Research Article

Activity of Toscana and Rift Valley fever virus transcription complexes on heterologous templates -- Accardi et al. 82 (4): 781 -- Journal of General Virology

Journal of General Virology 82(4):781

With thanks to our partners for supporting this archive.

Abstract

A transcription system for Toscana virus (TOSV) (a member of the family Bunyaviridae, genus Phlebovirus) was constructed. For in vivo expression, the TOSV transcription system uses the viral N and L proteins and an S-like RNA genome containing the chloramphenicol acetyltransferase reporter gene in the antisense orientation flanked by the viral genomic 5'- and 3'-terminal S sequences. It was found that the N and L proteins represent the minimal protein requirement for an active transcription complex. To investigate the possibility of reassortment between TOSV and Rift Valley fever virus (RVFV), the activity of their polymerase complexes was tested on their heterologous S-like RNA genomes and this showed that both virus complexes were active. Moreover, hybrid transcriptase complexes with protein components originating from the two viruses were tested on both virus templates and only the combination RVFV L + TOSV N on RVFV S-like RNA was found to be active in this assay. These results suggest that virus reassortants might be generated whenever the two viruses infect the same host.
Toscana virus (TOSV) and Rift Valley fever virus (RVFV) are arthropod-borne viruses that belong to the family Bunyaviridae, genus Phlebovirus. They are segmented negative-stranded RNA viruses and their ribonucleoprotein complexes, consisting of genomic RNA molecules encapsidated by the nucleocapsid protein N and by a few molecules of the RNA-dependent RNA polymerase L protein (Accardi et al., 1993 ; Müller et al., 1994 ), are the active template for transcription and replication. In both viruses, the shortest segments (S) code for the N and the non-structural (NSs) proteins by using an ambisense strategy (Giorgi et al., 1991 ).

An in vivo system that allowed the transcription of cDNA-derived RNA templates was established previously for RVFV (Lopez et al., 1995 ). This system was based on an S-like genomic RNA molecule containing the chloramphenicol acetyltransferase (CAT) reporter gene in the antisense orientation flanked by the 3' and 5' non-coding regions of the genomic S segment. Transcription was monitored by assaying CAT activity in cells that were infected with vaccinia viruses expressing the viral proteins and transfected with the S-like RNA genome. A similar system was also developed successfully for Bunyamwera virus (Dunn et al., 1995 ). In both these systems, only the N and L proteins were necessary to form a functional transcriptase complex. The NSs protein had neither an inhibitory nor a stimulating effect on transcriptase activity.

In this study, we used ribozymes to cleave RNA in vivo (Pattnaik et al., 1992 ) in order to obtain the correct 5' and 3' extremities of the RNA molecule, which is directly released in the infected cell. The antisense CAT gene flanked by RVFV S-terminal genomic sequences (MP12 strain) derived from the pCAT-RVF-Sg vector (Lopez et al., 1995 ) was cloned into the pBluescript KS vector (Stratagene) between two ribozyme sequences, i.e. the hammerhead and the antigenomic hepatitis delta ribozymes (Haseloff & Gerlach, 1988 ; Perrotta & Been, 1991 ), which are under the control of the T7 promoter. The resultant clone was designated pCP-S (Fig. 1a). An in vivo transcription system was then constructed by transfecting Vero-E6 cells, which had been pre-infected with a T7 polymerase-expressing recombinant vaccinia virus (vTF7-3, kindly provided by B. Moss, NIH, USA), with plasmids carrying the RVFV L and N sequences (pBS-Lc and pRVF-N) (Lopez et al., 1995 ) and with pCP-S in vitro-transcribed RNA. The RVFV N and L proteins expressed in this T7-driven vaccinia virus system were revealed by Western blotting using RVFV anti-N monoclonal antibodies and TOSV anti-L polyclonal antibodies, respectively (Fig. 1b). The CAT activity that was revealed in cell extracts (Fig. 2, lane 4) showed the reliability of this assay.



(42K):

Fig. 1. (a) Schematic representation of RVFV S-like genome cDNA in the plasmid pCP-S. The 3'- and 5'-terminal non-coding (nc) sequences of the viral genomic S segment are flanked by the hammerhead (H) and antigenomic hepatitis delta virus (D) ribozyme sequences. The T7 polymerase promoter (T7) and the sequences for transcription termination (term) are indicated. Oligonucleotides (arrows) used to replace RVFV 3'- and 5'-terminal S sequences with the corresponding TOSV sequence are indicated. (b) Western blots of RVFV and TOSV proteins (arrowheads) expressed in a vTF7-3 driven system. (i) vTF7-3-infected Vero-E6 cells transfected with either pL6400 (lane 1) or pBS-Lc (lane 2) and untransfected (lane 3) cells are shown. Lysates from TOSV-infected (lane 4) and mock-infected (lane 5) Vero-E6 cells are also indicated. (ii)(iv) vTF7-3-infected Vero-E6 cells transfected with p4N (ii, lane 1), pRVF-N (iii, lane 1) or pNSs (iv, lane 1) and untransfected cells are shown (iiiv, lanes 2).


(22K):

Fig. 2. CAT activity of TOSV and RVFV polymerase complexes. vTF7-3-infected Vero-E6 cells cotransfected with TOSV L and N expression plasmids and transfected with either TOSV (lane 1) or RVFV (lane 2) S-like RNA. vTF7-3-infected Vero-E6 cells cotransfected with RVFV L and N expression plasmids and transfected with either TOSV (lane 3) or RVFV (lane 4) S-like RNA. vTF7-3-infected Vero-E6 cells transfected with either RVFV (lane 9) or TOSV (lane 10) S-like RNA. vTF7-3-infected Vero-E6 cells cotransfected with TOSV N and RVFV L expression plasmids and transfected with either RVFV (lane 6) or TOSV (lane 8) S-like RNA. vTF7-3-infected Vero-E6 cells cotransfected with RVFV N and TOSV L expression plasmids and transfected with either RVFV (lane 5) or TOSV (lane 7) S-like RNA.

We then established a similar in vivo transcription system for TOSV. To express the viral proteins, the full-length cDNAs of the L and S segments, which were obtained by RTPCR using viral genomic RNA as a template, were cloned into pGEM vectors (Promega) under the control of the T7 promoter. The TOSV plasmid expressing the L protein, pL6400, was constructed by assembling two overlapping cDNA clones using an internal StuI restriction site. TOSV S cDNA was cloned into pGEM-3Z (pN) and pGEM-4Z (pNSs) in order to allow T7 polymerase transcription of either N or NSs protein coding sequences.

A plasmid containing only the N coding sequence (p4N) was also constructed in order to avoid the possibility of annealing that might occur between the complementary sequences at the 5' end of the N mRNA and at the 3' end of the S-like RNA.

The TOSV genomic S-like plasmid p4.4 was then constructed. It was obtained by replacing the RVFV terminal genomic sequences with those from TOSV by two successive steps of PCR using the Ex-site system (Promega). The primer pairs used were H (hammerhead, 5'GACCTAGGGAAACACACCC 3') and 5'TOS-3'CAT (5'ACACAAAGACCTCCCGTATTGCTAAACCAGAGGCTAGTAATAGACTTCTA GACAGCCCTCGAGAAGCTTCGACGAAT3', TOSV sequence is underlined), and D (delta, 5' GGGTCGGCATGGCATCTCCA 3') and 3'TOS-5'CAT (5'ACACAGAGATTCCCGTGTATTAAACAAAAGCTATCAACATGGAGAAAAAAATCACTGG3', TOSV sequence is underlined) (Fig. 1a).

The three plasmids expressing TOSV proteins were transfected into vTF7-3-infected Vero-E6 cells and cell lysates were then analysed for protein expression by Western blot analysis, as described by Di Bonito et al. (1999) . The mono-specific TOSV polyclonal anti-L, -N and -NSs antibodies identified three proteins with the electrophoretic mobilities that were expected for L, N and NSs proteins, respectively. The electrophoretic mobility of the recombinant L protein was compared with that of the native L protein from TOSV-infected cells (Fig. 1b). The low expression of the recombinant L protein observed is a feature which is shared by all Bunyaviridae L polymerases that are expressed either by recombinant vaccinia viruses or by T7-driven expression plasmids (Elliott, 1996 ; Lopez et al., 1995 ; Dunn et al., 1995 ; Jin & Elliott, 1991 ).

To assay TOSV transcriptase activity, vTF7-3-infected Vero-E6 cells were cotransfected with the TOSV L and N expression plasmids using a transfection reagent of non-liposomal formulation, Fugene 6 (Roche), according to the manufacturer's recommendations. Cells were transfected 3 h later with TOSV S-like RNA, which was in vitro-transcribed from p4.4. Cell extracts were prepared 48 h post-infection and assayed for CAT activity as described previously (Ausubel et al., 1995 ).

Under these conditions, CAT activity was detected (Fig. 2, lane 1), indicating that the S-like RNA had been transcribed into mRNA. No CAT activity was detected either in infected cells transfected with only TOSV S-like RNA (Fig. 2, lane 10) or in cells transfected with both TOSV S-like RNA and one of the expression plasmids (data not shown). In each experiment, the efficiency of plasmid transfection was tested by monitoring N protein expression by immunofluorescence (data not shown). CAT assays were performed only when transfection efficiencies were above 60%.

In this system, no significant improvement of CAT activity was obtained when cells were transfected with pNSs (data not shown), indicating that NSs has neither a stimulating nor an inhibitory effect upon transcription. Recently, evidence was obtained that showed that RVFV and Bunyamwera virus NSs proteins are involved in the IFN response in infected cells (Bouloy et al., 2001 ; Weber et al., 2000 ). Although the function of TOSV NSs is not yet determined, it might play a similar role in IFN response in infected cells. These results provide evidence that L and N proteins form the active TOSV transcription complex.

Viruses with multipartite genomes can exchange their genomic segments, giving rise to heterotypic viruses. RNA segment reassortment among viruses with multipartite genomes belonging to the same genus or serogroup has been shown in members of the Bunyaviridae family both in vivo and in vitro (reviewed by Pringle, 1996 ; Sall et al., 1999 ). TOSV and RVFV are circulating in the Mediterranean regions and, although they are not transmitted by the same vector, dual heterologous infection of vertebrate hosts cannot be excluded. Moreover, the similarities between their nucleotide sequences (Accardi et al., 1993 ; Giorgi et al., 1991 ) suggest that the two phleboviruses are phylogenetically related, in spite of the differences in their ecology and pathogenesis (Nicoletti et al., 1996 ; Peters & Meegan, 1989 ; Sall et al., 1998 ).

To address the molecular basis of reassortment between TOSV and RVFV, we investigated whether or not their transcription complexes would be active with the S-like RNA genome of the heterologous virus.

vTF7-3-infected Vero-E6 cells were either cotransfected with TOS-N and -L expression plasmids and transfected with the RVFV S-like RNA genome, or cotransfected with RVF-N and -L expression plasmids and transfected with TOSV S-like RNA genome. In both cases, CAT activity was detected (Fig. 2, lanes 2 and 3), indicating that the transcription complex of both viruses can recognize the heterologous terminal genomic sequences and therefore transcribe the heterologous S-like RNA genome.

We also investigated whether or not a transcriptase complex that was artificially derived from both viruses would be active with the respective S-like RNA genomes. CAT activity was detected when TOS-N in association with RVF-L was tested on the RVFV S-like RNA genome (Fig. 2, lane 6), but not when tested on the TOSV S-like genomic RNA (Fig. 2, lane 8). No CAT activity was detected when RVF-N in association with TOS-L was tested on either RVFV or TOSV S-like genomic RNAs (Fig. 2, lanes 5 and 7). Therefore, the combination of TOS-N + RVF-L proteins works in this assay and is active only on the RVFV S-like genomic RNA, highlighting the importance of the template sequences in transcription. In this context, some role could be played by the nucleotide differences observed at the 3' ends of the genomic sequences of the two viruses (see below) in combination with other factors, for example, interactions between the L and N proteins.

The sequence that is recognized by the RVFV transcription complex at the 3' end of its viral ambisense S segment has been determined previously (Prehaud et al., 1997 ). The minimal sequence that is required for transcription resides in the first 3'-terminal 13 nucleotides of both genomic and antigenomic RNAs, but the first seven or eight nucleotides are not themselves sufficient for initiating transcription.

Alignments of the 3'-terminal 13 nucleotides of TOSV and RVFV S segments show a high degree of identity in either the genomic or the antigenomic sequences (Fig. 3). Genomic sequences show mismatches at residues 6, 9 and 11, whereas the antigenomic sequences show full nucleotide identity except at residue 12. Interestingly, the same positions that are mismatched between the genomes are identical to each other in the antigenomes and vice versa. Moreover, residue 10 shows identity between the strands of the same polarity (residue A on the genomic RNAs and residue G on the antigenomic RNAs). These observations and our results suggest that the two viruses could be considered to be virus variants: the nucleotide differences between their 3'-terminal genomic sequences result in silent mutations with respect to transcription. Since the first 13 nucleotides at the ends of both S genomic segments are nearly perfectly matched in the two viruses (Fig. 3), we can expect that the respective polymerase complexes could also be active on the viral antigenomic RNAs from which the mRNAs of the NSs proteins are transcribed.



(14K):

Fig. 3. Nucleotide alignments of the 3'-terminal genomic (g) and antigenomic (ag) S segment sequences of TOSV and RVFV. Asterisks highlight nucleotide identity. Positions showing a nucleotide difference among the four strands (residues 6, 912) are in bold typeface.

In conclusion, we speculate that, in the case of reassortment, viruses with homologous L and S segments could perform transcription and might produce progeny virus. This fact suggests an opportunity to begin a surveillance programme to monitor the possible emergence of new viruses with altered pathogenicity in areas where the two viruses are cocirculating. A reassortant virus bearing the M segment of Germiston virus and the L and S segments of Bunyamwera virus has been isolated recently from a case of human haemorrhagic fever syndrome during the epidemic of 19971998 in Kenya and Somalia (Nichol, 2000 ). The confirmation of this reassortant virus will strongly support the need for such a surveillance programme. We thank Romina Tomasetto and Sabrina Tocchio for their skilful secretarial assistance and Roberto Gilardi for assistance in computer artwork. We are indebted to Dr Andrew Ball for the generous gift of the pTV (2.0) transcription plasmid. The nucleotide sequences of TOSV and RVFV L segments are in the EMBL nucleotide sequence databank under accession numbers X68414 and X56464, respectively; TOSV and RVFV S segment sequences have the accession numbers X53794 and X53771, respectively.

Footnotes

b Present address: Unité de Neurovirologie et Régénération du Système Nerveux, Institut Pasteur, 25 rue du Dr Roux, 75724 Paris Cedex 15, France.

References

Accardi, L., Grò, M. C., Di Bonito, P. & Giorgi, C. (1993). Toscana virus genomic L segment: molecular cloning, coding strategy and amino acid sequence in comparison with other negative strand RNA viruses. Virus Research 27, 119-131.[Medline]

Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A. & Struhl, K. (1995). Current Protocols in Molecular Biology. New York: John Wiley.

Bouloy, M., Jansen, C., Vialat, P., Khun, H., Pavlovic, J., Huerke, M. & Haller, O. (2001). Genetic evidence for an interferon antagonist effect of the Rift Valley fever virus non-structural protein NSs. Journal of Virology 75, 13711377.[Abstract/Free Full Text]

Di Bonito, P., Nicoletti, L., Mochi, S., Accardi, L., Marchi, A. & Giorgi, C. (1999). Immunological characterization of Toscana virus proteins. Archives of Virology 144, 1947-1960.[Medline]

Dunn, E. F., Pritlove, D. C., Jin, H. & Elliott, R. M. (1995). Transcription of a recombinant Bunyavirus RNA template by transiently expressed Bunyavirus proteins. Virology 211, 133-143.[Medline]

Elliott, R. M. (1996). The Bunyaviridae. Concluding remarks and future prospects. In The Bunyaviridae , pp. 295-332. Edited by R. M. Elliott. New York:Plenum Press.

Giorgi, C. (1996). Molecular biology of Phleboviruses. In The Bunyaviridae , pp. 105-128. Edited by R. M. Elliott. New York:Plenum Press.

Giorgi, C., Accardi, L., Nicoletti, L., Grò, M. C., Takehara, K., Hilditch, C. & Bishop, D. H. (1991). Sequences and coding strategies of the S RNAs of Toscana and Rift Valley fever viruses compared to those of Punta Toro, Sicilian Sandfly fever, and Uukuniemi viruses. Virology 180, 738-753.[Medline]

Haseloff, J. & Gerlach, W. L. (1988). Simple RNA enzymes with new and highly specific endoribonuclease activities. Nature 334, 585-591.[Medline]

Jin, H. & Elliott, R. M. (1991). Expression of functional Bunyamwera virus L protein by recombinant vaccinia viruses. Journal of Virology 65, 4182-4189.[Medline]

Lopez, N., Müller, R., Prehaud, C. & Bouloy, M. (1995). The L protein of Rift Valley fever virus can rescue viral ribonucleoproteins and transcribe synthetic genome-like RNA molecules. Journal of Virology 69, 3972-3979.[Abstract]

Müller, R., Poch, O., Delarue, M., Bishop, D. H. L. & Bouloy, M. (1994). Rift Valley fever virus L segment: correction of the sequence and possible functional role of newly identified regions conserved in RNA-dependent polymerases. Journal of General Virology 75, 1345-1352.[Abstract]

Nichol, S. T. (2000). Evolution of viruses in the real word. Genetics, Pathogenesis and Ecology of Emerging Viral Diseases (Taos, New Mexico, USA, 2430 January, 2000).

Nicoletti, L., Ciufolini, M. G. & Verani, P. (1996). Sandfly fever viruses in Italy. Archives of Virology Supplementum 11, 41-47.[Medline]

Pattnaik, A. K., Ball, L. A., LeGrone, A. W. & Wertz, G. W. (1992). Infectious defective interfering particles of VSV from transcripts of a cDNA clone. Cell 69, 1011-1020.[Medline]

Perrotta, A. T. & Been, M. D. (1991). A pseudoknot-like structure required for efficient self cleavage of hepatitis delta virus RNA. Nature 350, 434-436.[Medline]

Peters, C. J. & Meegan, J. M. (1989). Rift Valley fever. In CRC Handbook Series in Zoonoses , pp. 403-420. Edited by G. Beran. Boca Raton, FL:CRC Press.

Prehaud, C., Lopez, N., Blok, M. J., Obry, V. & Bouloy, M. (1997). Analysis of the 3' terminal sequence recognized by the Rift Valley fever virus transcription complex in its ambisense S segment. Virology 227, 189-197.[Medline]

Pringle, C. R. (1996). Genetics and genome segment reassortment. In The Bunyaviridae , pp. 189-226. Edited by R. M. Elliott. Plenum Press:New York.

Sall, A. A., Zanotto, P. M., Sene, O. K., Zeller, H. G., Digoutte, J. P., Thiongane, Y. & Bouloy, M. (1999). Genetic reassortment of Rift Valley fever virus in nature. Journal of Virology 73, 8196-8200.[Abstract/Free Full Text]

Sall, A. A., Zanotto, P. M., Vialat, P., Sene, O. K. & Bouloy, M. (1998). Origin of 199798 Rift Valley fever outbreak in East Africa. Lancet 352, 1596-1597.[Medline]

Weber, F., Bridgen, A. & Elliott, R. M. (2000). The Bunyamwera virus non-structural protein NSs is a repressor of the viral polymerase and confers interferon antagonistic function. 11th International Conference on Negative Strand Viruses. (Quebec City, Canada, June 2429, 2000).

Received 23 October 2000; accepted 9 January 2001.