Demonstration by single-cell PCR that Reed-Sternberg cells and bystander B lymphocytes are infected by different Epstein-Barr virus strains in Hodgkin's disease

EpsteinBarr virus (EBV) is now firmly associated with Hodgkins disease (HD), and a monoclonal and circular episomal form of the EBV genome is found in ReedSternberg (RS) cells of more than 50% of patients with HD (Brousset et al., 1993 ; Herbst et al., 1990 ; Weiss et al., 1987 , 1989 ). EBV-positive RS cells express latent membrane protein-1 (LMP-1) (Delsol et al., 1992 ; Herbst et al., 1991 ), which has oncogenic properties (Baichwal & Sugden, 1988 ; Wang et al., 1985 ). Sequences from the carboxy terminus influence cell growth, differentiation and apoptosis by interacting with the tumour necrosis factor receptor-associated signalling factors (TRAFs) and the NF-κB family of transcriptional regulators (Izumi & Kieff, 1997 ; Kaye et al., 1996 ). However, in most EBV-positive cases of HD, affected lymph nodes also contain rare, EBV-positive bystander B lymphocytes (Brousset et al., 1993 ; Hummel et al., 1992 ). In a previous report, using total DNA extracted from lymph nodes affected by HD, we demonstrated the presence of two distinct EBV strains in the same HD biopsy (Meggetto et al., 1997 ). However, their cellular localization (i.e. RS cells vs bystander B lymphocytes) could not be determined clearly.

In the present study, we studied 13 patients with EBV-associated HD in which EBV-positive RS cells co-existed with rare, EBV-positive bystander small lymphocytes. Of these cases, frozen specimens were available for three cases and in two of them we also had the corresponding lymphoblastoid cell lines. These cases are different from those reported previously, which were not included in the present study because frozen lymph node biopsy specimens were exhausted (Meggetto et al., 1997 ). In each case, we performed a PCR assay to determine the LMP-1 gene sequence, using DNA extracted from (i) whole lymph node cells and (ii) single RS cells isolated from tissue sections by micromanipulation. The analysis of LMP-1 sequence polymorphism using single-cell PCR demonstrates that, in each case, all RS cells were infected by the same EBV genome, which may be different from that infecting bystander B lymphocytes.

Detection of EBV.
EBV was detected by in situ hybridization with an EBV-(EBER)-PNA probe/FITC kit (DAKO).

PCR analysis of the LMP-1 gene.
Total DNA extracted from lymph node biopsies affected by HD was amplified by the PCR strategy described by Mehl et al. (1998) . Briefly, LMP-1 PCR products were amplified by nested PCR with two sets of primers. For the 5'-fragment, the primers were as follows: 8617 (5' GGTCCGTCGCCGGCTCCACTCACGAGCAGG 3'; B95.8 coordinates 168617168646) and 9580 (5' CCAAGAAACACGCGTTACTCTGACGTAGCC 3'; 169551169580); for nested PCR, 8667 (5' GTTAGAGTCAGATTCATGGCCAGAATCATCG 3'; 168667168697) and 9494 (5' CCTGACACACTGCCCTCGAGG 3'; 169471169494). For the 3'-fragment, the primers were as follows: 7832 (5' GCCTGGTAGTTGTGTTGTGCAGAGGTC 3'; 167832167858) and 8785 (5' CGATTTTAATCTGGATGTATTACCATGG 3'; 168758168785); for nested PCR, 7901 (5' GGCGGAGTCTGGCAACGCCCGGGTCCTTG 3'; 167901167929) and 8702 (5' GCTACCGATGATTCTGGCCATGAATCTGAC 3'; 168673168702).

PCR amplification was performed in a final volume of 50 µl containing 1 µl of each primer (50 µM), 5 µl 10x polymerase buffer, 8 µl each dNTP (1·25 mM), 5 µl DMSO, 500 ng genomic DNA and 1·25 U AmpliTaq Gold polymerase (Perkin Elmer). Reaction mixtures were covered with mineral oil, placed in a 480 thermal cycler (Perkin Elmer) and subjected to the following program: 35 cycles at 94 °C for 1 min, 65 °C (or 55 °C for the nested PCR) for 1 min and 72 °C for 1 min. For all PCR amplifications, a pre-PCR heating step at 94 °C for 10 min to activate the AmpliTaq Gold enzyme and a final period of 10 min at 72 °C to complete the reaction were included. PCR products were analysed by agarose gel electrophoresis.

DNA sequencing.
Fifty ng of each PCR product was sequenced with an ABI PRISM dye terminator kit (Perkin Elmer) supplemented with 7·5 pmol of each primer. Reaction mixtures were placed in a 2400 thermal cycler (Perkin Elmer) and subjected to a program that followed the manufacturers recommendations. Sequence analysis was performed with the OMIGA software. In addition to the primers used for amplification, internal primers used for sequencing were: LMP-2 (5' GACTGGACTGGAGGAGCCCTC 3'; B95.8 coordinates 169319169339), LMP-4 bis (5' CTCTCTGGAATTTGCACGGA 3'; 169091169110), LMP-9S (5' ATCATTTCCAGCAGAGTCGC 3'; 168370168389), LMP-13AS (5' AACGAGGGCAGACACCACCT 3'; 168644168663) and LMP-11AS (5' TGATTAGCTAAGGCATTCCCT 3'; 168075168095).

Extraction of DNA from single cells.
Each isolated cell was placed in a tube containing 12 µl extraction solution (50 mM TrisHCl, pH 8, 10 mM EDTA, 100 mM NaCl, 200 µg/ml proteinase K). After an overnight proteinase K digestion at 37 °C followed by 10 min inactivation of the proteolytic enzyme at 95 °C, the extracted DNA was used for PCR amplification.

Characterization of different isoforms of the LMP-1 gene in total DNA from lymph node biopsies affected by HD
All lymph node biopsies affected by HD showed EBV-positive RS cells and bystander B lymphocytes (data not shown). No other populations of cells in the lymph node were EBV-positive.

PCR amplifications of the 5'-segment of the LMP-1 gene of total DNA extracted from the lymph node of the three cases yielded single fragments. PCR amplification of the 3' region of cases 2 and 3 yielded only single fragments, whereas two distinct fragments were obtained for case 1 (designated Ta and Tb), which were cloned into pGEM-T. Fragments Ta and Tb were of different sizes compared with the 3'-fragment amplified from the standard B95.8 used as a control. These results suggested that the lymph node of case 1 contained two EBV strains (Table 1).

Table 1. EBV sequences obtained from lymph node biopsies and lymphoblastoid cell lines

In order to substantiate this hypothesis further, the 5' region (fragment T1) and the 3' regions of both fragments Ta and Tb of the LMP-1 gene were sequenced after purification from agarose gel. Fifty ng of each fragment was sequenced. Except for the presence of the 30 bp deletion, possibly associated with an increased transforming potential of the LMP-1 protein (Li et al., 1996 ), the Ta and Tb fragments showed different sequences. The Tb fragment contained five repeats of the 33 bp motif, whereas the Ta fragment contained only three repeats (the corresponding fragment amplified from the standard B95.8 isolate contains 4·5 repeats of the 33 bp motif; Baer et al., 1984 ). Most importantly, sequence differences observed between the two fragments Ta and Tb involved not only the number of 33 bp repeats but also several point mutations. In effect, whilst the 5' regions of the genes that yielded fragments Ta and Tb were identical (i.e. the T1 fragment), four different point mutations (positions 229, 309, 334, 366 and 382) were found in fragment Tb relative to the B95.8 sequence, whereas two point mutations (positions 338 and 382) were found in fragment Ta (Table 2). These mutations were responsible for amino acid changes in comparison with the standard B95.8 genome (Table 2). Interestingly, these point mutations in the LMP-1 gene have already been described in HD and nasopharyngeal carcinoma (Knecht et al., 1993 ). As suggested in a previous report (Meggetto et al., 1997 ), the results of the present study further support the suggestion that two EBV stains are present in the lymph node affected by HD from patient 1, but their cellular localization (RS cells vs bystander B lymphocytes) cannot be determined from a total DNA extract.

Table 2. Substitutions and deletions in the amino acid sequence of LMP-1 identified in EBV strains infecting RS cells in lymph nodes from patients 13 and lymphoblastoid cell lines derived from patients 2 and 3

The results obtained after PCR amplification from DNA extracts from whole lymph nodes of patients 2 and 3 are more difficult to explain. In these cases, the lymph node biopsies showed EBV-positive RS cells associated with scarce (compared to patient 1) EBV-positive bystander lymphocytes. In contrast to our expectations, only single fragments were found after five PCR amplification runs on each lymph node DNA sample from these patients. One possible explanation is that RS cells and bystander B lymphocytes are infected by the same EBV strain. Alternatively, two different EBV strains were present, but only the LMP-1 gene from the EBV that infected RS cells was amplified in these cases, EBV-positive lymphocytes being too rare to allow amplification of the LMP-1 gene. To answer this last question, we took advantage of our previous findings that culture of cells isolated from lymph nodes affected by HD induced lymphoblastoidEBV cell lines originating from bystander B lymphocytes and not from RS cells (Meggetto et al., 1996 ). This led us to favour the latter hypothesis (i.e. EBV-positive lymphocytes are too rare to allow LMP-1 gene amplification), as PCR amplification of DNA extracted from lymphoblastoid cell lines obtained from EBV-positive B lymphocytes of patients 2 and 3 yielded fragments different in size and sequence from those obtained from the lymph node DNA (Fig. 1; Table 2). In addition, using PCR for immunoglobulin and Southern blot analysis of the fused terminal repeat of the episomal EBV genome, we showed that these cell lines were monoclonal (data not shown).

(47K): Fig. 1. PCR amplification of the 3' region of the LMP-1 gene of the virus present in lymph nodes of patients 2 (T2) and 3 (T3) affected by HD and in the corresponding lymphoblastoid cell lines (L2 and L3). PCR amplification of the 3' region of the LMP-1 gene from the prototype B95.8 (953 bp) was used as a positive control (lane +). Amplification from whole DNA extracted from a tumour tissue sample from patient 2 yielded a fragment (T2; 953 bp) distinct from that obtained from its corresponding lymphoblastoid cell line (L2; 986 bp). Similarly, the two PCR fragments obtained from patient 3 (T3 and L3) were distinct in size (938 and 953 bp). Lane -, negative control (EBV-negative T-cell lymphoma); φ, molecular mass markers. Arrowheads indicate the various fragments.

To determine further the identity of the EBV strain infecting RS cells, we investigated the polymorphism of the 3' region by single-cell PCR.

Single-cell PCR amplification of the LMP-1 gene in RS cells
For this purpose, 8 µm frozen sections were immunostained with monoclonal antibodies directed against the LMP-1 protein of EBV [anti-LMP-1 antibody (CS1-4); Dako] to visualize EBV-positive RS cells by the alkaline phosphatase and monoclonal anti-alkaline phosphatase (APAAP) technique (Fig. 2a) (Cordell et al., 1984 ). After overlaying the frozen section with PBS, eight single cells were picked under the microscope with a closed glass capillary using a hydraulic micromanipulator and then transferred by aspiration to an open glass capillary with another micromanipulator (Fig. 2b, c) (Gravel et al., 1998 ). DNA was extracted from each isolated cell as described in Methods and used for PCR amplification.

(150K): Fig. 2. Isolation of a single RS cell from a frozen section of a lymph node affected by HD and immunostained with anti-LMP-1 antibody (CS1-4). (a) Tissue section before picking of a single cell, showing closed glass capillary close to an LMP-1-positive RS cell. Note the lack of staining of surrounding small lymphocytes. (b) Tissue section after micromanipulation of the nucleus of the RS cell (APAAP technique with nuclear counterstaining). Magnification, x400. (c) The nucleus of the RS cell is transferred by aspiration to an open glass capillary.

PCR amplification of the 3'-segment of the LMP-1 gene from eight isolated RS cells of patient 1 yielded one fragment (Fig. 3). The fragments obtained from each RS cell showed the same size and sequence as the Tb fragment obtained from the whole lymph node DNA (30 bp deletion, five repeats of the 33 bp motif and the same mutations at positions 229, 309, 334, 366 and 382; Table 2). As it is now clearly established that a monoclonal EBV genome is localized specifically in the tumour cells of HD (Anagnostopoulos et al., 1989 ; Weiss et al., 1989 ), our results confirmed that RS cells and bystander B lymphocytes in the lymph node from patient 1 were infected by different virus strains, corresponding to fragments Tb and Ta (Fig. 3).

(53K): Fig. 3. Single-cell PCR analysis of the 3' region of LMP-1 of the EBV strain infecting RS cells. For each patient, eight single cells were picked but PCR results are shown for only three single cells. Total DNA extracted from the lymph node of patient 1 yielded two PCR products (Ta and Tb), which were cloned into pGEM-T. Note that the PCR products from DNA of each single RS cell from this patient (lanes 13) are the same size as the Tb band (998 bp), indicating that these PCR products are related to amplification of LMP-1 from the EBV strain infecting RS cells, whereas Ta (863 bp) is related to bystander B lymphocytes. PCR amplification from total DNA extracted from the lymph nodes of patient 2 and 3 (lanes T) yielded only single bands (953 and 938 bp, respectively). These fragments correspond to the LMP-1 gene of the EBV strain infecting RS cells, as demonstrated by amplification from DNA of single RS cells (lanes 13). EBV-positive bystander lymphocytes were extremely scarce in these cases and thus not detected by PCR from total DNA extracted from the lymph node. Lane +, LMP-1 of B95.8 used as a positive control (953 bp PCR product); -, negative control (EBV-negative T cell lymphoma); φ, molecular mass markers. Arrowheads indicate the positions of fragments.

Single-cell PCR of the 3'-fragment of the LMP-1 gene from the eight individual RS cells of the lymph node from patient 2 generated the same fragment (regarding size and sequence) as that obtained after PCR amplification of total DNA extracts (Fig. 3; Table 2). Of note, this fragment was different from that obtained from the corresponding lymphoblastoid cell line, L2. Comparable results were observed for patient 3. As discussed previously, in the latter two cases, the LMP-1 gene was amplified from total DNA only from EBV infecting RS cells, EBV-positive lymphocytes being too rare to allow amplification of the LMP-1 gene.

In most cases of EBV-associated HD, EBV-positive RS cells and rare, EBV-positive bystander B lymphocytes co-exist in the same lymph node (Hummel et al., 1992 ; Brousset at al, 1993 ). In our previous study, based on two cases of EBV-associated HD, we amplified two fragments with a different LMP-1 polymorphism (Meggetto et al., 1997 ). We showed a dual EBV infection in lymph nodes affected by HD, but we could not completely exclude the possibility that subsets of tumour cells and small lymphocytes shared the same virus strain. Using single-cell PCR and sequence analysis of the LMP-1 gene, we now strengthen the argument that RS cells and bystander B lymphocytes may be infected by different EBV isolates.

In previous reports, EBV clonality in HD was based on RFLP analysis of EBV terminal repeats (Raab-Traub, 1989 ). However, we now know that two different EBV strains may have the same number of terminal repeats (Sato et al., 1990 ). On the basis of the LMP-1 sequence, the results of the present study further confirm that, in RS cells, the EBV genome is clonal. Our findings are in keeping with those reported by other groups, which demonstrated by single-cell PCR that RS cells showed clonal Ig gene rearrangement (Kuppers et al., 1998 ; Stein & Hummel, 1999 ).

The question arises as to the origin of these two strains and whether they could be derived from a unique strain by accumulation of mutations and recombination events. Co-infection with multiple EBV genotypes is commonly found in human immunodeficiency virus-positive patients (Berger et al., 1999 ; Sixbey et al., 1989 ), but the identification of multiple virus isolates has not been documented in lymphocytes from non-immunocompromised patients. Our preliminary results suggest that EBV strains infecting RS and bystander lymphocytes are phylogenetically related but different from those found in reactive lymph nodes from patients with non-neoplastic lymphoproliferative disorders (unpublished data).

Whatever the origin of the EBV strains infecting RS cells, it is possible to speculate that LMP-1 sequence variations may alter the oncogenic properties and/or the immunogenicity of the LMP-1 protein.

This work was supported by the Association pour la Recherche sur le Cancer (ARC contract no. 9312).