Research Article

The UL14 protein of herpes simplex virus type 2 translocates the minor capsid protein VP26 and the DNA cleavage and packaging UL33 protein into the nucleus of coexpressing cells

Journal of General Virology 2001; 82(2):321

PubMed

Abstract

The herpes simplex virus type 2 (HSV-2) gene UL14 encodes a 32 kDa protein which is a minor component of the virion tegument and is expressed late in infection. The UL14 protein shows varied localization patterns in HSV-2-infected and singly expressing cells, suggesting the possibility that it is multifunctional. We have investigated the influence of the UL14 protein on the intracellular localization of capsid proteins and DNA cleavage and packaging proteins in coexpressing cells. VP26 is the minor capsid protein; it binds to hexons of the outer capsid shell and is predominantly cytoplasmic upon sole expression. We have found that VP26 coexpressed with the UL14 protein showed mutual and predominant relocation into the nucleus. At least seven viral genes encode proteins (UL6, UL15, UL17, UL25, UL28, UL32 and UL33) that are required for DNA cleavage and packaging. We have found that the UL33 protein, which was also cytoplasmic by sole expression, was relocated to the nucleus upon expression with the UL14 protein, which again seemed to be a result of mutual influence. Coexpression experiments also suggested the possibility of a mutual influence between the UL14 and UL17 proteins, and the UL17 protein and VP26. Our results suggest that the UL14 protein can influence the intracellular localization patterns of a number of proteins belonging to the capsid or the DNA encapsidation machinery.
The herpes simplex virus type 2 (HSV-2) genome contains at least 74 different protein-coding genes (Dolan et al., 1998 ; McGeoch et al., 1988 ; Roizman & Sears, 1996 ). Approximately half are essential for virus replication in cell cultures (Roizman, 1996 ). The UL14 gene is conserved in the alphaherpesviruses, and the coding region overlaps that of UL13, which encodes a protein kinase (Dolan et al., 1998 ; Daikoku et al., 1997 ). Homologues are also detected in betaherpesviruses and gammaherpesviruses, including human cytomegalovirus (HCMV), human herpesvirus-6 and EpsteinBarr virus (Chee et al., 1990 ; Gompels et al., 1995 ; Baer et al., 1984 ). The UL14 protein was thought to be essential for replication in cell culture, but it has been recently reported that a UL14 mutant virus replicates to near wild-type levels, although showing a prolonged cycle. The protein has been identified as a minor component of the virion tegument (Cunningham et al., 2000 ), but its functions remain largely unknown.

During the replication cycle of HSV, the large concatemeric products of DNA replication are cleaved into unit length and packaged into preassembled capsids. Capsids are icosahedral structures and the outer shell is principally composed of four proteins: the major capsid protein, VP5; a small protein bound to hexons, VP26; and a triplex structure made up of heterotrimers of VP19c and VP23. VP24, VP21 and VP22a are found in the interior of the capsid. VP21 and VP22a are present only in B capsids and make up the scaffold. Although VP26 is dispensable for assembly (Tatman et al., 1994 ; Thomsen et al., 1995 ; Desai et al., 1998 ), it is incorporated into the capsid in large amounts. The native capsid (a T=16 icosahedron) contains 900 copies of VP26: six on each of the 150 hexons of VP5, but none on the 12 VP5 pentons at its vertices (Wingfield et al., 1997 ). Three types of capsids (A, B and C) can be isolated from infected cells by sucrose gradient sedimentation (Gibson & Roizman, 1972 ). C capsids contain the viral DNA genome, B capsids contain the scaffolding protein, and A capsids lack both DNA and the scaffolding protein (Perdue et al., 1976 ).

At least seven genes encode proteins (UL6, UL15, UL17, UL25, UL28, UL32 and UL33) that are required for the DNA cleavage and packaging process, in which replicated concatemeric DNA is cleaved into unit-size monomers and encapsidated into preformed C capsids (Salmon et al., 1998 ). Mutant viruses defective in UL6, UL15, UL17, UL28, UL32 or UL33 are defective in DNA cleavage and packaging, and cells infected with these mutants produce only B capsids (al-Kobaisi et al., 1991 ; Baines et al., 1997 ; Lamberti & Weller, 1996 , 1998 ; Patel et al., 1996 ; Salmon et al., 1998 ; Tengelsen et al., 1993 ; Yu et al., 1997 ). It has been reported that the UL17 gene is required for correct targeting of capsids and major and minor capsid proteins to the DNA replication compartment of infected cells (Taus et al., 1998 ).

The capsid is surrounded by a proteinaceous layer of variable thickness, called the tegument, and the entire structure is bounded by the viral envelope, a spherical lipid bilayer containing 12 or more different glycoproteins (Steven & Spear, 1997 ). The precise roles of many tegument proteins have not been determined, but it seems evident that the capsid and tegument will form specific interactions, although these have not been established to date (Zhou et al., 1999 ).

The current studies were undertaken to identify possible interactions between the HSV-2 UL14 protein and capsid proteins or DNA cleavage and packaging proteins.

Cells.
African green monkey kidney Vero cells were propagated in Eagles minimum essential medium containing 5% calf serum.

Plasmids.
For expression of a FLAG-tagged version of the UL6, UL25 and UL33 proteins and VP26, forward and reverse PCR primers UL6-1, UL6-2, UL25-1, UL25-2, UL33-1, UL33-2, UL35-1 and UL35-2 were made (suffix 1 corresponding to a forward primer, and 2 to a reverse primer). The plasmid pFLAG-CMV-5a (Sigma) expresses the gene of interest under the control of the HCMV immediate early promoter. HindIII and BamHI sites were incorporated into each of the forward and reverse primers respectively. The ORFs of each gene in the HSV-2 genome are UL6 (1524817284), UL25 (4903750794), UL33 (6963770029) and UL35 (7106171399). The primer sequences are as follows: UL6-1, ACCCAAGCTTATGGCCGCACAGCGCG; UL6-2, CACGGGATCCTCGGCGGGCGTGGGGTCG; UL25-1, ACCCAAGCTTATGGACCCGTACTACCCTT; UL25-2, CACGGGATCCGGCCACGGACAGGTACTGGG; UL33-1, CCCAAAGCTTATGGCCGGTCGAGCGGGG; UL33-2, TAGAGGATCCGCCCCGCAGGATCTGGTGCA; UL35-1, CCCAAAGCTTATGGCCGCCCCGCAGTTTC; and UL35-2, CGAGGGATCCCGGGGTGCTGGGGGTCTTGG. The PCR product for each pair was cloned as a HindIIIBamHI fragment into HindIII/BamHI-digested pFLAG-CMV-5a to generate pFLAG-UL6, pFLAG-UL25, pFLAG-UL33 and pFLAG-UL35, each of which expresses a version of the UL6, UL25 or UL33 proteins or VP26 tagged with a FLAG epitope (Asp-Tyr-Lys-Asp-Asp-Asp-Asp-Lys) at its C terminus.

For expression of the UL17 protein, forward primer UL17-1, with a BamHI site (ACTCGGATCCATGAACGCGCACTTTGCCAA), and reverse primer UL17-2, with a HindIII site (CATTAAGCTTTCAGCGGACAAGGCCGGGT), were made. The UL17 ORF is located between nucleotide positions 31362 and 33471. For expression of the UL19 protein, forward primer UL19-1, with a BamHI site (CCCAGGATCCATGGCCGCTCCTGCCCGCG), and reverse primer UL19-2, with an EcoRI site (CACAGAATTCTTACAGAGACAGGCCCTTTAG), were made. The UL19 ORF is located between nucleotide positions 36448 and 40572. The PCR products were ligated into the multicloning site (MCS) of pcDNA3.1(-) (Invitrogen) to generate pcDNA3-UL17 and pcDNA3-UL19 under the control of the HCMV promoter. Similarly, for expression of the UL29 protein, primers UL29f, with a BamHI site (CGGGATCCATGGACACCAAGCCCAAAACG), and UL29r, with an EcoRI site (CGGATTCCTAGAGCATATCCAACGTCAG), were made. For expression of the UL42 protein, primers UL42f, with an EcoRI site (AGCGTGAATTCATGGCTCATCTTC), and UL42r, with a HindIII site (ACCCGAAGCTTTCAGGGCAACCC), were made. The ORF of UL29 is from nucleotide positions 58857 to 62447 and the UL42 ORF is from 93769 to 95181. The PCR products were ligated into pcDNA3.1(+).

Construction of deletion mutants of the UL14 protein.
For expression of N terminus and C terminus deletion mutants of the UL14 protein, plasmids pcDNA3-UL14Δ40N, pcDNA3-UL14Δ80N and pcDNA3-UL14Δ40C were constructed. The forward PCR primers for the N terminus deletion plasmids and the incorporated restriction enzyme sites are UL14-40F (GTGAAAGCTTAAATGCCTAGGTTTG/HindIII) and UL14-80F (TGTGAAGCTTTTATGCTAAAGTCCC/HindIII). The reverse primer is C14R (GACGGGATCCTCACTCGCCATCGGG/BamHI). The forward and reverse primers for the C terminus deletion mutant are UL14F (GGGCGAATTCATGAGCCGAGACGCC) and UL14-40R (CTTGGGCCTCGAGTGACCCGGCGGC), with an EcoRI and XhoI site respectively. The PCR products were ligated into pcDNA3.1(+).

Antibodies.
Anti-UL14 and anti-UL42 polyclonal antisera were produced in rabbits by immunization with E. coli-expressed, 6xHis-tagged HSV-2 proteins as previously described (Wada et al., 1999 ). Anti-UL17 polyclonal antiserum was produced as previously described (Goshima et al., 2000 ). The anti-FLAG monoclonal antibody (Sigma) recognizes an 8 amino acid sequence (Asp-Tyr-Lys-Asp-Asp-Asp-Asp-Lys) located following the KpnI site in the MCS of the pFLAG-CMV-5a vector. Mouse monoclonal antibodies for UL19 and UL29 have been described previously (Goshima et al., 2000 ; Wada et al., 1999 ). Anti-UL14 mouse polyclonal antibody was produced in mice by inoculation of plasmid DNA encoding the gene, three times at 2 week intervals, into the abdominal epidermis of BALB/c female mice with a gene gun (Bio-Rad). Before inoculation, abdominal fur in the local area was removed with a depilatory agent. The inoculation contained 1 µg DNA and 1 mg of 1·6 µm-sized gold powder. Mice were anaesthetized with chloroform and then bled from the heart with a syringe. Serum was collected from the blood and used for immunofluorescence assays.

Indirect immunofluorescence.
Cells grown on coverslips in 35 mm culture dishes were transfected using the lipofectamine reagent (GibcoBRL) according to the instructions of the supplier. Incubations at 37 °C were continued for 24 h for all the immunofluorescence studies. The cells were washed with PBS and fixed in cold acetone for 5 min. Cells were blocked in 10% donkey serum in PBS for 30 min at room temperature, then the coverslips were washed in PBS before labelling with primary antibodies. Primary antibodies were used at dilutions of 1:100 (anti-FLAG, anti-VP5, anti-UL29, anti-UL42), 1:200 (anti-UL17, anti-UL14 mouse antiserum), and 1:500 to 1:1000 (anti-UL14 rabbit antiserum). Following 1 h incubation at 37 °C, coverslips were extensively washed in PBS and labelled with secondary antibodies: FITC-conjugated goat anti-rabbit IgG (FITC-GAR), TRITC-conjugated goat anti-mouse IgG (TRITC-GAM), FITC-GAM or TRITC-GAR for 1 h at 37 °C. After rinsing with PBS, the coverslips were swiftly mounted onto glass slides by using Perma Fluor (Immunon) and then analysed with Zeiss laser scanning microscope LSM510, or with the Bio-Rad MRC series confocal imaging system. Fluorescent images were obtained with 488 nm and 568 nm bandpass filters for excitation of FITC and TRITC respectively.

The mutual relocation of the UL14 protein and the minor capsid protein VP26 into the nucleus
Vero cells were cotransfected with plasmids pcDNA3-UL14 and pcDNA3-UL19, or pcDNA3-UL14 and pFLAG-UL35, and the intracellular localization of expressed proteins was observed by indirect immunofluorescence. The UL14 protein expressed alone showed varied intracellular distribution 24 h after transfection: cytoplasmic (70% of expressing cells) as in Fig. 1(c), cytoplasmic and nuclear (15%) as in Fig. 1(d) and nuclear (15%) as in Fig. 1(e).



(13K):

Fig. 1. The UL14 protein expressed alone shows varied intracellular distribution. Mock-transfected Vero cells detected with the anti-UL14 polyclonal antibody (a), and pcDNA3-UL14-transfected cells detected with preimmune serum (b). (ce) Single expression patterns of the UL14 protein detected with the anti-UL14 polyclonal antibody. The percentage of cells showing each type of distribution was approximately 70% cytoplasmic (c), 15% cytoplasmic and nuclear (d), 15% nuclear (e).

VP5, the UL19 product, is the major capsid protein, with a molecular mass of 150 kDa, and is distributed mainly in the cytoplasm when expressed by itself. Coexpression with the UL14 protein localized VP5 mostly in the cytoplasm (data not shown).

VP26, the UL35 product, is the minor capsid protein, with a molecular mass of 12 kDa, and is distributed predominantly in the cytoplasm when expressed by itself (Fig. 2b, c). It is known that coexpression with any of the four proteins, VP23 (UL18), VP5 (UL19), VP19c (UL38) or pre-VP22a (UL26.5) fails to convert VP26 to a nuclear distribution. Under multiple coexpression experiments of capsid proteins, the only case in which VP26 becomes nuclear is when VP5 is relocated into the nucleus by pre-VP22a or VP19c (Nicholson et al., 1994 ; Rixon et al., 1996 ). It is said that the transport of VP26 into the nucleus requires its direct binding to VP5, and no single capsid protein is able to transport VP26 into the nucleus. In the following, we demonstrate a mutual influence on the intracellular localization of VP26 and the UL14 protein, which converts the cytoplasmic localization of VP26 to a predominantly nuclear one.



(93K):

Fig. 2. Double-labelling immunofluorescence of Vero cells transfected with pFLAG-UL35 alone (ac), or pcDNA3-UL14 and pFLAG-UL35 (di). Cells were reacted with the anti-UL14 polyclonal antibody and anti-FLAG antibody, stained with secondary antibodies anti-rabbit FITC and anti-mouse TRITC, and then examined with confocal laser scanning microscopes as described in Methods. Cells expressing VP26 alone (ac), and a field view (df) and magnified view (gi) of cell(s) coexpressing the UL14 protein and VP26 are shown. The merged images are shown in (c), (f) and (i).

Cotransfection experiments were performed with plasmids pcDNA3-UL14 and pFLAG-UL35, and at 24 h post-transfection the localization of VP26 was examined by immunofluorescence under a laser scanning confocal microscope. In more than 75% of VP26-expressing cells, VP26 localized almost entirely in the nucleus, and in the rest it is localized throughout the cell or in the cytoplasm (data not shown). Furthermore, double-labelling immunofluorescence revealed that the UL14 protein colocalized with VP26 in the nucleus (Fig. 2di). Cells coexpressing both proteins localized VP26 mainly in the nucleus (Fig. 2e, h), and the UL14 protein was also strongly nuclear with some distribution in the cytoplasm (Fig. 2d, g). To certify that VP26 did not enter the nucleus merely by coexpression with a nuclear-destined protein, plasmid pcDNA3-UL42, which expresses a DNA replication protein, was cotransfected with pFLAG-UL35. VP26 remained predominantly in the cytoplasm and the two proteins showed non-overlapping distributions (data not shown). This meant that it was appropriate to judge the shift in VP26 localization as an inevitable result rather than an accidental outcome. Thus, we propose that the presence of the UL14 protein has a marked influence on VP26 localization.

The single-stranded DNA-binding protein encoded by the UL29 gene (ICP8) localized in the nucleus when expressed by itself. To examine whether the UL14 protein effected its intracellular distribution, pcDNA3-UL14 and pcDNA3-UL29 were cotransfected. At 24 h post-transfection, the two proteins seemed to have little or no effect on each others intracellular state (data not shown), suggesting that these two proteins did not influence each other. Our approaches with DNA replication proteins show that both the UL14 protein and VP26 did not concentrate in the nucleus upon mere coexpression with these proteins, thus reflecting a probable specific mutual relationship between the unexplained UL14 protein and the well known hexon-binding VP26.

From these results we conclude that the UL14 protein has a marked ability to translocate the minor capsid protein VP26, a cytoplasmic protein, into the nucleus. As the UL14 protein also accumulated in the nucleus upon coexpression with VP26, a mutual nuclear relocation may have taken place.

The UL14 and UL17 proteins combined show high efficiency in translocating all of VP26 into the nucleus
Immunofluorescence studies on Vero cells transfected with pcDNA3-UL17 and pFLAG-UL35 revealed to our surprise that VP26 colocalized with the UL17 protein throughout the cell with accumulation in the nuclei (Fig. 3df). This suggests that VP26 relocation into the nucleus was due to the expression of the UL17 protein. Given the smooth translocation of VP26 into the nucleus of coexpressing cells, the UL14 protein and UL17 protein appeared to share a common aspect, which could be the direct or indirect binding with VP26. In addition, the fact that only the UL14 protein was capable of translocating most of the intracellular VP26 entirely into the nucleus as in Fig. 2(h) suggests that the presence of the UL14 protein was more influential on VP26 than presence of the UL17 protein.



(60K):

Fig. 3. Double-labelling immunofluorescence of Vero cells transfected with pFLAG-UL35 (ac), or with pcDNA3-UL17 and pFLAG-UL35 without (df) or with (gi) pcDNA3-UL14. The cells were reacted with anti-UL17 polyclonal antibody and anti-FLAG antibody, stained with secondary antibodies anti-rabbit FITC and anti-mouse TRITC, and then examined with confocal laser scanning microscopes as described in Methods. Vero cells expressing VP26 alone (ac) and coexpressing the UL17 protein and VP26 in the absence (df) or probable presence (gi) of the UL14 protein are shown. The merged images are shown in (c), (f) and (i).

We have found that VP26 localized in the nucleus when either the UL14 or UL17 protein coexisted. Since the UL14 and UL17 proteins seem to be related in their properties regarding VP26, it was anticipated that a mutual influence existed among the three proteins. To look into this hypothesis and to examine any noticeable difference in VP26 localization with the presence of both UL14 and UL17 proteins, Vero cells were triply transfected with pcDNA3-UL14, pcDNA3-UL17 and pFLAG-UL35. The intracellular localization of VP26 was examined by indirect immunofluorescence. When both the UL14 and UL17 genes were transfected, VP26 seemed to be much more efficiently located in the nucleus. To examine this under our experimentation, the UL17 protein and VP26 were double-labelled and examined. The localization of the UL17 protein and VP26 upon double expression (Fig. 3df) shifts to nuclear by additional expression of the UL14 protein (Fig. 3gi). It was assumed that the cells were expressing the UL14 protein by the exclusive nuclear staining patterns of the UL17 protein and VP26. Together with our cotransfection experiments of pcDNA3-UL14/pFLAG-UL35 and pcDNA3-UL14/pcDNA3-UL17, it can be said that in the presence of the UL14 protein, both VP26 and the UL17 protein accumulate in the nuclei (Fig. 3gi). Thus, the UL17 protein may support the UL14 protein in the nuclear translocation of VP26.

The UL14 protein influences the intracellular localization of cleavage and packaging proteins encoded by the UL17 and UL33 genes
In cotransfection assays of pcDNA3-UL14 and pcDNA3-UL17, the nuclear aggregation of the UL17 protein was notable (Fig. 4di) compared with expression by itself (Fig. 4ac). Though UL17 expressed on its own is in part already nuclear (Fig. 4a), the amount of cytoplasmic UL17 protein decreased when the UL14 protein was coexpressed in the cell (Fig. 4d, g). In such cotransfected cells, both proteins colocalized in the nucleus (Fig. 4 f and i). Fig. 4(g, h and i) shows a good example of a coexpressing cell. The UL17 protein is both cytoplasmic and nuclear (Fig. 4g), and colocalizes with the UL14 protein (Fig. 4h) in the nucleus (Fig. 4i). This nuclear staining pattern of the UL17 protein was not seen upon sole expression, whereas a similar pattern was observed in the nuclear localization of the UL14 protein as in Fig. 1(d), thus suggesting the influence of the UL14 protein on nuclear localization of the UL17 protein.



(77K):

Fig. 4. Double-labelling immunofluorescence of Vero cells transfected with pcDNA3-UL17 alone (ac), or pcDNA3-UL17 and pcDNA3-UL14 (di). Cells were reacted with anti-UL17 polyclonal antibody and anti-UL14 monoclonal antibody, stained with secondary antibodies anti-rabbit FITC and anti-mouse TRITC, and then examined with confocal laser scanning microscopes as described in Methods. Cells expressing the UL17 protein alone (ac), and a field view (df) and magnified view (gi) of cells coexpressing the UL14 and UL17 proteins are shown. The merged images are shown in (c), (f) and (i).

Intrigued by the fact that the UL14 protein showed signs of affecting the nuclear distribution of a DNA cleavage and packaging protein, we examined if other cleavage and packaging proteins (UL6, UL25, UL33) would act similarly. The UL6 and UL25 proteins were chosen, as these were known to associate firmly with B and C capsids (Ali et al., 1996 ; Patel & MacLean, 1995 ). Alongside the UL17 and UL28 proteins, the UL6 protein is required for the association of the UL15-encoded proteins with B capsids (Salmon & Baines, 1998 ). The UL25 protein is required for encapsidation but not for cleavage of viral DNA (McNab et al., 1998 ). Transfection of pcDNA3-UL14 was carried out with plasmids pFLAG-UL6, pFLAG-UL25 and pFLAG-UL33, each expressing a version of the cleavage and packaging proteins UL6, UL25 and UL33 with the FLAG epitope tagged to its C terminus.

In cotransfected cells, the localization of the UL6 protein (data not shown) was unaffected. The UL25 protein expressed alone localized in the cytoplasm (Fig. 5a). This did not change when the UL14 protein was coexpressed (Fig. 5e, i). Alternatively, the UL14 protein colocalized in the cytoplasm when coexpressed with the UL25 protein (Fig. 5c, g, i). In contrast, the UL33 protein was relocated completely into the nucleus upon coexpression with the UL14 protein (Fig. 5f, j). It was striking that when expressed alone, the UL33 protein localized predominantly in the cytoplasm in rod-shaped or round-shaped particles (Fig. 5b). Coexpression with the UL14 protein translocated the UL33 protein into the nucleus in dots (Fig. 5f). The proteins mostly colocalized in the nucleus (Fig. 5j), though in some, the UL14 protein surrounded the UL33 protein (Fig. 5h). From the above, we conclude that the UL14 and UL33 proteins are relocated into the nucleus by mutual influence.



(37K):

Fig. 5. Immunofluorescent images of Vero cells transfected with pFLAG-UL25 alone (a), pFLAG-UL33 alone (b), or with pcDNA3-UL14 and pFLAG-UL25 (c, e, g, i) or pcDNA3-UL14 and pFLAG-UL33 (d, f, h, j). Cells were reacted with anti-FLAG antibody (a, b) or with anti-UL14 polyclonal antibody and anti-FLAG antibody (cj), stained with the appropriate secondary antibodies, and then examined with confocal laser scanning microscopes as described in Methods. A field view (i) and magnified view (c, e, g) of cell(s) coexpressing the UL14 and UL25 proteins and a field view (j) and magnified view (d, f, h) of cells coexpressing the UL14 and UL33 proteins are shown. Fluorescence in the field views (i) and (j) are FITC (the UL14 protein) and TRITC (the FLAG-tagged protein). For convenience, transfected genes are shown in white in the top-left corner of the panels, and antisera used to visualize proteins are shown in yellow in the bottom-left corner of the panels. Panels (g) and (h) are merged images of (c) and (e), and (d) and (f) respectively. Panels (i) and (j) are field view (FV) merged images.

Quantification of VP26 localization in coexpressing cells and deletion mutant analysis of the UL14 protein
To compare the efficiency of VP26 relocation into the nucleus by the UL14 and UL17 proteins, cells expressing (i) VP26, (ii) VP26 and the UL14 protein, (iii) VP26, the UL14 and UL17 proteins, or (iv) VP26 and the UL17 protein were each observed by staining VP26. Next, the type of intracellular localization (cytoplasmic, cytoplasmic and nuclear, nuclear) of VP26 was quantified in 200 cells in each assay (Fig. 6). In singly expressing cells, VP26, the UL35 gene product, was predominantly cytoplasmic. A decline in this cytoplasmic distribution was observed by coexpression of the UL14 protein, and predominantly nuclear VP26 was seen in 75% of expressing cells. Furthermore, by additional expression of the UL17 protein, nuclear VP26 levels rose to over 90%. This is an interesting result considering that VP26 was predominantly cytoplasmic under single expression and is also consistent with the fact that capsid assembly occurs in the nuclei of cells.



(13K):

Fig. 6. A histogram displaying the population of localization of VP26 in various cotransfection experiments. Horizontal axis from left: transfection of pFLAG-UL35, pFLAG-UL35/pcDNA3-UL14, pFLAG-UL35/pcDNA3-UL14/pcDNA3-UL17, pFLAG-UL 35/pcDNA3-UL17, pFLAG-UL35/pcDNA3-UL14Δ80N, pFLAG-UL35/pcDNA3-UL14Δ80N/pcDNA3-UL17. The bars represent the percentage of intracellular VP26 localization (cytoplasm, predominantly cytoplasmic; C+N, cytoplasmic and nuclear; nucleus, predominantly nuclear) in the 200 cells counted in each cotransfection assay. The presence of the UL14 and UL17 proteins markedly increased nuclear VP26. An N-terminal deletion of 80 amino acids of the UL14 protein abrogated VP26 relocation into nuclei.

To examine which part of the UL14 protein was crucial for the translocation of VP26 and the UL33 protein into the nucleus, plasmids pcDNA3-UL14Δ40N, pcDNA3-UL14Δ80N and pcDNA3-UL14Δ40C were constructed (see Methods). These plasmids produce N terminus and C terminus deletion mutants of the UL14 protein of 40 or 80 amino acids. First, pcDNA3-UL14Δ80N was coexpressed with VP26, or with VP26 and the UL17 protein, and VP26 localization was quantified as above. In contrast, VP26 remained predominantly cytoplasmic in both assays (Fig. 6).

Next, the UL14 deletion mutant proteins were coexpressed with either VP26 or the UL33 protein and their localization was examined after 24 h. The intracellular localization patterns of the deletion mutants are shown in Fig. 7 (column 1). The predominantly nuclear localization observed in the wild-type UL14 protein could not be seen in any of the mutants. The mutant which lacks 80 amino acids from the N terminus failed to translocate VP26 to the nucleus (Fig. 7, column 2), whereas the UL33 protein, though less effectively, was still relocated (Fig. 7, column 3). VP26 was still fully relocated to the nucleus by a 40 amino acid deletion from the N terminus, and the C terminus deletion mutant translocated VP26 into the nucleus but failed to translocate the UL33 protein.



(9K):

Fig. 7. Effects of deletions of the UL14 protein on relocation of VP26 (UL35) and the UL33 protein. pFLAG-UL35 or pFLAG-UL33 was cotransfected with pcDNA3-UL14Δ40N, pcDNA3-UL14Δ80N or pcDNA3-UL14Δ40C respectively. The proteins were detected by double-labelling immunofluorescence as described in Methods. Column 1 shows the intracellular localization of the UL14 wild-type protein or the UL14 deletion mutants when singly expressed. The localization of VP26 and the UL33 protein upon one-to-one coexpression with one of the UL14 deletion mutants is shown in columns 2 and 3 respectively. The efficiency of the deletion mutants to relocate either VP26 or the UL33 protein into the nucleus in coexpressing cells is shown in comparison to that of the wild-type UL14 protein, which was signified as +++. The efficiency was graded from - to +++, depending on the extent of the relocation into the nucleus. C, cytoplasmic; CN, cytoplasmic and nuclear; N, nuclear.
We have demonstrated that a single protein, UL14, possibly interacts with and also influences the translocation of two predominantly cytoplasmic proteins (VP26 and UL33) into the nucleus. All experiments were done in coexpression systems so our results may not reflect truly the actual dynamics which take place in infected cells. Even so, we believe our results to be highly suggestive of proteinprotein relationships that occur in vivo. So far, a protein with the potential to influence the intracellular localization of both capsid proteins and cleavage and packaging proteins has not been identified, but our evidence implies that the UL14 protein is the first. We think it is meaningful that there may be a link between these two important properties.

As a result of UL14 translocation, VP26 and the UL33 protein both localized neatly in the nuclei of coexpressing cells and often colocalized with the UL14 protein. Although in about 17% of the 200 cells counted VP26 colocalized with the UL14 protein in the cytoplasm, the presence of the UL17 protein reduced this to about 5% (Fig. 6), suggesting a supportive role for the UL17 protein in VP26 translocation. By multiple expression of the UL14 and UL17 proteins, VP26 and VP5, the amount of VP26 that remained in the cytoplasm increased (data not shown). This was probably because VP5VP26 binding in the cytoplasm prevented nuclear transport. No such effect was observed with the UL33 protein (data not shown). Deletion mutants of the UL14 protein suggested that VP26 and the UL33 protein seemed to require different domains of the UL14 protein for their distribution changes.

A region rich in basic amino acids (KSRAR) exists between the 62nd and 66th amino acids from the N terminus of the UL14 protein and this region may act as the nuclear localization signal. In almost all the cells coexpressing the UL14 and UL33 proteins, the UL33 protein localized in the nucleus. The amount of UL33 protein taken into the nucleus decreased as amino acids were deleted from the N terminus of the UL14 protein. This was observed by coexpressing the UL33 protein with UL14 protein deletions of 20 and 60 amino acids at its N terminus (data not shown). Therefore, the UL33 protein seemed to require amino acids at the N terminus of the UL14 protein as well as the 40 amino acids at the C end, but the role for the N- and C-terminal portion in maintaining translocational functions of the UL14 protein could not be distinguished. When the UL33 protein localized in the nucleus, the UL14 protein was often found throughout the cell and colocalized with the UL33 protein in the nucleus.

VP26 influenced the UL14 protein as the dotted patterns of the UL14 protein were not seen in singly expressed cells. Similar results were found with the UL33 protein, and in some cells the UL33 protein colocalized with the UL14 protein in the cytoplasm in particles similar to those observed when the UL33 protein was expressed by itself (data not shown). The circular pattern of the UL14 protein led us to consider a possible relationship with the nuclear membrane.

We have previously shown that the UL14 protein associates with intracellular capsids isolated from HSV-2-infected cells and it has been recently reported that the UL14 product is present in the virion as a minor component of the tegument (Cunningham et al., 2000 ). The effects that we have seen by coexpression of proteins concern the UL14 protein and capsid proteins or DNA cleavage and packaging proteins. Capsid formation and DNA cleavage and packaging are vital for virus replication, and the mutual relationships suggest an important role for the UL14 protein, such as a mediator of the two mechanisms. A possible mutual influence between the UL14 and UL17 proteins and VP26 suggests that the UL17 protein may require the UL14 protein for its interaction with capsids. Cellular factors must not be forgotten but it is beyond the boundaries of this study to discuss them in this text. Other DNA cleavage and packaging proteins such as the UL6 and UL25 proteins are known to associate tightly with B and C capsids (Ali et al., 1996 ; Patel & MacLean, 1995 ). In our experiments, the UL14 protein seemed to have no relation to the UL6 protein, at least on a one-to-one basis. Though UL14 protein localization was affected by coexpression of the UL25 protein, UL25 protein localization did not change. All the possible relationships found in this study are summarized in Fig. 8: at the centre is the UL14 protein that brings about clear changes in the intracellular localization of at least three proteins. The versatile localization of UL14 protein in singly expressed cells led us to the presumption that it may be a multifunctional protein, and this was supported in this study. Further investigation is needed to clarify the precise role of the UL14 protein in infection.



(13K):

Fig. 8. A summary of possible interactions among the proteins investigated in this study. The genes written in green encode capsid proteins and the genes written in blue encode DNA cleavage and packaging proteins. The UL29 gene, which is written in brown, encodes the DNA replication protein ICP8. Proteins that influence each other are joined with a line. The thicker lines represent apparently stronger relationships and the significant ones reported in this study are in red. Proteins that appear to have no relation (such as UL14 and UL29) are not joined. Note that the previously described interaction between VP5 and VP26 is not included.
We thank E. Iwata and T. Tsuruguchi for technical assistance. This work was supported by a grant from the Japan Society for the Promotion of Science (JSPS-RFTF97L00703) and also by a Grant-in-Aid for Scientific Research from the Ministry of Education, Science, and Culture of Japan.

References

Ali, M. A., Forghani, B. & Cantin, E. M.(1996). Characterization of an essential HSV-1 protein encoded by the UL25 gene reported to be involved in virus penetration and capsid assembly. Virology 216, 278-283.[Medline]

al-Kobaisi, M. F., Rixon, F. J., McDougall, I. & Preston, V. G.(1991). The herpes simplex virus UL33 gene product is required for the assembly of full capsids. Virology 180, 380-388.[Medline]

Baer, R., Bankier, A. T., Biggin, M. D., Deininger, P. L., Farrell, P. J., Gibson, T. J., Hatfull, G., Hudson, G. S., Satchwell, S. C., Seguin, C. & others (1984). DNA sequence and expression of the B95-8 EpsteinBarr virus genome. Nature 310, 207211.[Medline]

Baines, J. D., Cunningham, C., Nalwanga, D. & Davison, A.(1997). The U(L)15 gene of herpes simplex virus type 1 contains within its second exon a novel open reading frame that is translated in frame with the U(L)15 gene product. Journal of Virology 71, 2666-2673.[Abstract]

Chee, M. S., Bankier, A. T., Beck, S., Bohni, R., Brown, C. M., Cerny, R., Horsnell, T., Hutchison, C. A., III, Kouzarides, T., Martignetti, J. A. & others (1990). Analysis of the protein-coding content of the sequence of human cytomegalovirus strain AD169. Current Topics in Microbiology and Immunology 154, 125169.[Medline]

Cunningham, C., Davison, A. J., MacLean, A. R., Taus, N. S. & Baines, J. D.(2000). Herpes simplex virus type 1 gene UL14: phenotype of a null mutant and identification of the encoded protein. Journal of Virology 74, 33-41.[Abstract/Free Full Text]

Daikoku, T., Shibata, S., Goshima, F., Oshima, S., Tsurumi, T., Yamada, H., Yamashita, Y. & Nishiyama, Y.(1997). Purification and characterization of the protein kinase encoded by the UL13 gene of herpes simplex virus type 2. Virology 235, 82-93.[Medline]

Desai, P., DeLuca, N. A. & Person, S.(1998). Herpes simplex virus type 1 VP26 is not essential for replication in cell culture but influences production of infectious virus in the nervous system of infected mice. Virology 247, 115-124.[Medline]

Dolan, A., Jamieson, F. E., Cunningham, C., Barnett, B. C. & McGeoch, D. J.(1998). The genome sequence of herpes simplex virus type 2. Journal of Virology 72, 2010-2021.[Abstract/Free Full Text]

Gibson, W. & Roizman, B.(1972). Proteins specified by herpes simplex virus 8. Characterization and composition of multiple capsid forms of subtypes 1 and 2. Journal of Virology 10, 1044-1052.[Abstract/Free Full Text]

Gompels, U. A., Nicholas, J., Lawrence, G., Jones, M., Thomson, B. J., Martin, M. E., Efstathiou, S., Craxton, M. & Macaulay, H. A.(1995). The DNA sequence of human herpesvirus-6: structure, coding content, and genome evolution. Virology 209, 29-51.[Medline]

Goshima, F., Watanabe, D., Takakuwa, H., Wada, K., Daikoku, T., Yamada, M. & Nishiyama, Y.(2000). Herpes simplex virus UL17 protein is associated with B capsids and colocalizes with ICP35 and VP5 in infected cells. Archives of Virology 145, 1-10.[Medline]

Lamberti, C. & Weller, S. K.(1996). The herpes simplex virus type 1 UL6 protein is essential for cleavage and packaging but not for genomic inversion. Virology 226, 403-407.[Medline]

Lamberti, C. & Weller, S. K.(1998). The herpes simplex virus type 1 cleavage/packaging protein, UL32, is involved in efficient localization of capsids to replication compartments. Journal of Virology 72, 2463-2473.[Abstract/Free Full Text]

McGeoch, D. J., Dalrymple, M. A., Davison, A. J., Dolan, A., Frame, M. C., McNab, D., Perry, L. J., Scott, J. E. & Taylor, P.(1988). The complete DNA sequence of the long unique region in the genome of herpes simplex virus type 1. Journal of General Virology 69, 1531-1574.[Abstract/Free Full Text]

McNab, A. R., Desai, P., Person, S., Roof, L. L., Thomse, D. R., Newcomb, W. W., Brown, J. C. & Homa, F. L.(1998). The product of the herpes simplex virus type 1 UL25 gene is required for encapsidation but not for cleavage of replicated viral DNA. Journal of Virology 72, 1060-1070.[Abstract/Free Full Text]

Nicholson, P., Addison, C., Cross, A. M., Kennard, J., Preston, V. G. & Rixon, F. J.(1994). Localization of the herpes simplex virus type 1 major capsid protein VP5 to the cell nucleus requires the abundant scaffolding protein VP22a. Journal of General Virology 75, 1091-1099.[Abstract/Free Full Text]

Patel, A. H. & MacLean, J. B.(1995). The product of the UL6 gene of herpes simplex virus type 1 is associated with virus capsids. Virology 206, 465-478.[Medline]

Patel, A. H., Rixon, F. J., Cunningham, C. & Davison, A. J.(1996). Isolation and characterization of herpes simplex virus type 1 mutants defective in the UL6 gene. Virology 217, 111-123.[Medline]

Perdue, M. L., Cohen, J. C., Randall, C. C. & OCallaghan, D. J.(1976). Biochemical studies of the maturation of herpesvirus nucleocapsid species. Virology 74, 194-208.

Rixon, F. J., Addison, C., McGregor, A., Macnab, S. J., Nicholson, P., Preston, V. G. & Tatman, J. D.(1996). Multiple interactions control the intracellular localization of the herpes simplex virus type 1 capsid proteins. Journal of General Virology 77, 2251-2260.[Abstract/Free Full Text]

Roizman, B.(1996). The function of herpes simplex virus genes: a primer for genetic engineering of novel vectors. Proceedings of the National Academy of Sciences, USA 93, 11307-11312.[Abstract/Free Full Text]

Roizman, B. & Sears, A. E.(1996). Herpes simplex virus and their replication. In Fields Virology , pp. 1043-1107. Edited by B. N. Fields, D. M. Knipe & P. M. Howley. Philadelphia:LippincottRaven.

Salmon, B. & Baines, J. D.(1998). Herpes simplex virus DNA cleavage and packaging: association of multiple forms of U(L)15-encoded proteins with B capsids requires at least the U(L)6, U(L)17, and U(L)28 genes. Journal of Virology 72, 3045-3050.[Abstract/Free Full Text]

Salmon, B., Cunningham, C., Davison, A. J., Harris, W. J. & Baines, J. D.(1998). The herpes simplex virus type 1 U(L)17 gene encodes virion tegument proteins that are required for cleavage and packaging of viral DNA. Journal of Virology 72, 3779-3788.[Abstract/Free Full Text]

Steven, A. C. & Spear, P. G.(1997). Herpesvirus capsid assembly and envelopment. In Structural Biology of Viruses , pp. 312-351. Edited by W. Chiu, R. M. Burnett & R. Garcea. New York:Oxford University Press.

Tatman, J. D., Preston, V. G., Nicholson, P., Elliott, R. M. & Rixon, F. J.(1994). Assembly of herpes simplex virus type 1 capsids using a panel of recombinant baculoviruses. Journal of General Virology 75, 1101-1113.[Abstract/Free Full Text]

Taus, N. S., Salmon, B. & Baines, J. D.(1998). The herpes simplex virus 1 UL 17 gene is required for localization of capsids and major and minor capsid proteins to intranuclear sites where viral DNA is cleaved and packaged. Virology 252, 115-125.[Medline]

Tengelsen, L. A., Pederson, N. E., Shaver, P. R., Wathen, M. W. & Homa, F. L.(1993). Herpes simplex virus type 1 DNA cleavage and encapsidation require the product of the UL28 gene: isolation and characterization of two UL28 deletion mutants. Journal of Virology 67, 3470-3480.[Abstract/Free Full Text]

Thomsen, D. R., Roof, L. L. & Homa, F. L.(1995). Assembly of the herpes simplex virus capsid: requirement for the carboxyl-terminal twenty-five amino acids of the proteins encoded by the UL26 and UL26.5 genes. Journal of Virology 69, 3690-3703.[Abstract]

Wada, K., Goshima, F., Takakuwa, H., Yamada, H., Daikoku, T. & Nishiyama, Y.(1999). Identification and characterization of the UL14 gene product of herpes simplex virus type 2. Journal of General Virology 80, 2423-2431.[Abstract/Free Full Text]

Wingfield, P. T., Stahl, S. J., Thomsen, D. R., Homa, F. L., Booy, F. P., Trus, B. L. & Steven, A. C.(1997). Hexon-only binding of VP26 reflects differences between the hexon and penton conformations of VP5, the major capsid protein of herpes simplex virus. Journal of Virology 71, 8955-8961.[Abstract]

Yu, D., Sheaffer, A. K., Tenney, D. J. & Weller, S. K.(1997). Characterization of ICP6: lacZ insertion mutants of the UL15 gene of herpes simplex virus type 1 reveals the translation of two proteins. Journal of Virology 71, 2656-2665.[Abstract]

Zhou, Z. H., Chen, D. H., Jakana, J., Rixon, F. J. & Chiu, W.(1999). Visualization of tegumentcapsid interactions and DNA in intact herpes simplex virus type 1 virions. Journal of Virology 73, 3210-3218.[Abstract/Free Full Text]

Received 12 July 2000; accepted 18 October 2000.