Research Article

Porcine endogenous retroviruses: in vitro host range and attempts to establish small animal models

Journal of General Virology 2001; 82(4):837

PubMed

With thanks to our partners for supporting this archive.

Abstract

Using transgenic pigs as the source of cells or organs for xenotransplantation is associated with the risk of porcine endogenous retrovirus (PERV) transmission. Multiple proviruses are integrated into the genome of all pigs, and virus particles, some of which are able to infect human cells, are released from normal pig cells. In order to evaluate the potential risk posed by the transmission of PERVs, in vitro infection studies were performed as a basis for small animal as well as non-human primate models. In vitro infectivity was demonstrated for permanent cell lines and primary cells from a wide range of species. Productive infection was shown using reverse transcriptase (RT) assays and RTPCR for mink, feline and human kidney cell lines, primary rhesus peripheral blood mononuclear cells (PBMCs), and baboon spleen cells and PBMCs as well as for different human lymphoid and monocyte cell lines and PBMCs. In an attempt to establish a small animal model, naive guinea pigs, non-immunosuppressed rats, rats immunosuppressed by cyclosporin-A and immunosuppressed rats treated with cobra venom factor were inoculated with PERVs produced from porcine kidney PK-15 cells, infected human 293 kidney cells and mitogen-stimulated porcine PBMCs. Animals were also inoculated with PERV-producing PK-15 and 293 cells. No antibodies against PERV and no provirus integration were observed in any of the treated animals. This suggests that productive infection of these animals did not occur in this experimental setting.
The use of xenotransplantation may help to overcome the critical shortage of organs that are suitable for allotransplantation. Although early attempts at xenotransplantation used primate xenografts (Starzl et al., 1993 ), the focus nowadays is, for ethical, economical and microbiological reasons, on the use of porcine organs and tissues. However, transplantation of animal organs into humans involves the risk of transmission of pathogenic micro-organisms. Although most of these potential pathogens could be eliminated by either pathogen-free breeding (Swindle, 1998 ) or vaccination against known micro-organisms, the risk of exposure to both unknown micro-organisms and donor-derived endogenous retroviruses is unavoidable. Porcine endogenous retroviruses (PERVs) are present as multiple copies in the genome of all pigs (Akiyoshi et al., 1998 ). PERV particles are produced by porcine cell lines (Breese, 1970 ; Lieber et al., 1975 ), tumours (Frazier, 1985 ), aorta endothelial cells (Martin et al., 1998 ) and peripheral blood mononuclear cells (PBMCs) (Denner, 1999 ; Wilson et al., 1998 ; Tacke et al., 2000a ). The porcine kidney PK-15 cell line (Armstrong et al., 1971 ; Le Tissier et al., 1997 ; Todaro et al., 1974 ) and primary aorta endothelial cells (Martin et al., 1998 ) produce at least two subtypes of PERV, PERV-A and PERV-B, which are able to infect human cells (Patience et al., 1997 ; Takeuchi et al., 1998 ). A third subtype, PERV-C, is released from porcine PBMCs after mitogenic stimulation. All three subtypes share common sequences but have substantial differences in the receptor-binding region of the viral surface envelope protein. PERVs are related in nucleotide and amino acid sequence (Akiyoshi et al., 1998 ; Le Tissier et al., 1997 ) and morphology (Bouillant et al., 1975 ; Denner, 1998 ) to type C retroviruses of mice (murine leukaemia virus), cats (feline leukaemia virus) and gibbons (gibbon ape leukaemia virus), each of which induce leukaemia and immunodeficiencies in the infected host (Fan, 1994 ; Hardy, 1993 ). Transmission of PERVs from the transplant tissue to the recipient following xenotransplantation could, therefore, lead to tumours and leukaemia, e.g. by insertional mutagenesis and/or immunodeficiency disease. Clearly, the evaluation of PERV transmission in animal models is a fundamental requirement to guarantee microbiological safety in future clinical xenotransplantations. As the primary entry receptor for the three subtypes of PERV-A, -B and -C, which should be different for each subtype (Takeuchi et al., 1998 ), still remains unknown, the full host range of PERV should be studied in terms of both species and cell tropisms.

In this paper we report on our attempts to infect cells of different species with PERV. In addition to permanent cell lines, we have used primary cells to simulate, as closely as possible, the situation during xenotransplantation. We demonstrate the infection of different permanent animal and human cell lines and primary cells with PERV. Furthermore, we have tried to establish a small animal model using naive and immunosuppressed rats as well as naive guinea pigs. Under our experiment conditions, no signs of PERV infection were observed.

PERV producer cells.
For the production of PERVs, porcine kidney PK-15 (ATCC CCL-33) or infected human 293 kidney cells (PERV/293, kindly provided by R. Weiss, Institute of Cancer Research, Chester Beatty Laboratories, London, UK) (Takeuchi et al., 1998 ) and PERV/NIH-infected 293 cells, kindly provided by C. Wilson, FDA, Washington, USA (Wilson et al., 2000 ), were used. Both viruses were serially passaged on uninfected human 293 kidney cells. Later, passage 5 of PERV/NIH was also used for infections. In addition, PBMCs that were isolated from the blood of healthy outbred Yucatan micro pigs (Charles River Laboratories), as described by Tacke et al. (2000a ), were cultured in RPMI-1640 with 10% FCS and stimulated with 72 µg/ml phytohaemagglutinin (PHA) (Abbott Murex) for 5 days in the presence of 100 IU/ml IL-2 (EuroCetus). Supernatants shown to contain PERV by RT assay were collected on day 5 and used for infection experiments.

Cell lines used for infection.
Feline CRFK (ATCC CCL-94) and PG4 (ECACC 94102703) cells, and human THP-1 (ATCC TIB-202), WIL2.NS.6TG (ECACC 93031001) and C8166 (ECACC 88051601) cells were grown in different culture medium, as indicated by either ATCC or ECACC, respectively.

Preparation of primary cells.
Primary cells from different organs were isolated as described by Freshney (1987) . Kidneys and embryos were removed aseptically, minced and treated with 1 ml 0·25% trypsin in PBS per 5 mg tissue using a magnetic stirrer at 37 °C. Single cell suspensions were cultivated in DMEM containing 4·5% sucrose and 10% FCS. Spleens were resuspended using a steel mesh. Spleen cells were cultivated in RPMI-1640 with 10% FCS and stimulated with 72 µg/ml PHA for 3 days, followed by stimulation with 100 IU/ml IL-2 every second day.

Electron microscopy.
Cells were fixed at room temperature for 45 min with freshly mixed glutaraldehyde (2·5%) in warm medium. Fixed cells were scraped off the culture plate, suspended in warm liquid agarose and immediately chilled on ice. After cutting the agarose into small cubes, cells were re-fixed in 1% OsO4 in PBS, dehydrated in a graded series of ethanol and embedded in Epon 812, according to standard protocols (Luft, 1961 ). Epon blocs were cut into 80 nm sections on a Leica Ultracut 4 microtome and contrasted with 2% uranylacetate for 10 min and 2% lead citrate for 2 min at room temperature. Micrographs were taken on a Zeiss CEM 902 electron microscope using ESI mode.

PCR.
DNA from infected and control cells was isolated using preparation kits from Qiagen. DNA from spleen, kidney and lymph nodes of infected rats and guinea pigs was isolated using DNAzol (Life Technologies). For the detection of provirus, primers specific for the pol gene (forward primer 5' TTGACTTGGGAGTGGGACGGGTAAC and reverse primer 5' GAGGGTCACCTGAGGGTGTTGGAT) (Czauderna et al., 2000 ) and the gag gene (forward primer 5' GCGACCCACGCAGTTGCATA and reverse primer 5' CAGTTCCTTGCCCAGTGTCCTT) (Paradis et al., 1999 ) of PERV were used. For identification of the virus subtype, primers specific for each of the env genes were used [PERV-A, forward primer 5' TGGAAAGATTGGCAACAGCG and reverse primer 5' AGTGATGTTAGGCTCAGTGG (Le Tissier et al., 1997 ); PERV-B, forward primer 5' TTCTCCTTTGTCAATTCCGG and reverse primer 5' TACTTTATCGGGTCCCACTG; PERV-C, forward primer 5' CTGACCTGGATTAGAACTGG and reverse primer 5' ATGTTAGAGGATGGTCCTGG (Takeuchi et al., 1998 )]. For PCR amplification, the standard PCR program of one cycle of 95 °C for 10 min, 35 cycles of 95 °C for 1 min, 55 °C for 1 min and 72 °C for 1 min and one cycle of 72 °C for 7 min was applied. PCR sensitivity was also analysed; one PERV-producing 293 cell was detected on the background of 1x106 uninfected 293 cells.

RTPCR.
For the detection of virus production from infected cells, viral RNA from supernatants of cultured cells was isolated. Cells were removed from supernatants by centrifugation at 200 g for 10 min. Thereafter, cell debris was removed by centrifugation at 3500 g for 10 min and an additional centrifugation step at 10000 g for 30 min. Virus was pelleted by ultracentrifugation (54000 g for 3 h) and viral RNA isolated using the viral RNA isolation kit from Qiagen. RNA was reverse transcribed using a one-step RTPCR kit (Life Technologies) and cDNA was screened using PCR with PERV-specific primers.

Immune peroxidase assay (IPA).
Cells were trypsinized and seeded in 6-well (1x105 cells per well) or 96-well (3x104 cells per well) plates coated with either 100 µl or 1 ml of a 0·005% poly(L-lysine) solution (Sigma), respectively. After 4 h of incubation at 37 °C, 5% CO2 and 98% humidity, cells were washed twice with PBS and fixed with methanol overnight at -20 °C. Cells were treated with 2% fat-free milk powder (Marvel) in PBS for 1 h to block unspecific antibody binding. Thereafter, cells were incubated for 1 h with PERV-specific antisera (diluted 1:40 in blocking solution). After washing four times with PBS, horseradish peroxidase-labelled protein G (1:5000 in blocking solution) was added to the cells. After 1 h of incubation, cells were washed four times with PBS and the substrate 3-amino-9-ethyl-carbazole (Sigma) was added.

Western blot assays.
Western blots were performed as described by Tacke et al. (2000a ). Supernatants from PERV-producing 293 cells were collected and cell debris was removed by centrifugation at 10000 g for 30 min. Virus was concentrated by ultracentrifugation (54000 g for 3 h) and pelleted through a 20% sucrose cushion (140000 g for 2 h). Resuspended virus pellets were then loaded onto a sucrose gradient (2050%, 200000 g for 3 h). Virus-containing fractions were collected, pelleted, subjected to denaturing 10% SDSPAGE using Tricine buffer and transferred to PVDF membranes by electroblotting. Membranes were blocked with 0·1% Tween-20 and 1% BSA in TBS. Sera were incubated for 12 h at 4 °C at 1:201:50 dilution followed by a further incubation with a 1:5001:1000 dilution of peroxidase-coupled species-specific anti-IgG antiserum for 2 h at room temperature. Antibody binding was visualized using metal-enhanced diaminobenzidine (Pierce) and peroxide. For all assays, a positive control goat antiserum, raised against a 15 kDa band from purified virus from PK-15 cells, and rabbit antiserum, raised against purified whole virus from infected 293 cells, were included (Tacke et al., 2000b ).

Measurement of RT.
RT activity was measured using a commercial assay (Cavidi Tech).

Virus titration.
Supernatants from infected human 293 cells and porcine PK-15 cells were titrated on uninfected human 293 cells in the presence of 8 µg/ml polybrene (PB) (Sigma) and virus infection was measured using IPA.

In vitro infection experiments.
For infection experiments, cell-free supernatants from PERV-producing porcine PK-15 and infected human 293 cells were used. In all cases, cell debris was removed by centrifugation at 10000 g for 30 min. For attempts at virus infection, 616 µg/ml PB or 6 µg/ml protamine sulfate (PS) (Sigma) was added.

Infection of rats.
Cell-free supernatants from porcine PK-15 or PERV-producing human 293 cells were collected and cell debris was removed by centrifugation at 10000 g for 30 min. For some infections, virus was concentrated by ultracentrifugation (54000 g for 3 h). Aliquots of 2 ml of virus-containing supernatant or pelleted virus were injected (titre up to 1x105 TCID50 per animal) either intraperitoneally (i.p.) or intramuscularly (i.m.) into naive rats (Wistar, Charles River Laboratories). For inoculation of cells, porcine PK-15 (1x107) or PERV-producing human 293 (1x108) cells were injected i.p. Rats were immunosuppressed by 10 mg/kg cyclosporin-A (Cs-A) (Sandimmune, Sandoz), which was applied i.m. every second day. Immunosuppressed rats received PERV intravenously (i.v.), i.m. and i.p. For complement inhibition, some rats received 500 µg/kg cobra venom factor (CVF) (Sigma) i.p. 5 days before virus application and on the day of virus inoculation.

Infection of guinea pigs.
Virus-containing cell-free supernatants and pelleted virus, as described above, were applied i.m. and i.p. to naive animals (Dunkin Hartley, Charles River Laboratories).

Analysis of infection conditions
For in vitro and in vivo infection experiments, PERVs produced by the porcine PK-15 cell line as well as by the infected human kidney cell line 293 were used. Virus production was monitored by RT assay (Fig. 1A) and titration (Fig. 1B). Furthermore, in both producer cell lines, virus particles with no major morphological differences were shown in multiple electron microscopy (EM) screenings (Fig. 2).



(12K):

Fig. 1. Characterization of PERVs used for infection experiments. (A) Detection of RT activity in supernatants of porcine PK-15 kidney and PERV-producing human 293 kidney cell lines. The mean±SD of ten different experiments is given. (B) Titration of PERV produced by porcine PK-15 and PERV-producing human 293 cell lines. Titration was performed using uninfected 293 cells. Virus infection was detected by IPA. The mean±SD of three different experiments is given. (C) Infection studies in the presence (+) or absence (-) of PB or PS (6 µg/ml each). Human 293 cells were infected with cell-free supernatants from PERV-producing 293 or PERV/NIH cells (passages 3 or 5): , PERV/293 (-PB); , PERV/293 (+PB); , PERV/293 (+PS); , PERV/NIH3 (-PB); , PERV/NIH3 (+PB); •, PERV/NIH5 (-PB); , PERV/NIH5 (+PB). The mean±SD of three experiments is given.


(133K):

Fig. 2. Electron microscopy of the PERV-producing porcine PK-15 (A) and infected human 293 (B) cell lines. Bar, 500 nm.

As a positive control in all infection studies, human 293 cells were infected in parallel with cell-free supernatants from porcine PK-15 cells in the presence of 8 µg/ml PB. A productive infection could only be seen after 60 days of cultivation, during which the cells were split every 35 days (data not shown). In contrast, human 293 cells infected with virus derived from PERV-producing 293 cells showed productive virus infection 20 days post-infection under the same conditions. These data suggest that virus infection of human 293 cells is much easier with PERV derived from human 293 cells than with PERV derived from porcine cells (Fig. 1C). These results led us to serially passage PERV on 293 cells by transferring supernatants from productively infected 293 cells to uninfected 293 cells. The time required for the establishment of a productive infection in human 293 cells with this serially passaged virus was significantly shortened (Fig. 1C).

Furthermore, extended investigations into the influence of infection enhancers, such as PB and PS, which are commonly used to enhance retrovirus infection in vitro (Themis et al., 1998 ; Seitz et al., 1998 ; Porter et al., 1998 ), were performed. A significant increase of the in vitro infection potential of PERV in the presence of each of the two substances was demonstrated (Fig. 1C). However, no obvious differences in the enhancement of infection were detected when both PB and PS were compared. For that reason, and having in mind the limited lifespan of primary cells, we decided to use 68 µg/ml PB for our infection experiments.

In vitro infection experiments
Infection experiments with primary cells and cell lines of small animals were performed. Mink lung fibroblasts (Mv1Lu) and the feline CRFK and PG4 cell lines were inoculated with PERV derived from porcine PK-15 and infected human 293 cells. Supernatants from all three cell lines were positive for RT activity. Although inoculated CRFK cells released RT, no PERV-specific provirus was found by PCR, indicating that an endogenous feline retrovirus was released. This has been reported for other feline cell lines (Lieber et al., 1973 ). The infected mink Mv1Lu and feline PG4 cells expressed PERV protein, which was measured by IPA, and PERV provirus was detectable by PCR. Therefore mink Mv1Lu and feline PG4 cell lines were productively infected by PERV. Primary cells of rats and cotton rats, including preparations from embryos that contain low levels of differentiated cells which are more susceptible to retroviral infection (Argirova et al., 1973 ), could not be infected (Table 1). Although some of the rat cells released RT activity, the lack of PERV provirus indicated that endogenous retroviruses had been released. This has been shown previously for other permanent cell lines of these species (Gazzolo et al., 1971 ; Kindig & Kirsten, 1967 ).


Table 1. In vitro infection of primary cells and cell lines with PERV


Although it has been demonstrated that human kidney cells can be infected, both by PERV from porcine PK-15 cells (Patience et al., 1997 ; Takeuchi et al., 1998 ) and by PBMCs (Wilson et al., 2000 ), it was important to evaluate PERV infection of other human cells. The human T-cell line C8166, monocyte cell line THP-1, spleen cell line WIL2.NS.6TG and primary PBMCs could be infected with 293-derived PERV. Viral DNA was detected in these infected cells by PCR (Fig. 3AD). Furthermore, all infected cells were productively infected, as shown by RT activity as well as by detection of PERV RNA in the virus pellet using RTPCR.



(55K):

Fig. 3. Infection of human and non-human primate cells with cell-free supernatants from PERV-producing human 293 cells. Provirus was detected by PCR amplification using primers specific for the PERV pol gene, which give an expected amplicon of 817 bp. PERV-producing human 293 cells were used as a positive control. (A) Human infected (lane 1) and uninfected (lane 2) C8166 cells and positive control (lane 3) are shown. (B) Human uninfected (lane 1) and infected (lane 2) THP-1 cells and positive control (lane 3) are shown. (C) Positive control (lane 1) and human infected (lane 2) and uninfected (lane 3) PBMCs are shown. (D) Positive control (lane 1) and human uninfected (lane 2) and infected (lane 3) WIL2.NS.6TG cells are shown. (E)(G) Non-human primate cells. Uninfected (lane 1) and infected (lane 2) cells from baboon spleen (E), baboon PBMCs (F) and rhesus monkey PBMCs (G) are shown. M, 100 bp marker.

In addition, non-human primate cells, including primary kidney cells, primary spleen cells and PBMCs from baboons as well as PBMCs from African green monkeys, pigtailed macaques and rhesus monkeys, were infected in the same manner as the human cell lines. Viral DNA could be detected in PBMCs of rhesus monkey and baboon as well as in baboon spleen cells (Fig. 3EG), but not in African green monkey and pigtailed macaque (data not shown) cells. In all infected cells at 1 week post-infection, RT activity was detected in cell culture supernatants and viral RNA was detected by RTPCR in virus pellets.

In vivo infection experiments
Rats were chosen for the initial attempts to establish a practical animal model because of the reported infection of rat cell lines (Takeuchi et al., 1998 ). In our first in vivo experiment, adult naive rats were inoculated i.p. with 1x108 porcine PK-15 cells, 1x108 PERV-infected human 293 cells or 5x107 mitogen-stimulated porcine PBMCs as well as with pelleted virus from PK-15 and infected 293 cell cultures, respectively. Rats remained uninfected, as shown by the absence of specific antibodies against PERVs at different time-points post-infection as well as by the absence of PERV provirus in the genomic DNA of the spleen, kidneys and lymph nodes of the animals 3 months post-inoculation (data not shown). In a second experiment (Table 2), adult naive rats were inoculated i.m. with pelleted virus from porcine PK-15 and infected human 293 cells (groups 1 and 2). Simultaneously, rats immunosuppressed by Cs-A were inoculated i.m. and i.v. (groups 4 and 5). Frequent measurements of Cs-A indicated that levels were high enough to induce permanent immunosuppression. Due to the lack of PERV provirus and antibodies against PERV 4 weeks post-infection, rats of groups 1, 2, 4 and 5 (Table 2) were inoculated again, this time i.p. with 5x107 porcine PK-15 or infected human 293 cells, respectively. After a further 4 weeks, all animals still remained negative for PERV-specific antibody and PERV DNA, as shown by PCR. Finally, newborn rats (groups 8 and 9) and rats treated with both Cs-A and CVF (for complement inhibition) (groups 1012) were inoculated either i.p. or i.v. with pelleted virus from either porcine PK-15 or infected human 293 cells. These rats also showed no evidence of infection. These data indicate that neither naive, immunosuppressed, immunosuppressed and simultaneously complement-inhibited adult rats nor newborn rats, with a not yet developed immune system, could be infected with PERV under the conditions used in this study.


Table 2. Infection of rats and guinea pigs


Guinea pigs were also used for in vivo infection experiments (Table 2). The same amount of pelleted virus produced by PK-15 cells or 293 cells as given to rats in the above-described experiment was inoculated i.p. Similar to the rats, guinea pigs developed no antibodies to PERV and no PERV provirus was detected in the genomic DNA of spleen, kidneys and lymph nodes of the animals 4 weeks post-inoculation. A subgroup of these animals, therefore, received a second i.p. application of 5x107 PK-15 or 293 cells, respectively. After a further 6 weeks, neither provirus nor antibodies could be detected, indicating that no infection had taken place. The lack of virus or detectable provirus in the tested organs also implicates that, at that time, nearly all porcine cells were eliminated from the recipients organs. In order to evaluate the potential risk from PERVs during xenotransplantation, it is important to know the host range of these viruses and their infectivity for human cells and to study their behaviour in different animal models. The data presented here clearly indicate that PERVs are able to infect human cell lines in vitro, such as the human lymphoid T-cell line C8166, spleen cell line WIL2.NS.6TG, monocyte cell line THP-1 and also primary PBMCs. Other human primary cells such as epithelial cells, muscle cells and fibroblasts are now being studied.

In comparison with PERVs derived directly from PK-15 cells, PERVs produced by human kidney cells demonstrate an enhanced infectivity for human and non-human cells, especially after repeated passaging on uninfected human 293 cells. In contrast to PERVs derived directly from PK-15 cells or to the first passage of PERV on uninfected 293 cells, later passages of the virus did not even require the presence of PB for efficient infection of their target cells in vitro (Fig. 1C). Productive infection by these viruses was detected by RT activity measurement in both the presence and the absence of PB at nearly the same time-points.

In vitro infection of cells of a certain species does not automatically indicate that this species is susceptible in vivo. The complement system and specific and unspecific immune responses of the transplant recipient may prevent infection. However, in the case of transplants from transgenic animals carrying human complement regulatory genes designed to prevent hyperacute rejection, PERV particles produced by these transgenic pigs will not be recognized by the human complement system (Patience et al., 1997 ), as has been shown for many other retroviruses (Takeuchi et al., 1994 , 1996 ). The specific immune system of the transplant recipient will be inhibited by pharmacological immunosuppression, which is designed to prevent immunological rejection of the transplant. Therefore, the final outcome in the human transplant recipient will be determined by all the factors summarized here, e.g. by the susceptibility shown in vitro and the degree of protection remaining after the numerous manipulations performed to protect the transplant.

In that context, infection with PERV in SCID mouse models described recently (van der Laan et al., 2000 ; Deng et al., 2000 ) is of great interest for the evaluation of cross-species virus transmission and replication. In contrast to SCID mice, which completely lack a functional immune system, even heavily immunosuppressed transplant recipients will show partial immune responses. For that reason, we decided to use rats that had been immunosuppressed with Cs-A and CVF in comparison with naive rats and guinea pigs, respectively. In addition to the differences in the state of the immune system, the SCID mouse models and our animal experiments differ in species, virus subtype and inoculated virus titre. To evaluate the influence of these components we have commenced further experiments, which include analysis of a non-human primate model.

We thank R. Eilenstein and B. Löschner for excellent technical assistance, Dr R. Plesker, Dr C. Coulibaly and K. Papadopulos for animal care, Dr S. Norley for critical reading of the manuscript and for helpful discussions, Dr C. Wilson (FDA, Washington, USA), Dr C. Patience (Biotransplant, Boston) and Dr R. A. Weiss (present address Wohl Virion Centre, London, UK) for providing the PERV-infected 293 cell lines. Furthermore, we thank Dr I. Hauser (University Hospital, Frankfurt, Germany) for measurement of Cs-A levels. This work was supported by the German Federal Ministry of Health.

References

Akiyoshi, D. E., Denaro, M., Zhu, H., Greenstein, J. L., Banerjee, P. & Fishman, J. A. (1998). Identification of a full-length cDNA for an endogenous retrovirus of miniature swine. Journal of Virology 72, 4503-4507.[Abstract/Free Full Text]

Argirova, R. M., Zakharova, L. G. & Altstein, A. D. (1973). The sensitivity of embryonal cell cultures from rats and mice of different lines: the transformation-destructive effect of mouse sarcoma virus. Voprosy Virusologii 18, 5459 (in Russian).[Medline]

Armstrong, J. A., Porterfield, J. S. & De Madrid, A. T. (1971). C-type virus particles in pig kidney cell lines. Journal of General Virology 10, 195-198.[Abstract/Free Full Text]

Bouillant, A. M. P., Greig, A. S., Lieber, M. M. & Todaro, G. J. (1975). Type C virus production by a continuous line of pig oviduct cells (PFT). Journal of General Virology 27, 173-180.[Abstract/Free Full Text]

Breese, S. S.Jr (1970). Virus-like particles occurring in cultures of stable pig kidney cell lines. Archiv für die Gesamte Virusforschung 30, 401-404.[Medline]

Czauderna, F., Fischer, N., Boller, K., Kurth, R. & Tönjes, R. (2000). Establishment and characterization of molecular clones of porcine endogenous retroviruses replicating on human cells. Journal of Virology 74, 4028-4038.[Abstract/Free Full Text]

Deng, Y. M., Tuch, B. E. & Rawlinson, W. D. (2000). Transmission of porcine endogenous retroviruses in severe combined immunodeficient mice xenotransplanted with fetal porcine pancreatic cells. Transplantation 70, 1010-1016.[Medline]

Denner, J. (1998). Immunosuppression by retroviruses: implications for xenotransplantation. Annals of the New York Academy of Sciences 862, 75-86.[Medline]

Denner, J. (1999). Immunsuppression durch Retroviren: Implikationen für die Xenotransplantation. Transplantationsmedizin 11, 223-233.

Fan, H. (1994). Retroviruses and their role in cancer. In The Retroviridae , pp. 313-362. Edited by J. A. Levy. New York:Plenum Press.

Frazier, M. E. (1985). Evidence for retrovirus in miniature swine with radiation-induced leukemia or metaplasia. Archives of Virology 83, 83-97.[Medline]

Freshney, R. I. (1987). Culture of Animal Cells. A Manual of Basic Technique. New York: John Wiley.

Gazzolo, L., Smicovic, D. & Martin-Berthelon, M. C. (1971). The presence of C-type RNA virus particles in a rat embryo cell line spontaneously transformed in tissue culture. Journal of General Virology 12, 303-311.[Abstract/Free Full Text]

Hardy, W. D. (1993). Feline oncoretroviruses. In The Retroviridae , pp. 109-180. Edited by J. A. Levy. New York:Plenum Press.

Kindig, D. A. & Kirsten, W. H. (1967). Virus-like particles in established cell lines: electron microscopic observations. Science 155, 1543-1545.[Abstract/Free Full Text]

Le Tissier, P. l., Stoye, J. P., Takeuchi, Y., Patience, C. & Weiss, R. A. (1997). Two sets of human-topic pig retrovirus. Nature 389, 681-682.[Medline]

Lieber, M. M., Beneviste, R. E., Livingston, D. M. & Todaro, G. J. (1973). Mammalian cells in culture frequently release type C viruses. Science 182, 56-59.[Abstract/Free Full Text]

Lieber, M. M., Sherr, C. J., Benveniste, R. E. & Todaro, G. J. (1975). Biologic and immunologic properties of porcine type C viruses. Virology 66, 616-619.[Medline]

Luft, J. H. (1961). Improvements in epoxy resin embedding methods. Journal of Biophysical and Biochemical Cytology 9, 409-413.

Martin, U., Kiessig, V., Blusch, J. H., Haverich, A., von der Helm, K., Herden, T. & Steinhoff, G. (1998). Expression of pig endogenous retrovirus by primary porcine endothelial cells and infection of human cells. Lancet 352, 692-694.[Medline]

Paradis, K., Langford, G., Long, Z., Heneine, W., Sandstrom, P., Switzer, W. M., Chapman, L. E., Lockey, C., Onions, D. & Otto, E. (1999). Search for cross-species transmission of porcine endogenous retrovirus in patients treated with living pig tissue. Science 285, 1236-1241.[Abstract/Free Full Text]

Patience, C., Takeuchi, Y. & Weiss, R. A. (1997). Infection of human cells by an endogenous retrovirus of pigs. Nature Medicine 3, 282-286.[Medline]

Porter, C. D., Lukacs, K. V., Box, G., Takeuchi, Y. & Collins, M. K. (1998). Cationic liposomes enhance the rate of transduction by recombinant retroviral vector in vitro and in vivo. Journal of Virology 72, 4832-4840.[Abstract/Free Full Text]

Seitz, B., Baktanian, E., Gordon, E. M., Anderson, W. F., LaBree, L. & McDonnell, P. J. (1998). Retroviral vector-mediated gene transfer into keratocytes: in vitro effects of polybrene and protamine sulfate. Graefes Archive for Clinical and Experimental Ophthalmology 23, 602-612.

Starzl, T. E., Fung, J., Tzakis, A., Todo, S., Demetris, A. J., Marino, I. R., Doyle, H., Zeevi, A., Warty, V. & Michaels, M. (1993). Baboon-to-human liver transplantation. Lancet 341, 65-71.[Medline]

Swindle, M. M. (1998). Defining appropriate health status and management programs for specific-pathogen-free swine for xenotransplantation. Annals of the New York Academy of Sciences 862, 111-120.[Medline]

Tacke, S. J., Kurth, R. & Denner, J. (2000a). Porcine endogenous retroviruses inhibit human immune cell function: risk for xenotransplantation? Virology 268, 87-93.[Medline]

Tacke, S. J., Specke, V., Stephan, O., Seibold, E., Bodusch, K. & Denner, J. (2000b). Porcine endogenous retroviruses: diagnostic assays and evidence for immunosuppressive properties. Transplantation Proceedings 32, 1166.[Medline]

Takeuchi, Y., Cosset, F.-L., Lachmann, P. J., Okada, H., Weiss, R. A. & Collins, M. K. L. (1994). Type C retrovirus inactivation by human complement is determined by both the viral genome and the producer cell. Journal of Virology 68, 8001-8007.[Abstract/Free Full Text]

Takeuchi, Y., Porter, C. D., Strahan, K. M., Preece, A. F., Gustafsson, K., Cosset, F.-L., Weiss, R. A. & Collins, M. K. L. (1996). Sensitization of cells and retroviruses to human serum by (α13)galactosyltransferase. Nature 379, 85-88.[Medline]

Takeuchi, Y., Patience, C., Magre, S., Weiss, R. A., Banerjee, P. T., Le Tissier, P. & Stoye, J. P. (1998). Host range and interference studies of three classes of pig endogenous retrovirus. Journal of Virology 72, 9986-9991.[Abstract/Free Full Text]

Themis, M., Forbes, S. J., Chan, L., Cooper, R. G., Etheridge, C. J., Miller, A. D., Hodgson, H. J. & Coutelle, C. (1998). Enhanced in vitro and in vivo gene delivery using cationic agent complexed retrovirus vectors. Gene Therapy 5, 1180-1186.[Medline]

Todaro, G. J., Benveniste, R. E., Lieber, M. M. & Sherr, C. J. (1974). Characterization of a type C virus released from the porcine cell line PK(15). Virology 58, 65-74.[Medline]

van der Laan, L. J. W., Lockely, C., Griffeth, B. C., Fraiser, F. S., Wilson, C. A., Onions, D. E., Hering, J., Long, Z., Otto, E., Torbett, B. E. & Salomon, D. R. (2000). Infection by porcine endogenous retrovirus after islet xenotransplantation in SCID mice. Nature 407, 501-504.

Wilson, C. A., Wong, S., Muller, J., Davidson, C. E., Rose, T. M. & Burd, P. (1998). Type C retrovirus released from porcine primary peripheral blood mononuclear cells infects human cells. Journal of Virology 72, 3082-3087.[Abstract/Free Full Text]

Wilson, C. A., Wong, S., VanBrocklin, M. & Federspiel, J. (2000). Extended analysis of the in vitro tropism of porcine endogenous retrovirus. Journal of Virology 74, 49-56.[Abstract/Free Full Text]

Received 22 June 2000; accepted 21 December 2000.