., Nakamura, K., Palese, P. & Webster, R. (2000). Family Orthomyxoviridae In Virus Taxonomy. Seventh Report of the International Committee on Taxonomy of Viruses , pp. 585-597. Edited by M. H. V. van Regenmortel, C. M. Fauquet, D. H. L. Bishop, E. B. Carstens, M. K. Estes, S. M. Lemon, J. Maniloff, M. A. Mayo, D. J. McGeoch, C. R. Pringle & R. B. Wickner. San Diego:Academic Press.

Cunningham, C. O. & Snow, M. (2000). Genetic analysis of infectious salmon anaemia virus (ISAV) from Scotland. Diseases of Aquatic Organisms 41, 1-8.[Medline]

Falk, K., Namork, E., Rimstad, E., Mjaaland, S. & Dannevig, B. H. (1997). Characterization of infectious salmon anemia virus, an orthomyxo-like virus isolated from Atlantic salmon (Salmo salar L.). Journal of Virology 71, 9016-9023.[Abstract/Free Full Text]

Feldmann, H., Kretzschmar, E., Klingeborn, B., Rott, R., Klenk, H. D. & Garten, W. (1988). The structure of serotype H10 hemagglutinin of influenza A virus: comparison of an apathogenic avian and a mammalian strain pathogenic for mink. Virology 165, 428-437.[Medline]

Griffiths, S., Cook, M., Mallory, B. & Ritchie, R. (2001). Characterisation of ISAV proteins from cell culture. Diseases of Aquatic Organisms 45, 19-24.[Medline]

Inglis, J. A., Bruce, J. & Cunningham, C. O. (2000). Nucleotide sequence variation in isolates of infectious salmon anaemia virus (ISAV) from Atlantic salmon Salmo salar in Scotland and Norway. Diseases of Aquatic Organisms 43, 71-76.[Medline]

Kibenge, F. S. B., Dybing, J. K. & McKenna, P. K. (1991). Rapid procedure for large-scale isolation of plasmid DNA. Biotechniques 11, 65-67.[Medline]

Kibenge, F. S. B., Lyaku, J. R., Rainnie, D. & Hammell, K. L. (2000). Growth of infectious salmon anaemia virus in CHSE-214 cells and evidence for phenotypic differences between virus strains. Journal of General Virology 81, 143-150.[Abstract/Free Full Text]

Kibenge, F. S. B., Garate, O. N., Johnson, G., Arriagada, R., Kibenge, M. J. T. & Wadowska, D. (2001). Isolation and identification of infectious salmon anaemia virus (ISAV) from Coho salmon in Chile. Diseases of Aquatic Organisms 45, 9-18.[Medline]

Klenk, H.-D. & Rott, R. (1988). The molecular biology of influenza virus pathogenicity. Advances in Virus Research 34, 247-281.[Medline]

Krossøy, B., Hordvik, I., Nilsen, F., Nylund, A. & Endresen, C. (1999). The putative polymerase sequence of infectious salmon anemia virus suggests a new genus within the Orthomyxoviridae. Journal of Virology 73, 2136-2142.[Abstract/Free Full Text]

Krossøy, B., Devold, M., Sanders, L., Knappskog, P. M., Aspehaug, V., Falk, K., Nylund, A., Koumans, S., Endresen, C. & Biering, E. (2001a). Cloning and identification of the infectious salmon anaemia virus haemagglutinin. Journal of General Virology 82, 1757-1765.[Abstract/Free Full Text]

Krossøy, B., Nilsen, F., Falk, K., Endresen, C. & Nylund, A. (2001b). Phylogenetic analysis of infectious salmon anaemia virus isolates from Norway, Canada and Scotland. Diseases of Aquatic Organisms 44, 1-6.[Medline]

Matsuzaki, Y., Mizuta, K., Kimura, H., Sugawara, K., Tsuchiya, E., Suzuki, H., Hongo, S. & Nakamura, K. (2000). Characterization of antigenically unique influenza C virus strains isolated in Yamagata and Sendai Cities, Japan, during 19921993. Journal of General Virology 81, 1447-1452.[Abstract/Free Full Text]

Mjaaland, S., Rimstad, E., Falk, K. & Dannevig, B. H. (1997). Genomic characterization of the virus causing infectious salmon anemia in Atlantic salmon (Salmo salar L.): an orthomyxo-like virus in a teleost. Journal of Virology 71, 7681-7686.[Abstract/Free Full Text]

Palese, P. & García-Sastre, A. (1999). Influenza viruses (Orthomyxoviridae): molecular biology In Encyclopedia of Virology , pp. 830-836. Edited by A. Granoff & R. G. Webster. San Diego:Academic Press.

Pearson, W. R. & Lipman, D. J. (1988). Improved tools for biological sequence comparison. Proceedings of the National Academy of Sciences, USA 85, 2444-2448.[Abstract/Free Full Text]

Rimstad, E., Mjaaland, S., Snow, M., Mikalsen, A. B. & Cunningham, C. O. (2001). Characterization of the infectious salmon anemia virus genomic segment that encodes the putative hemagglutinin. Journal of Virology 75, 5352-5356.[Abstract/Free Full Text]

Ritchie, R. J., Cook, M., Melville, K., Simard, N., Cusack, R. & Griffiths, S. (2001). Identification of infectious salmon anaemia virus in Atlantic salmon from Nova Scotia (Canada): evidence for functional strain differences. Diseases of Aquatic Organisms 44, 171-178.[Medline]

Saitou, N. & Nei, M. (1987). The neighbor-joining method: a new method for reconstructing phylogenetic trees. Molecular Biology and Evolution 4, 406-425.[Abstract]

Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning: A Laboratory Manual, 2nd edn. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.

Schneider-Schaulies, J. (2000). Cellular receptors for viruses: links to tropism and pathogenesis. Journal of General Virology 81, 1413-1429.[Free Full Text]

Snow, M. & Cunningham, C. O. (2001). Characterisation of the putative nucleoprotein gene of infectious salmon anaemia virus (ISAV). Virus Research 74, 111-118.[Medline]

Stothard, P. (2000). The sequence manipulation suite: JavaScript programs for analyzing and formatting protein and DNA sequences. Biotechniques 28, 1102-1104.[Medline]

Thompson, J. D., Higgins, D. G. & Gibson, T. J. (1994). CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Research 22, 4673-4680.[Abstract/Free Full Text]

Thompson, J. D., Gibson, T. J., Plewniak, F., Jeanmougin, F. & Higgins, D. G. (1997). The CLUSTAL X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Research 25, 4876-4882.[Abstract/Free Full Text]

Webster, R. G., Bean, W. J., Gorman, O. T., Chambers, T. M. & Kawaoka, Y. (1992). Evolution and ecology of influenza A viruses. Microbiological Reviews 56, 152-179.[Abstract/Free Full Text]

Wergeland, H. I. & Jakobsen, R. A. (2001). A salmonid cell line (TO) for production of infectious salmon anaemia virus (ISAV). Diseases of Aquatic Organisms 44, 183-190.[Medline]

Received 10 May 2001; accepted 9 August 2001.