Research Article

Geographically distant isolates of the crinivirus Cucurbit yellow stunting disorder virus show very low genetic diversity in the coat protein gene

Journal of General Virology 2001; 82(4):929

PubMed

With thanks to our partners for supporting this archive.

Abstract

The population structure and genetic variation of Cucurbit yellow stunting disorder virus (CYSDV) isolates were estimated by single-strand conformation polymorphism and nucleotide sequence analyses of the CYSDV coat protein gene. Analysis of 71 isolates collected from Spain, Jordan, Turkey, Lebanon, Saudi Arabia and North America showed that, from a genetic viewpoint, these isolates could be divided into two diverged subpopulations: an Eastern subpopulation composed of Saudi Arabian isolates and a Western subpopulation containing the rest of the CYSDV isolates. The genetic variation within the Western subpopulation was very small (nucleotide identity >99%) in spite of the extensive and discontinuous geographical distribution and different years of collection. We also estimated the within-isolate genetic structure and variation of three CYSDV isolates by analysing 30 clones per isolate. Our results showed that these CYSDV isolates had a quasispecies structure.



RNA viruses have a potential for high genetic variation due to the absence of proofreading activity of their RNA replicases, their large populations and rapid replication (Holland et al., 1982 ; Domingo & Holland, 1997 ). In fact, the potential for variation is so large that a single virus isolate is not a single sequence, but a population (termed quasispecies) of mutant sequences that vary around a consensus sequence (Holland et al., 1982 ). However, the high mutability of RNA viruses need not result in high genetic variation, as other factors, such as natural selection, bottleneck episodes etc., can reduce the virus genetic diversity (Roossinck, 1997 ; Holland & Domingo, 1998 ).

We studied the genetic variation of the plant virus Cucurbit yellow stunting disorder virus (CYSDV), a member of the genus Crinivirus within the family Closteroviridae (Martelli et al., 2000 ). CYSDV has a bipartite single-strand plus-sense RNA genome encapsidated in long filamentous and flexuous particles. CYSDV infections are phloem-limited and the virus is transmitted in a semipersistent manner by the whiteflies Bemisia tabaci (Gennadius) and B. argentifolii (Bellows & Perring) (Célix et al., 1996 ; Martelli et al., 2000 ). CYSDV was first identified in the United Arab Emirates in the early 1990s (Hassan & Duffus, 1991 ) and since then it has been reported in other Middle East countries and in the Mediterranean basin, where it is recognized as a rapidly emerging and economically important plant virus (Célix et al., 1996 ; Wisler et al., 1998 ; Rubio et al., 1999 ; Abou-Jawdah et al., 2000 ). Just recently, CYSDV has been reported from North America (Kao et al., 2000 ).

We used single-strand conformation polymorphism (SSCP) and nucleotide sequence analyses of the CYSDV coat protein (CP) gene to estimate the population structure and genetic variation within individual CYSDV isolates, and between CYSDV isolates collected in different years from different areas of the world. Also, we estimated the genetic variation of a region of the CYSDV HSP70 homologue gene (HSP70) from data obtained in a previous report (Rubio et al., 1999 ) and from new data obtained after analysing additional CYSDV isolates.

Seventy-one CYSDV isolates were collected from cucurbit plants (squash, Cucurbita pepo L.; cucumber, Cucumis sativus L.; watermelon, Citrullus lanatus Schard; and melon, Cucumis melo L.) from different curcubit-growing regions included in the Mediterranean basin, Middle East and North America (Table 1). Total RNAs were extracted from curcubit leaf tissue by using Tri Reagent (Molecular Research Center) according to manufacturers instructions, and were used as the template for RTPCR. Specific oligonucleotide primers CYSCPf (5' ATGGCGAGTTCGAGTGAGAATAA 3') and CYSCPr (5' ATTACCACAGCCACCTGGTGCTA 3') corresponding to both ends of the CYSDV CP gene were designed based on the nucleotide sequence published by Livieratos et al. (1999) . RT was performed in a reaction mixture (20 µl) of 1xAMV buffer, 200 µM of each dNTP, 40 ng of CYSCPr primer, 2 units of Rnasin Ribonuclease Inhibitor (Promega), 0·3 units of AMV reverse transcriptase (Promega). The mixture was incubated at 42 °C for 45 min. PCR was performed in a 20 µl reaction containing 2 µl of the synthesized cDNA, 2 µl 10xbuffer, 5 units Pfu (Stratagene), 1 ng/µl of each primer. The mixture was incubated first at 94 °C for 4 min, followed by 30 cycles at 94 °C for 30 s, 50 °C, 72 °C for 2 min, and by a final cycle at 72 °C for 5 min. When the RTPCR products were electrophoresed in agarose gels, a unique DNA species of 755 nt, the expected size, was detected for each CYSDV isolate. No DNA was obtained from non-CYSDV-infected plants (data not shown).


Table 1. Geographical origin of CYSDV and number of isolates showing different SSCP patterns


For a rapid differentiation of CYSDV isolates we performed SSCP analyses on CYSDV CP RTPCR products. These were first digested with EcoRI into two fragments of 304 and 451 nt for better resolution (Orita et al., 1989 ; Rubio et al., 1996 ). SSCP conditions were the same as described in previous reports (Rubio et al., 1996 , 1999 ), but electrophoresis was done in 12% polyacrylamide gels at 200 V, 4 °C for 3 h. After analysing 68 isolates (Turkish isolates were not included), three different SSCP patterns (A, B and C; Fig. 1 and Table 1) were distinguished. The mobility, number and intensity of bands of each SSCP pattern can be used as a first estimation of the population structure within individual isolates (Enomoto et al., 1994 ; Rubio et al., 2000 ). The SSCP patterns observed for CYSDV (Fig. 1) were composed of three or four bands. Given that the expected SSCP patterns were composed of four bands from the two EcoRI DNA fragments analysed, and assuming that the three band patterns could be four band patterns with two bands too close to be distinguished, this suggests that all CYSDV isolates analysed were most likely composed of a predominant single sequence variant. Additionally, to confirm this we estimated more accurately the within-isolate population composition of three isolates (the Saudi Arabian isolate SA1 showing SSCP pattern A, the Spanish isolate S1 showing pattern B and the Lebanese isolate L1 showing pattern C; Fig. 1) by SSCP analysis of 30 CP clones per isolate. For all isolates, more than 93% of the clones showed the same SSCP pattern as did the original RTPCR product (Fig. 1), supporting the hypothesis that each isolate had one predominant sequence variant. To estimate the genetic distances between sequence variants from individual isolates, we determined the nucleotide sequences of 14 clones (four clones showing SSCP pattern A1 and one with pattern A2 from isolate SA1, four with pattern B1 and one with pattern B2 from isolate S1, and two clones with pattern C1 and two with pattern C2 from isolate L1; Fig. 1). The nucleotide sequences were aligned using CLUSTAL W (Thompson et al., 1994 ) and the nucleotide distances were estimated by DNADIST of PHYLIP using the Jukes and Cantor method for correction of superimposed substitutions (Felsenstein, 1989 ). The frequencies of the different SSCP patterns and nucleotide distances derived from clones with the same and different SSCP patterns were then used to estimate the genetic diversity (average genetic distance between two sequence variants selected randomly) within CYSDV isolates by the method of Lynch & Crease (1990) . According to our estimations, the mean nucleotide distance between clones showing the same SSCP pattern was 0·00071±0·00155, whereas that for clones with different SSCP patterns was 0·00294±0·00097. The high standard error with respect to the mean value observed here for clones with the same SSCP pattern resulted because most of these clones had the same nucleotide sequence, but two clones showed one and four nucleotide substitutions with respect to the other clones. The within-isolate CP genetic diversities from the CYSDV isolates SA1, S1 and L1 were 0·00019±0·00025, 0·00073±0·00058 and 0·00038±0·00037, respectively. These results were similar to those reported for other plant viruses (Schneider & Roossinck, 2000 ; Kong et al., 2000 ) and indicate that CYSDV isolates have a quasispecies nature (Holland et al., 1982 ).


Table 1). The following lanes (e.g. A1) represent SSCP patterns obtained after analysing 30 clones from each RTPCR product obtained from the isolates SA1 (from Saudi Arabia), S1 (from Spain) and L1 (from Lebanon), which showed the SSCP patterns A, B and C, respectively. Numbers at the bottom indicate the number of clones with that SSCP pattern out of 30 clones analysed per isolate.


To estimate the genetic distance between isolates, the RTPCR products of the CP gene were sequenced and compared from 17 CYSDV isolates: three from Turkey (unknown SSCP patterns), four from Saudi Arabia (all showing pattern A), four from Spain (three with pattern B and one with pattern C), one from Jordan (pattern C), three from Lebanon (pattern C), two from North America (Mexico and USA, pattern C). The mean genetic distance between CYSDV isolates with the same SSCP pattern was 0·00117±0·00135, which indicates the high sensitivity of SSCP analyses under our conditions, similar to other SSCP analyses previously reported (Rubio et al., 1996 , 1999 ; Kong et al., 2000 ). The mean genetic distance between isolates showing pattern B and isolates showing pattern C was 0·00095±0·00149. The Turkish isolates showed a high nucleotide identity with isolates showing SSCP patterns B and C. However, isolates showing SSCP pattern A showed high genetic distances (between 0·1160 and 0·1227) with respect to the rest of the isolates. Thus, from the genetic viewpoint the CYSDV isolates analysed here could be divided in two groups or subpopulations: a Western group from Spain, Jordan, Turkey, Lebanon and North America and an Eastern group from Saudi Arabia. Within each group the genetic diversity was very low (0·00250±0·00089 for the Western group isolates and 0·00213±0·00139 for the Eastern group isolates). Similar population division was found when a portion of the CYSDV HSP70 homologue gene was analysed (Rubio et al., 1999 ). However, given that in some areas (e.g. Turkey and Saudi Arabia) the number of isolates analysed here was very low, we must consider the possible existence of more diverged isolates in these areas.

The low genetic diversity found in the Western group, distributed in such an extensive area (Europe, Middle East and North America) is surprising for an RNA virus. One possible cause of this low diversity could be the rapid expansion of CYSDV, possibly related with the recent colonization and explosion of the CYSDV whitefly vectors into new areas (Brown et al., 1995 ). For example, in Spain the displacement of another Crinivirus affecting cucurbits, Beet pseudo-yellows virus (BPYV), by CYSDV has been associated with the displacement of the BPYV vector, Trialeurodes vaporariorum, by the CYSDV vector, B. tabaci (Célix et al., 1996 ; Berdiales et al., 1999 ). However, the low genetic variation found here was not only for CYSDV isolates geographically distant, but also for CYSDV isolates separated temporally over a 3 year period (Table 1). Negative selection due to functional constraints of virus-encoded proteins can limit the extent of genetic variation in virus populations. Therefore, we estimated the degree and sense of selection by calculating the ratio of nucleotide diversity at nonsynonymous (dN) to synonymous sites (dS) (as described by Pamilo & Bianchi, 1993 ; Li, 1993 ) of the HSP70 and CP coding regions between CYSDV Western and Eastern subpopulations. The dN/dS ratio was 0·07048 for CP and 0·10452 for HSP70, suggesting that both coding regions are under high negative selective constraints. However, this cannot explain the low variation at the synonymous positions found between isolates within the Western subpopulation. Other constraints, such as those imposed by secondary structure or expression recognition signals might have also limited the genetic variation (Roossinck, 1997 ). A model of periodic selection, proposed by Moya et al. (1993) , consisting of negative selection alternating with rapid expansion of a genome with high fitness (positive selection), could account for the genetic stability observed for CYSDV.

Spatial and temporal genetic stability have also been reported for the tobamoviruses Pepper mild mottle virus (Rodríguez-Cerezo et al., 1989 ) and Tobacco mild green mosaic virus (Fraile et al., 1996 ). Within the genus Crinivirus, data concerning the genetic variation are scarce and fragmented. Analysis of partial HSP70 homologue sequences of eight BPYV isolates from Italy, Crete and California showed very low genetic diversity (Rubio et al., 1999 ; Fig. 2). Although a larger number of isolates should be analysed for a more accurate estimation of BPYV genetic diversity, we can conclude that with respect to the genomic region analysed, geographically distant BPYV isolates are genetically very similar. Analysis of eight Ugandan isolates of another Crinivirus, Sweet potato chlorotic stunt virus (SPCSV; Alicai et al., 1999 ), showed a small genetic diversity for HSP70 and CP genes (Fig. 2). In contrast, a partial CP gene sequence of 20 Californian isolates of Citrus tristeza virus (CTV), a member of the genus Closterovirus (the other genus within the family Closteroviridae), showed a significantly greater genetic diversity (Fig. 2) despite the low dN/dS ratio observed (0·02739), suggesting high negative selection pressure (unpublished data). The different genetic variation for CTV and CYSDV might be caused in part by differences in factors such as host plants and/or modes of transmission. CTV has perennial host plants that can be infected for years whereas CYSDV hosts are annual and infections are generally less than 60 days old. CYSDV is transmitted only by its whitefly vector, whereas CTV is also transmitted by vegetative propagation, a means which could remove selective constraints related to insect transmission.



(24K):

Fig. 2. Genetic diversities (average genetic distance between two isolates selected randomly) and their standard errors for four viruses in the family Closteroviridae: for SPCSV the HSP70 and CP genes from eight isolates from Uganda (Alicai et al., 1999 ) were analysed. For CTV a portion of the CP gene from 20 Californian isolates was analysed (unpublished data). For CYSDV and BPYV isolates, SSCP analyses were performed and a number of isolates per each SSCP pattern were selected for nucleotide sequence comparisons. The number of isolates used for SSCP analyses is shown and the number sequenced is given in parenthesis. For CYSDV a portion of HSP70 gene from 8 (2) Spain, 4 (2) Jordan, 2 (2) Turkey and 12 (3) Lebanon isolates was analysed. The CYSDV CP gene of 22 (3) Spain, 7 (1) Jordan, 3 (3) Turkey, 12 (3) Lebanon and 13 (2) North America isolates was also analysed. For BPYV a portion of HSP70 gene from 1 (1) isolate from California, 3 (2) from Crete and 4 (2) from Italy (Rubio et al., 1999 ) was analysed.
These studies were supported in part by a grant to Bryce W. Falk from the US Department of Agriculture. Luis Rubio was supported in part by a postdoctoral fellowship from Ministerio de Educación y Ciencia, Spain. Han-Xin Lin was supported in part by the China Scholarship Council from The Ministry of Education, PR China. We acknowledge the help of Dr John Kao in obtaining North American samples of CYSDV.

Footnotes

The GenBank accession numbers of the sequences reported in this paper are AF312795AF312810.

References

Abou-Jawdah, Y., Sobh, H., Fayad, A., Lecoq, H., Delécolle, B. & Trad-Ferré, J. (2000). Cucurbit yellow stunting disorder virus a new threat to cucurbits in Lebanon. Journal of Plant Pathology 82, 5560.

Alicai, T., Fenby, N. S., Gibson, R. W., Adipala, E., Vetten, H. J., Foster, G. D. & Seal, S. E. (1999). Occurrence of two serotypes of sweet potato chlorotic stunt virus in East Africa and their associated differences in coat protein and HSP70 homologue gene sequences. Plant Pathology 48, 718-726.

Berdiales, B., Bernal, J. J., Sáez, E., Woudt, B. & Rodríguez-Cerezo, E. (1999). Occurrence of cucurbit yellow stunting disorder virus (CYSDV) and beet pseudo-yellows virus in cucurbit crops in Spain and transmission of CYSDV by two biotypes of Bemisia tabaci. European Journal of Plant Pathology 105, 211-215.

Brown, J. K., Frohlich, D. R. & Rosell, R. C. (1995). The sweet potato or silverleaf whiteflies: biotypes of Bemisia tabaci or a species complex? Annual Review of Entomology 40, 511-534.

Célix, A., López-Sesé, A., Almarza, N., Gómez-Guillamón, M. L. & Rodríguez-Cerezo, E. (1996). Characterization of cucurbit yellow stunting disorder virus, a Bemisia tabaci-transmitted closterovirus. Phytopathology 86, 1370-1376.

Domingo, E. & Holland, J. J. (1997). RNA virus mutations and fitness for survival. Annual Review of Microbiology 51, 151-178.[Medline]

Enomoto, N., Kurosaki, M., Tanaka, Y., Marumo, F. & Sato, C. (1994). Fluctuation of hepatitis C virus quasispecies in persistent infection and interferon treatment revealed by single-strand conformation polymorphism analysis. Journal of General Virology 75, 1361-1369.[Abstract/Free Full Text]

Felsenstein, J. (1989). PHYLIP: Phylogenetic Inference Package (version 3.2). Cladistics 5, 164-166.

Fraile, A., Malpica, J. M., Aranda, M. A., Rodríguez-Cerezo, E. & García-Arenal, F. (1996). Genetic diversity in tobacco mild green mosaic tobamovirus infecting the wild plant Nicotiana glauca. Virology 223, 148-155.[Medline]

Hassan, A. A. & Duffus, J. E. (1991). A review of a yellowing and stunting disorder in the United Arab Emirates. Emirates Journal of Agricultural Sciences 2, 1-16.

Holland, J. & Domingo, E. (1998). Origin and evolution of viruses. Virus Genes 16, 13-21.[Medline]

Holland, J. J., Spindler, K., Horodyski, F., Grabau, E., Nichol, S. & VandePol, S. (1982). Rapid evolution of RNA genomes. Science 215, 1577-1582.[Abstract/Free Full Text]

Kao, J., Jia, L., Tian, T., Rubio, L. & Falk, B. W. (2000). First report of Cucurbit yellow stunting disorder virus (Genus Crinivirus) in North America. Plant Disease 84, 101.

Kong, P., Rubio, L., Polek, M. & Falk, B. W. (2000). Population structure and genetic diversity of California citrus tristeza virus (CTV) field isolates. Virus Genes 21, 139-145.[Medline]

Li, W.-H. (1993). Unbiased estimation of the rates of synonymous and nonsynonymous substitutions. Journal of Molecular Evolution 36, 96-99.[Medline]

Livieratos, I. C., Avgelis, A. D. & Coutts, R. H. A. (1999). Molecular characterization of the cucurbit yellow stunting disorder virus coat protein gene. Phytopathology 89, 1050-1055.[Medline]

Lynch, M. & Crease, T. J. (1990). The analysis of population survey data on DNA sequence variation. Molecular Biology and Evolution 7, 377-394.[Abstract]

Martelli, G. P., Agranovsky, A. A., Bar-Joseph, M., Boscia, D., Candresse, T., Coutts, R. H. A., Dolja, V. V., Duffus, J. E., Falk, B. W., Gonsalves, D., Jelkmann, W., Karasev, A. V., Minafra, A., Murant, A., Namba, S., Niblett, C. L., Vetten, H. J. & Yoshikawa, N. (2000). Family Closteroviridae. In Seventh Report of the International Committee on Taxonomy of Viruses , pp. 943-952. Edited by M. H. V. Van Regenmortel, C. M. Fauquet, D. H. L. Bishop, E. B. Carstens, M. K. Estes, S. M. Lemon, J. Maniloff, M. A. Mayo, D. J. McGeoch, C. R. Pringle & R. B. Wickner. New York & San Diego: Academic Press.

Moya, A., Rodríguez-Cerezo, E. & García-Arenal, F. (1993). Genetic structure of natural populations of the plant RNA virus tobacco mild green mosaic virus. Molecular Biology and Evolution 10, 449-456.

Orita, M., Suzuki, Y., Sekiya, T. & Hayashi, K. (1989). Rapid and sensitive detection of point mutations and DNA polymorphisms using the polymerase chain reaction. Genomics 5, 874-879.[Medline]

Pamilo, P. & Bianchi, N. O. (1993). Evolution of the Zfx and Zfy genes: rates and interdependence between the genes. Molecular Biology and Evolution 10, 271-281.[Abstract]

Rodríguez-Cerezo, E., Moya, A. & García-Arenal, F. (1989). Variability and evolution of the plant RNA virus pepper mild mottle virus. Journal of Virology 63, 2198-2203.[Abstract/Free Full Text]

Roossinck, M. J. (1997). Mechanisms of plant virus evolution. Annual Review of Phytopathology 35, 1953-1965.

Rubio, L., Ayllón, M. A., Guerri, J., Pappu, H., Niblett, C. & Moreno, P. (1996). Differentiation of citrus tristeza closterovirus (CTV) isolates by single-strand conformation polymorphism analysis of the coat protein gene. Annals of Applied Biology 129, 479-489.

Rubio, L., Soong, J., Kao, J. & Falk, B. W. (1999). Geographic distribution and molecular variation of isolates of three whitefly-borne closteroviruses of cucurbits: lettuce infectious yellows virus, cucurbit yellow stunting disorder virus, and beet pseudo-yellows virus. Phytopathology 89, 707-711.[Medline]

Rubio, L., Guerri, J. & Moreno, P. (2000). Characterization of citrus tristeza virus isolates by single strand conformation polymorphism analysis of DNA complementary to their RNA population. In Proceedings of the 14th Conference of the International Organization of Citrus Virologists. Edited by R. H. Yokomi, J. V. da Graca & R. F. Lee. Riverside, California: IOCV (in press).

Schneider, W. L. & Roossinck, M. J. (2000). Evolutionary related Sindbis-like plant viruses maintain different levels of population diversity in a common host. Journal of Virology 74, 3130-3134.[Abstract/Free Full Text]

Thompson, J. D., Higgins, D. G. & Gibson, T. J. (1994). CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, positions-specific gap penalties and weight matrix choice. Nucleic Acids Research 22, 4673-4680.[Abstract/Free Full Text]

Wisler, G. C., Duffus, J. E., Liu, H. Y. & Li, R. H. (1998). Ecology and epidemiology of whitefly-transmitted Closteroviruses. Plant Disease 82, 270-280.

Received 13 November 2000; accepted 15 December 2000.