Research Article

Molecular characterization of strains of Human herpesvirus 8 from Japan, Argentina and Kuwait

Journal of General Virology 2001; 82(3):499

Abstract

Current genotyping systems for Human herpesvirus 8 (HHV-8) are based on the highly variable gene encoding the K1 glycoprotein. Most strains collected worldwide cluster into two subtypes (I/A and II/C). Sequenced African strains have belonged to subtypes I/A and IV/B. Members of all three of these subtypes can have either the M or P allele at the right-hand side (RHS) of the genome. Strains obtained predominantly from aboriginal or relatively isolated populations have formed clades that branch at a distance from subtypes I/A and II/C, all being of the RHS P allele. The characterization is reported here of 16 Japanese, two Kuwaiti and five Argentine HHV-8 strains obtained from human immunodeficiency virus-infected and non-infected patients with Kaposis sarcoma (KS), primary effusion lymphoma, multicentric Castlemans disease or renal transplants. K1 sequences of five Japanese, one Kuwaiti and two Argentine strains were identified as subtype I/A and eight Japanese, one Kuwaiti and three Argentine strains were subtype II/C. Three strains from elderly classic KS patients originally from Hokkaido, a northern Japanese island, were relatively closely related to strains of subtypes III/D and E. Consistent with previous observations, both the M and P alleles were identified at the RHS of subgroup I/A and II/C genomes; only the P allele was detected among the three Hokkaido strains. Distances among the Hokkaido strains were similar to the distance between subtypes I/A and II/C, suggesting that the Hokkaido strains may represent two distinct subtypes and that, as more strains are analysed, the currently recognized III/D subgroups will probably emerge as independent subtypes.
Human herpesvirus 8 (HHV-8), also known as Kaposis sarcoma-associated herpesvirus, is a recently described gammaherpesvirus. Compelling epidemiological evidence indicates that HHV-8 is aetiologically important in causing all clinical forms of Kaposis sarcoma (KS) (Chang et al., 1994 ; Moore & Chang, 1995 ), as well as primary effusion lymphoma (PEL) (Cesarman et al., 1995 ) and multicentric Castlemans disease (MCD) (Soulier et al., 1995 ). Molecular epidemiological studies have revealed that HHV-8 has a highly variable ORF K1 gene at the left end of its genome and that this variability makes the K1 gene a very good marker for HHV-8 genotyping and strain differentiation. Five major molecular subtypes or genotypes of the K1 gene and protein have been described from specimens obtained around the world. These include subtypes A, B, C, D and E, which have also been described as genotypes I, IV, II and III; in this paper we will use a hybrid nomenclature, e.g. subtype I/A. Some geographical restrictions have been noted, such as subtype IV/B being found only in specimens of African origin (Biggar et al., 2000 ; Cook et al., 1999 ; Fouchard et al., 2000 ; Kasolo et al., 1998 ; Meng et al., 1999 ; Zong et al., 1999 ). However, there is little information regarding the genetic variability of HHV-8 strains from Asia, except for Taiwan. We therefore explored the molecular characterization of HHV-8 from two Asian countries: Japan, a country located in east Asia that has low prevalence of both human immunodeficiency virus (HIV) and HHV-8 infection and is an endemic area of human T-lymphotropic virus type I infection, and Kuwait, a country located in south-west Asia (the Middle East). We also studied HHV-8 genetic variability in Argentina, a country in South America from which HHV-8 strains have not been described previously. Patient samples.
Clinical and epidemiological features of the patients and specimens are summarized in Table 1. The specimen set included KS lesions from autopsies and biopsies, lymph nodes, pericardial effusions and peripheral blood mononuclear cells (PBMC). Of 16 Japanese patients, 12 had AIDS-associated KS, MCD or PEL, three had classic KS and one had iatrogenic KS. The Argentine specimens were biopsies of KS skin lesions from both AIDS-associated and classical KS. The Kuwaiti specimens were PBMC from renal transplant patients.


Table 1. Specimens from Japan, Argentina and Kuwait: demographic details and country of origin


DNA isolation.
Genomic DNA was isolated from PBMC by using the QIAamp blood kit (Qiagen) following the manufacturers directions. KS tissue blocks from Argentine patients were sectioned and de-paraffinized by boiling in 200400 µl lysis buffer (50 mM TrisHCl, pH 8·5, 0·5% Tween 20, 1 mM EDTA and 200 µg/ml proteinase K), cooling to 4 °C and then removing the resolidified paraffin; the mixture was then incubated at 55 °C until completely digested. The DNA was extracted with phenolchloroform, precipitated with ethanol and then suspended in water. Japanese tissue specimens were digested in 600 µl lysis buffer (50 mM TrisHCl, pH 8·0, 2% SDS, 50 mM EDTA and 100 µg/ml proteinase K) at 37 or 50 °C. The completely digested tissue was then extracted with phenolchloroform.

PCR amplification and DNA sequencing.
An 886 bp segment representing the nearly complete ORF K1 coding region (nt 76961 of the strain BC-1 genomic sequence; Russo et al., 1996 ) was amplified directly from DNA samples by nested PCR as described previously (Meng et al., 1999 ). For some DNA specimens from which the longer product could not be amplified, such as from formalin-fixed, paraffin-embedded tissue, a shorter ORF K1 segment (nt 183545 of the BC-1 sequence) was amplified by nested PCR with primer sets as follows: forward outer primer, 5' GACCTTGTTGGACATCCTGTA 3'; reverse outer primer, 5' GAGTTTCTGGAGTTATATTG 3'; forward inner primer, 5' TTGTGCCCTGGAGTGATT 3'; and reverse inner primer 5' CA(G/T)CGTAAAATTATAGTA 3' (the G/T degeneracy at position 3 was used because of known variation at this position). The annealing temperatures for the outer and inner primer sets were 53 and 48 °C, respectively. Molecular subtype characterization of the right hand side (RHS) of the HHV-8 genome was done as described previously (Poole et al., 1999 ). Two different PCR strategies were used for this: a single PCR with a pair of primers unique to the M subtype of ORF K15 and a triple primer PCR set from ORF K14.1 covering the divergent junction of the two subtypes of ORF K15 genes.

Methods for PCR contamination control and direct sequencing of uncloned PCR amplicons were described previously (Meng et al., 1999 ). Both strands were sequenced in their entirety by using a variety of primer-directed strategies.

Alignments and phylogenetic analysis.
DNA sequences of amplified products, excluding the primer regions, were assembled with GelAssemble (GCG, Madison, WI, USA). Alignments were performed with both Pileup and Clustal W (Thompson et al., 1997 ). Aligned sequences resulting from both methods were used for phylogenetic analysis. Analyses were done that included and excluded gapped regions internal to the alignments. To evaluate the suitability of the data for phylogenetic reconstruction, likelihood-mapping analysis (Strimmer & von Haeseler, 1997 ) was performed with PUZZLE 4.0. Maximum-likelihood tree construction for phylogenetic relationships was done by quartet puzzling (Strimmer et al., 1997 ; Strimmer & von Haeseler, 1996 ) with PUZZLE 4.0 and distance methods (GCG).

In this study, we obtained nearly complete K1 sequences from 15 Japanese specimens, which, together with 27 K1 sequences from other sources, provided a total of 42 nearly complete sequences for analysis. In addition, the sequence of the amino-terminal half of the K1 extracellular domain (amino acids 25152, which includes the VR1 highly variable region that spans amino acids 5192) was available for 12 additional specimens. Thus, 54 partial or nearly complete K1 sequences were included in the analysis, representing all that were available at the time.

In previous work (Meng et al., 1999 ; and unpublished data), we found that concatenation of two segments of nucleotide sequence totalling 246 bp, which span the two most variable regions of the K1 gene, VR1 and VR2, allowed derivation of phylogenies that were essentially equivalent to those obtained with nearly complete K1 sequences. We attempted to develop a typing system based on amplification and sequencing of these restricted regions, but were unsuccessful, because the combination of G+C content and predicted hairpin structures in the DNA sequence, plus the highly variable sequence, precluded the design of useful primers targetting the VR2 region. As an alternative, we designed primer sets that spanned the region encoding the amino-terminal half of the extracellular domain of the K1 gene, including VR1. We were able to amplify this 363 bp segment from some clinical specimens that were either unsuitable for amplification of longer segments, such as formalin-fixed, paraffin-embedded tissue, or from which we were otherwise unable to obtain longer K1 PCR products. Phylogenetic inferences derived from the nucleotide and amino acid sequences of the 363 bp segment had topologies similar to trees derived from nearly complete K1 sequences (not shown). In the one exception, three sequences that were identical across the 363 bp segment differed elsewhere in their K1 genes (J14 compared to Au8 and BCBL-B); this can lead to loss of resolution at the lower levels of phylogenetic trees, but does not affect higher level classification (Fig. 1A).



(22K):

Fig. 1. Predicted K1 phylogenetic relationships: all genotypes (A) and a detailed view of genotypes II and I from the same tree (B). Segments containing 343 bp of nucleotide sequences from 54 HHV-8 strains were used in the analyses. Strains are labelled according to their source, including 17 Japanese (J), two Kuwaiti (Kuw) and five Argentine (Arg) sequences generated in this work (in bold), sequences reported in our previous work (Meng et al., 1999 ), sequences deposited by Biggar et al. (2000) , Cook et al. (1999) and Zong et al. (1999) , the K1 sequences of BC-1 and BCBL-1 (GenBank accession nos U75698 and U86667) and one KS strain (GenBank accession no. U93872), referred to here as Ge. The quartet trees were constructed from approximate maximum-likelihood values (PUZZLE 4.0) with the HKY model of substitution and 25000 puzzling steps. All trees are unrooted. The reliability values of quartet-puzzling tree searches are shown for the important internal branches. Scale bars represent 0·01 substitutions per site. The arrows in (B) point to the tips of branches for strains BC-2, BCBL-R, J1921 and US3 and to the branch nodes for strains Arg7, Arg10, Arg14, Au2, BC-1, J2 and Ge. A hybrid nomenclature/classification (in bold) is used. Genotypes I, II, III and IV and subtypes I-A, I-B, I-C, I-D, I-E and I-F correspond to our previous work; subtypes with an asterisk were determined previously provisionally based on gB and gH gene sequences (Meng et al., 1999 ). A, B, C, D and A1A4, C1, C3 and D1D2 refer to subtypes and subgroups described by Zong et al. (1999) . A', C' and C' refer to subtypes described by Cook et al. (1999) . E refers to the subtype described by Biggar et al. (2000) .

A handful of nomenclatural and classification systems for HHV-8 genotyping have been employed by different investigators (see Table 4 and Discussion). As additional sequences have been obtained and new strain groups identified, these systems have been extended in ways that are proving to be too cumbersome and confusing to be useful to or understood by any but those working actively in the field. To avoid adding to the confusion by creating yet another new system, we have used a hybrid nomenclature in presenting our data here, in anticipation of the collaborative development of a robust and comprehensive system.


Table 4. Classification of HHV-8 K1 genotypes by different investigators


The analyses reported here are based on maximum-likelihood methods applied to quartet puzzling, a robust, yet computationally efficient method. As evaluated by likelihood-mapping analysis similar to that shown in Meng et al. (1999) , the two datasets were well suited to robust phylogenetic reconstruction (not shown). As seen in the tree shown in Fig. 1(A), the 54 partial K1 sequences segregated into six main clades. Phylogenetic trees based on 42 nearly complete K1 sequences had topologies nearly identical to that shown in Fig. 1 (not shown), indicating that the partial K1 sequences are adequate for reconstructing K1 phylogeny. Among the clades, subtypes I/A, II/C and IV/B were well resolved and stable. However, as discussed in detail below, although their branches were well resolved (high quartet-reliability values), the relative positions of the branch-points were less stable for the three subtype D subgroups (D1, D2 and III/D3), subtype E and the newly identified Japanese strains from Hokkaido (Hok1 and Hok2).

Strains in subtype I/A were divided further into two major clades (enlarged in Fig. 1B), in which minor clades previously designated as I-A and I-B, subgroups A1, A2 and A4 and large subgroup A' fell into one clade and subtypes I-C, I-D, I-E and I-F and subgroup A3 fell into the other. Similarly, strains in subtype II/C segregated into two major clades (Fig. 1B), with subgroups C1 and C in one clade and subgroups C3 and C' in the other.

Nearly all of the newly identified strains were different from each other. J1, J9 and J16, as well as J19, J20 and J21, were identical to each other (J19 and J20 were obtained from the same patient). The Kuwaiti and Argentine strains fell into subtypes I/A and II/C. The two subtype I/A Argentine strains were more divergent within the subtype, with one falling into each of the two main subtype I/A clades. The three subtype II/C Argentine strains clustered relatively closely in one of the two main II/C clades.

The Japanese strains were more diverse, with 12 and 18% maximum pairwise distances at the nucleotide and amino acid levels, respectively (Table 2). Five and eight Japanese strains fell into genotypes I/A and II/C, respectively (Fig. 1). However, within these genotypes, the Japanese sequences tended to cluster. Strains J1, J8, J9, J14 and J16 clustered within subtype I/A among strains previously designated as I-A or A' (3% maximum pairwise nucleotide distance). Strains J2J5, J7, J17 and J19J21 clustered into the major subtype II/C clade previously designated as C3 or C' (4% maximum pairwise nucleotide distance). Most interestingly, three Japanese strains, all from elderly classic KS patients originally from Hokkaido, were relatively closely related to subtypes D1, D2, III/D3 and E (Table 3). Furthermore, the pairwise distances between Hokkaido strains J24/J26 and J25 were 6 and 7% at the nucleotide and amino acid levels, respectively; this is approximately equivalent to the distance between subtypes I/A and II/C (Tables 2 and 3). To acknowledge the distinctions among the Hokkaido strains and to avoid creating more nomenclatural confusion in the interim before a robust nomenclature is established, strains J24 and J26 are provisionally designated subtype Hok1 and strain J25 is designated Hok2.


Table 2. Maximum distances between and within genotypes for Japanese HHV-8 K1 sequences


Table 3. Maximum distances between and within genotypes for all HHV-8 K1 sequences


In previous work (Meng et al., 1999 ), we were unable to obtain K1 sequences for three strains (US11, US13 and NZ) that had yielded glycoprotein B (gB) and glycoprotein H (gH) sequences. As part of the current study, we were able to obtain short K1 segments from them (GenBank accession nos: NZ, AF278853; US11, AF278854; US13, AF278855). The K1 genotypes from the US strains were subtype I/A and the New Zealand (NZ) strain was subtype II/C, consistent with their previous provisionally determined genotyping based on gB (orf8) and gH (orf22) sequences. This demonstrates genetic stability at the left end of the genome among these strains.

PCR-based studies of the K14.1/K15 genomic region at the RHS of the HHV-8 genome revealed that, among 16 Japanese strains, four had the M allele and 12 had the P allele (Table 1). Of the four with the M allele, one had a subtype I/A K1 sequence while three had subtype II/C sequences. Of the 12 strains with the P allele, four were of K1 subtype I/A and five were genotype II/C. All three Hokkaido strains had the P allele.

In this study, we report the molecular characterization of 23 newly identified HHV-8 strains from Japan, Kuwait and Argentina. Our results extend our understanding of the distribution of HHV-8 genotypes in Asia and South America and raise the possibility that some clades currently considered as second-level are in fact first-level clades that have simply not been observed frequently because of the populations that have been studied so far. In addition, our results and the recent observations by Biggar et al. (2000) make it clear that additional major clades are likely to be discovered as more individuals and geographically, culturally and ethnically distinct populations are studied. We also found that a 363 bp segment encoding the portion of the extracellular domain of K1 that includes the VR1 variable domain allowed derivation of phylogenies that were essentially equivalent to those obtained using nearly complete K1 sequences. This provides an economical alternative to complete K1 DNA sequence-based typing.

About 5000 Japanese people are infected with HIV-1, one third of whom have haemophilia (National AIDS Surveillance Committee, 2000 ; Kondo et al., 2000 ). According to a recent survey, the seroprevalence of HHV-8 in Japan is 1·4% (Katano et al., 2000a ). KS was identified in only 5% of AIDS autopsy cases (National AIDS Surveillance Committee, 2000 ; Kondo et al., 2000 ) and classic KS cases are very rare, with only 39 certified classic KS cases reported as of 2000 (T. Sata and others, unpublished). Thus, the collection of specimens included in this study represents a large proportion of the known Japanese KS cases spanning many years. To our knowledge, this is the first report of Japanese K1 sequences and genotyping. The routes of HHV-8 transmission in Japan are unknown; we found no relationship between the HIV-1 and HHV-8 genotypes in individuals (Table 1), which runs counter to co-transmission theories for HIV-1 and HHV-8.

The Kuwaiti and Argentine strains studied here belong to the two widely distributed and more-prevalent HHV-8 subtypes, I/A and II/C. Thus, the Argentine strains are highly diverged from the subtype E strains identified elsewhere in South America (Brazil) in an isolated population of Amerindians; the Kuwaiti strains, although from Asia, are not related to the subtypes thus far found only along the southern and western Pacific Rim. Biggar et al. (2000) proposed that adaptation of HHV-8 to the host genotype can help explain the relatively high seroprevalence of the virus in some isolated populations and suggests the possibility of barriers to transmission between populations. Consistent with this, we suggest the possibility that the subtype I/A and II/C strains have evolved to enable more efficient transmission across human genotypic boundaries. This would explain in part the worldwide distribution of these subtypes, against a background of host genotype-restricted HHV-8 subtypes.

In the current HHV-8 K1 genotyping systems, most strains collected worldwide cluster into two well-populated clades (I/A and II/C). Strains from Africa have been of subtypes IV/B or a specific subgroup of I/A. Members of all three clades can have either the M or P allele at the right-hand side (RHS) of the genome. Strains obtained predominantly from aboriginal or relatively isolated populations form clades that branch at a distance from subtypes I/A and II/C; they have been designated variously as D1, D2, III/D3 and E. The K1 sequences (subtypes Hok1 and Hok2) found in elderly KS patients from the northern Japanese island of Hokkaido are especially interesting. Hokkaido has a large population of Ainu aboriginals, who are considered to be descendants of the native Asian populations of northern Japan and outliers relative to more predominant Asian populations that are thought to have arisen in South-east Asia (Zimdahl et al., 1999 ). Although we do not know the ethnic or genetic origin of the individuals from whom the Hokkaido strains were obtained, the presence of these unusual strains in this area is further evidence that the global migration of HHV-8 paralleled that of humans, rather than it being a recent introduction (Hayward, 1999 ). Molecular genetic population analysis based on HLA class II allele frequencies suggests that the Ainu are midway between other east Asian populations, including mainland Japanese, and native Americans (Bannai et al., 1996 ). These observations may support the hypothesis that the Ainu are the descendants of the Upper Palaeolithic populations of north-east Asia from which Native Americans are also derived. However, the relatively close relationship between the Hokkaido HHV-8 strains and a previously studied Australian strain classified as subtype III/D3 (67% pairwise nucleotide distance) suggests that the Hokkaido strains may have originated from South-east Asia, where Austronesians originated. Further study will be required to resolve these questions.

The nucleotide distance between the Hokkaido strains and type III/D3 Australian strains (67%) is generally less than that from other D or E strains (511%) and is substantially less than that from I/A, II/C and IV/B strains (1214%) (Table 3). More importantly, the distance between the Hok1 and Hok2 strains is 6 and 8% at the nucleotide and amino acid levels, which is nearly as great as the distance between subtypes I/A and II/C (8 and 12%, respectively). Unless the Hokkaido and III/D3 strains evolved by a mechanism different from that for the I/A and II/C strains, this suggests that the Hokkaido strains may represent two distinct subtypes and that, as more strains are analysed, each of the D subgroups will emerge as independent subtypes.

The current HHV-8 genotyping designations reflect the history of the field but do not allow easy description of phylogenetic relationships that have emerged from the growing collection of strains studied (Table 4). In addition to a dilemma in defining and designating top-level clades, designations for lower levels are fuzzy and sometimes arbitrary. The differences among the current systems are due to limitations of specimen collections (numbers, ethnic background of patients and geographical origin), the analytical methods used for phylogenetic analysis, the use of amino acid versus nucleotide sequences and attempts to preserve linkages between K1 genotyping and earlier typing systems. A new and robust nomenclature and classification system is needed for HHV-8 K1 genotyping that accommodates the current dataset and allows for the incorporation of new information. We look forward to working with others toward this end.

After submission of this manuscript, Lacoste et al. (2000) published a description of K1 sequences from Russian patients with classical KS. Six were of the I/A subtype and one was II/C. These authors also found both the M and P K14.1/K15 alleles in the I/A viruses included in their study.

We thank Dr Yujiro Arao for his contributions to this work. We also thank Mr N. Baba for his HIV-1 subtyping of the Japanese HIV-infected cases.

Footnotes

The GenBank accession numbers of the DNA sequences obtained in this study are AF274308, AF274309 and AF278832AF278855.

References

Bannai, M., Tokunaga, K., Imanishi, T., Harihara, S., Fujisawa, K., Juji, T. & Omoto, K.(1996). HLA class II alleles in Ainu living in Hidaka District, Hokkaido, northern Japan. American Journal of Physical Anthropology 101, 1-9.[Medline]

Biggar, R. J., Whitby, D., Marshall, V., Linhares, A. C. & Black, F.(2000). Human herpesvirus 8 in Brazilian Amerindians: a hyperendemic population with a new subtype. Journal of Infectious Diseases 181, 1562-1568.[Medline]

Cesarman, E., Chang, Y., Moore, P. S., Said, J. W. & Knowles, D. M.(1995). Kaposis sarcoma-associated herpesvirus-like DNA sequences in AIDS-related body-cavity-based lymphomas. New England Journal of Medicine 332, 1186-1191.[Abstract/Free Full Text]

Chang, Y., Cesarman, E., Pessin, M. S., Lee, F., Culpepper, J., Knowles, D. M. & Moore, P. S.(1994). Identification of herpesvirus-like DNA sequences in AIDS-associated Kaposis sarcoma. Science 266, 1865-1869.[Medline]

Cook, P. M., Whitby, D., Calabro, M.-L., Luppi, M., Kakoola, D. N., Hjalgrim, H., Ariyoshi, K., Ensoli, B., Davison, A. J. & Schulz, T. F.(1999). Variability and evolution of Kaposis sarcoma-associated herpesvirus in Europe and Africa. International Collaborative Group. AIDS 13, 1165-1176.[Medline]

Fouchard, N., Lacoste, V., Couppie, P., Develoux, M., Mauclere, P., Michel, P., Herve, V., Pradinaud, R., Bestetti, G., Huerre, M., Tekaia, F., De The, G. & Gessain, A.(2000). Detection and genetic polymorphism of human herpes virus type 8 in endemic or epidemic Kaposis sarcoma from West and Central Africa, and South America. International Journal of Cancer 85, 166-170.

Hayward, G. S.(1999). KSHV strains: the origins and global spread of the virus. Seminars in Cancer Biology 9, 187-199.[Medline]

Kasolo, F. C., Monze, M., Obel, N., Anderson, R. A., French, C. & Gompels, U. A.(1998). Sequence analyses of human herpesvirus-8 strains from both African human immunodeficiency virus-negative and -positive childhood endemic Kaposis sarcoma show a close relationship with strains identified in febrile children and high variation in the K1 glycoprotein. Journal of General Virology 79, 3055-3065.[Abstract]

Katano, H., Iwasaki, T., Baba, N., Terai, M., Mori, S., Iwamoto, A., Kurata, T. & Sata, T.(2000a). Identification of antigenic proteins encoded by human herpesvirus 8 and seroprevalence in the general population and among patients with and without Kaposis sarcoma. Journal of Virology 74, 3478-3485.[Abstract/Free Full Text]

Katano, H., Suda, T., Morishita, Y., Yamamoto, K., Hoshino, Y., Nakamura, K., Tachikawa, N., Sata, T., Hamaguchi, H., Iwamoto, A. & Mori, S.(2000b). Human herpesvirus 8-associated solid lymphomas that occur in AIDS patients take anaplastic large cell morphology. Modern Pathology 13, 77-85.[Medline]

Koizumi, H., Ohkawara, A., Itakura, O. & Kikuta, H.(1996). Herpesvirus-like DNA sequences in classic Kaposis sarcoma and angiosarcoma in Japan. British Journal of Dermatology 135, 1009-1010.[Medline]

Kondo, Y., Izumi, T., Yanagawa, T., Kanda, H., Katano, H. & Sata, T.(2000). Spontaneously regressed Kaposis sarcoma and human herpesvirus 8 infection in a human immunodeficiency virus-negative patient. Pathology International 50, 340-346.[Medline]

Lacoste, V., Kadyrova, E., Chistiakova, I., Gurtsevitch, V., Judde, J.-G. & Gessain, A.(2000). Molecular characterization of Kaposis sarcoma-associated herpesvirus/human herpesvirus-8 strains from Russia. Journal of General Virology 81, 1217-1222.[Abstract/Free Full Text]

Meng, Y.-X., Spira, T. J., Bhat, G. J., Birch, C. J., Druce, J. D., Edlin, B. R., Edwards, R., Gunthel, C., Newton, R., Stamey, F. R., Wood, C. & Pellett, P. E.(1999). Individuals from North America, Australasia, and Africa are infected with four different genotypes of human herpesvirus 8. Virology 261, 106-119.[Medline]

Moore, P. S. & Chang, Y.(1995). Herpes-like DNA sequences, AIDS-related tumors, and Castlemans disease. New England Journal of Medicine 333, 798-799.[Medline]

Nakamura, K., Katano, H., Hoshino, Y., Nakamura, T., Hosono, O., Masunaga, A., Mori, S., Iwamoto, A. & Tamaki, K.(1999). Human herpesvirus type 8 and EpsteinBarr virus-associated cutaneous lymphoma taking anaplastic large cell morphology in a man with HIV infection. British Journal of Dermatology 141, 141-145.[Medline]

National AIDS Surveillance Committee (2000). HIV/AIDS Surveillance in Japan. National AIDS Surveillance Committee, Ministry of Health & Welfare of Japan (in Japanese).

Poole, L. J., Zong, J. C., Ciufo, D. M., Alcendor, D. J., Cannon, J. S., Ambinder, R., Orenstein, J. M., Reitz, M. S. & Hayward, G. S.(1999). Comparison of genetic variability at multiple loci across the genomes of the major subtypes of Kaposis sarcoma-associated herpesvirus reveals evidence for recombination and for two distinct types of open reading frame K15 alleles at the right-hand end. Journal of Virology 73, 6646-6660.[Abstract/Free Full Text]

Russo, J. J., Bohenzky, R. A., Chien, M. C., Chen, J., Yan, M., Maddalena, D., Parry, J. P., Peruzzi, D., Edelman, I. S., Chang, Y. & Moore, P. S.(1996). Nucleotide sequence of the Kaposi sarcoma-associated herpesvirus (HHV8). Proceedings of the National Academy of Sciences, USA 93, 14862-14867.[Abstract/Free Full Text]

Soulier, J., Grollet, L., Oksenhendler, E., Cacoub, P., Cazals-Hatem, D., Babinet, P., dAgay, M.-F., Clauvel, J.-P., Raphael, M., Degos, L. & Sigaux, F.(1995). Kaposis sarcoma-associated herpesvirus-like DNA sequences in multicentric Castlemans disease. Blood 86, 1276-1280.[Abstract/Free Full Text]

Strimmer, K. & von Haeseler, A.(1996). Quartet puzzling: a quartet maximum-likelihood method for reconstructing tree topologies. Molecular Biology and Evolution 13, 964-969.[Free Full Text]

Strimmer, K. & von Haeseler, A.(1997). Likelihood-mapping: a simple method to visualize phylogenetic content of a sequence alignment. Proceedings of the National Academy of Sciences, USA 94, 6815-6819.[Abstract/Free Full Text]

Strimmer, K., Goldman, N. & von Haeseler, A.(1997). Bayesian probabilities and quartet puzzling. Molecular Biology and Evolution 14, 210-211.[Free Full Text]

Thompson, J. D., Gibson, T. J., Plewniak, F., Jeanmougin, F. & Higgins, D. G.(1997). The CLUSTAL X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Research 25, 4876-4882.[Abstract/Free Full Text]

Zimdahl, H., Schiefenhovel, W., Kayser, M., Roewer, L. & Nagy, M.(1999). Towards understanding the origin and dispersal of Austronesians in the Solomon Sea: HLA class II polymorphism in eight distinct populations of AsiaOceania. European Journal of Immunogenetics 26, 405-416.[Medline]

Zong, J. C., Ciufo, D. M., Alcendor, D. J., Wan, X., Nicholas, J., Browning, P. J., Rady, P. L., Tyring, S. K., Orenstein, J. M., Rabkin, C. S., Su, I. J., Powell, K. F., Croxson, M., Foreman, K. E., Nickoloff, B. J., Alkan, S. & Hayward, G. S.(1999). High-level variability in the ORF-K1 membrane protein gene at the left end of the Kaposis sarcoma-associated herpesvirus genome defines four major virus subtypes and multiple variants or clades in different human populations. Journal of Virology 73, 4156-4170.[Abstract/Free Full Text]

Received 7 August 2000; accepted 6 November 2000.