Abstract
The peopling of Europe by modern humans was a complex process that began about 40000 years ago (Bischoff et al., 1989 ). The first modern inhabitants in France and Spain were the Cro-Magnons, characterized by the Aurignacian and the later Magdalenian cultural complexes (Gamble, 1986 ; Cruz Fernandez Castro, 1995 ). However, the earliest peopling of Europe by Ancients (the migration termed Out of Africa 1), may have begun 1·7 million years ago based on dating of the skulls of Homo ergaster found at Dmanisi in Georgia (Gabunia et al., 2000 ). The Neanderthals followed these first human inhabitants at an uncertain date, perhaps as early as 200000250000 years ago (Tattersall & Schwartz, 1999 ). The Neanderthals overlapped with the first Moderns (Out of Africa 2), but whether they contributed genetically to the Moderns is a continuing controversy (Tattersall & Schwartz, 1999 ; Duarte et al., 1999 ). Beginning about 10000 years ago, the history of Europe was dominated by the Neolithic Revolution, a demic diffusion of agriculturalists from the east (Richards et al., 1996 ). This advancing wave of farmers transmitted not only agricultural techniques, but likely their proto-IndoEuropean language as well (Renfrew, 1987 ; Cavalli-Sforza, 2000 ).
JCV is widely distributed in human populations around the world as a persistent kidney infection, likely following primary viraemia with concomitant infection of peripheral blood lymphocytes and bone marrow (Gallia et al., 1997 ). In immunosuppressed individuals JCV can cause progressive multifocal leukoencephalopathy, a demyelinating disease that occurs in about 5% of AIDS patients. Strains from JCV-infected brain are characterized by unique and extensive rearrangements in the archetypal regulatory region (Yogo et al., 1990 ; Agostini et al., 1997b ). In vitro studies have shown that human immunodeficiency virus type 1 (HIV-1) and cytomegalovirus (CMV) can transactivate JCV replication (Chowdhury et al., 1992 ; Heilbronn et al., 1993 ), which makes JCV an interesting candidate for ophthalmo-virological studies of HIV-associated retinopathy and CMV retinopathy.
Sequencing of the JCV genome indicates at least seven major genotypes and numerous subtypes (Jobes et al., 1998 ). The major JCV genotypes are associated with populations in the large continental landmasses and these geographical associations have proved valuable in tracing major early human migrations, including the peopling of the Americas (Agostini et al., 1997c ; Chima et al., 2000 ), Asia (Guo et al., 1998 ; Chang et al., 1999 ), Africa (Agostini et al., 1995 ; Guo et al., 1996 ; Chima et al., 1998 ) and the Pacific (Sugimoto et al., 1997 ; Ryschkewitsch et al., 2000 ). Type 1 is found in Europeans, Types 2 and 7 in Asians, and Types 3 and 6 in Africans (Guo et al., 1996 ; Agostini et al., 1997a ; Chima et al., 1998 ). Two or more major subtypes of Type 1, Type 2 and Type 3 have also been identified. These genotypes and subtypes have been defined in three ways: first, in a 610 bp region spanning the 3' ends of the VP1 and T-antigen genes (Ault & Stoner, 1992 ; Guo et al., 1996 ); secondly, in a 215 bp region of the 5' end of the VP1 gene (Agostini et al., 1997c ); and finally, based on the sequence of the entire coding region of the genome (4854 bp) including untranslated regions except the archetypal regulatory region to the late side of ori (Agostini et al., 1997a ; Jobes et al., 1998 ). Distinctive point mutations (Yogo et al., 1990 ; Agostini et al., 1995 ) or deletions (Chang et al., 1996 ) in the regulatory region also provide useful information to supplement coding region typing.
In Africa today, Type 6 is found in West and Central Africa (Guo et al., 1996 ; Chima et al., 1998 ), but not in East Africa (Agostini et al., 1995 , 1997a ), apparently having been displaced westward by a population expansion carrying JCV Type 3. The major genotypes in Asia are Type 2 and Type 7. Type 2A predominates in Northeast Asia, while Type 7 is the major genotype in South China and Southeast Asia (Sugimoto et al., 1997 ; Jobes et al., 1998 ; Guo et al., 1998 ). The inhabitants of the New World carry genotypes characteristic of their origins on other continents. African Americans carry Type 3, and less commonly, Type 6, in addition to types probably introduced by intermarriage with Europeans (Chima et al., 2000 ). European-Americans carry Type 1 and Native Americans carry Type 2A characteristic of their Northeast Asian origins (Agostini et al., 1997c ).
In the United States strains designated as Type 4 were identified in the VP1 typing region, and the whole genome of Type 4 strains was found to be most closely related to Type 1 strains from which they differ by about 1% of their DNA sequence (Agostini et al., 1998a ). Type 4 strains made up 16% of strains among European Americans in the USA (Agostini et al., 1996b ) and 32% of African Americans in an urban population (Chima et al., 2000 ). These Type 4 strains were initially found to be absent from a European cohort consisting of Hungarian multiple sclerosis patients and controls (Stoner et al., 1998 ), and were considered as a possible recombinant of New World origin (Agostini et al., 1996a , b ). Alternatively, they might have had a source in an Old World population not identified at that time.
Type 5, of which a single example is known, appears to combine Type 6 sequence in the typing region of the VP1 gene with Type 2B in the early region (Hatwell & Sharp, 2000 ). Thus, Type 5 is a candidate for the only naturally occurring recombinant JCV strain identified to date.
Gypsies of Europe include the Sinti and the Roma in Germany, Hungary, Romania and elsewhere in Eastern and Western Europe. In Spain the Gypsies are known as Gitanos. There are also additional Gypsy families in Armenia, Syria and elsewhere in Eurasia (Fraser, 1995 ). The history of all these groups is thought to involve migrations from Northwest India in the 10th century, and after several hundred years in Persia, exodus to the Balkans at the beginning of the 14th century, with spread westward into Europe beginning in the 15th century. At that stage historically reliable accounts report their progress across Europe. The name Gypsy derives from the popular belief, which they themselves promulgated, that these travelling bands in Europe had originated in Egypt. Eventually, these wanderers reached the British Isles and Scandinavia, and many emigrated to the USA between 1880 and 1914.
Our knowledge about JCV genotype distribution in Europe is based on small studies of European-Americans of the USA (Agostini et al., 1996b ), a study in Hungary (Stoner et al., 1998 ), and on studies in the UK, Italy, Sweden and Spain, that did not differentiate Type 4 from Type 1 or its subtypes (Guo et al., 1996 ; Bofill-Mas et al., 2000 ). We therefore wished to further examine the distribution of JCV genotypes in Europe and investigated urinary excretion of JCV DNA in 350 individuals from two groups in Germany, one group in Poland, two groups in Hungary and four groups in Spain. The Hungarian cohort of 60 individuals has been described previously (Stoner et al., 1998 ). Here, we have added a cohort of Hungarian Gypsies obtained from Jan Ferenc Hospital in Budapest, as well as Sinti in Germany, along with Gitanos and Basques in Spain.
Study subjects.The 350 test subjects were adults or adolescents of both sexes. There were 191 females and 159 males within an age range of 13 to 95. All but four were over the age of 18. The demographic characteristics of the study groups are given in Table 1.
Table 1. Demographic characterization of the European cohorts
Poland.
The 56 patients were either hospitalized in the medical wards of the Szpital Praski or were outpatients in the Second Department of the University Eye Hospital in Warsaw. Twenty of these patients suffered from diabetes mellitus.
Hungary.
Specimens were obtained from Hungarian Roma patients hospitalized with a variety of neurological diagnoses (ten stroke, three vertigo, two multiple sclerosis, one myasthenia gravis, one epilepsy, one headache and one back pain). The Hungarian control samples, which included paired individuals with and without multiple sclerosis, were previously published (Stoner et al., 1998 ).
Germany.
Urine samples were collected from patients and staff of the University Eye Hospital in Freiburg. Patients were hospitalized for surgical treatment of cataract, retinal detachment, macular degeneration, proliferative retinopathy or neoplastic disease. Sixteen patients suffered from diabetes mellitus. The German Sintis were visiting the office of a General Practitioner in Freiburg.
Spain.
Urine samples were obtained from individuals with Basque or Spanish surnames in the city of San Sebastián, Gipuzkoa Province in the Basque autonomous region. Samples from Badalona on the Mediterranean coast near Barcelona were obtained from individuals who were self-identified as Gypsies (known in Spain as Gitanos) and, as a control group, individuals from the same area who were Spanish speakers with Spanish surnames.
DNA extraction.
Urine specimens were stored at 4 °C or frozen at -20 °C, and then shipped to NIH or the University Eye Hospital of Freiburg for processing. Urine (1050 ml) was centrifuged at 4300 r.p.m. for 10 min. The cell pellet was resuspended in 1030 ml PBS, re-centrifuged and the supernatant discarded. Viral DNA was then extracted from the pellet using the Qiagen QIAamp Viral RNA/DNA Kit and the recommended protocol. Alternatively, DNA was extracted using Proteinase K as described previously (Agostini et al., 1996b ). It should be noted that handling specimens without freezing minimizes the shearing of DNA and increases the likelihood that the complete JCV genome can be amplified from the extracted DNA for whole genome sequencing (see method below).
PCR.
For detection of JCV-positive specimens and virus genotyping a 215 bp fragment was amplified from the VP1 major capsid protein gene using primers previously described (Agostini et al., 1997c ): JLP-15, nucleotides 17101734, 5' ACAGTGTGGCCAGAATTCACTACC 3' and JLP-16, nucleotides 19241902, 5' TAAAGCCTCCCCCCCAACAGAAA 3'. This fragment provides sites that identify at least seven genotypes and additional subtypes and has been validated by the analysis of 22 complete JCV genomes (Jobes et al., 1998 ). Following an initial denaturation at 95 °C for 5 min, the 50 cycle, three step PCR program included 1 min for denaturation at 95 °C, followed by 1·5 min at 63 °C for annealing and 1 min at 72 °C for elongation, with a final extension time of 10 min. Reactions were performed using PfuTurbo DNA polymerase with 3'5' exonuclease proofreading activity (Stratagene) or Ex Taq DNA polymerase (Takara Shuzo) in a standard PCR buffer containing 2·0 mM MgCl2. Alternatively, HotStart Taq polymerase (Qiagen) was used with an initial heating step for 15 min at 95 °C to activate the enzyme. The typing fragment amplified by primers JLP-15 and -16 was separated on a 2% agarose gel containing 0·5 µg/ml ethidium bromide and visualized under UV light. The band was excised, purified using a Qiagen QIAquick Gel Extraction Kit and sequenced by manual cycle sequencing. Genotypes were assigned by inspection (Fig. 1).
|
In samples positive with JLP-15 and -16 primers the viral regulatory region was amplified using primers JRR-25 and -28, which generate a 463 bp fragment encompassing the entire control region on both sides of ori that includes three typing sites to the early side of ori [JRR-25, nucleotides 49815003, 5' CATGGATTCCTCCCTATTCAGCA 3'; JRR-28, nucleotides 313291, 5' TCACAGAAGCCTTACGTGACAGC 3') (Agostini et al., 1997c )]. The 50 cycle program was run as above, but with annealing at 62 °C. PCR products were separated, purified and sequenced manually as described above.
Manual sequencing.
Amplified fragments were sequenced with the Thermo Sequenase Radiolabelled Terminator Cycle Sequencing Kit with [33P]ddNTPs (USB) with the same primers used for amplification. Products were analysed on Castaway 6% polyacrylamide gels (Stratagene), and then fixed with 5% methanol5% acetic acid. After drying in a Castaway gel dryer, the gel was exposed to Kodak BioMax MR X-ray film for 1648 h. Alternatively, we followed the procedure described earlier using the SequiTherm Excel II DNA Sequencing Kit (Biozym, Oldendorf, Germany), with a premixed 6% polyacrylamide solution containing 7 M urea (Gibco BRL) (Agostini et al., 1998b ).
Complete-genome amplification.
Complete-genome JCV DNA amplification utilized primers BAM-1 and -2 as described (Agostini & Stoner, 1995 ), ideally from urine that had not been frozen. Following JCV amplification with the proofreading enzyme rTth DNA polymerase XL (Applied Biosystems), full-length PCR products were separated on a 1% agarose gel. The band at 5·1 kb was excised and purified using a QIAquick Gel Extraction Kit.
Complete-genome cloning and DNA sequencing.
The purified PCR products were cloned using the InVitrogen TOPO-TA cloning vector as described (Jobes et al., 1999 ). Alternatively, the products of six different PCR reactions were pooled after gel extraction as described above. The entire genome was sequenced with an ABI 373A automated sequencer using dye terminator nucleotides in 30 separate reactions to obtain the entire JCV genome (5·1 kb) including the regulatory region (D. V. Jobes and others, unpublished).
Genotyping.
Genotypes were assigned in the JCV VP1 gene typing region amplified by primers JLP-15 and -16 by comparison to prototype sequences of the known genotypes by inspection (Fig. 1) (Agostini et al., 1996b , 1997c , 1999 ; Jobes et al., 1998 ). A comparable nomenclature based on phylogenetic analysis of the VT intergenic region has been presented by Y. Yogo and colleagues (Sugimoto et al., 1997 ). For a comparison of the two systems see Jobes et al. (1998) . DNA sequence numbering of the coding region is that of Frisque et al. (1984) and the archetypal control region is that of Yogo et al. (1990) .
Sequence and statistical analysis.
Sequence and phylogenetic analysis utilized Wisconsin package version 10 [Genetics Computer Group (GCG), Madison, WI, USA], run on a 16-processor Silicon Graphics Origin computer. These included the PAUPSEARCH and PAUPDISPLAY programs (Swofford, 2001 ).
For phylogenetic reconstruction a heuristic search was undertaken using the minimum evolution distance algorithm in PAUPSEARCH applied to 36 complete genome JCV sequences. These included 21 sequences described previously (Jobes et al., 1998 ) and 15 new sequences. These consisted of eight sequences described in this work and seven to be described in detail elsewhere (see Table 2). Sequences were aligned with the PILEUP program. The minimum evolution algorithm calculates a distance matrix (uncorrected) from the aligned sequences and uses the matrix values to compute the sum of the branch lengths for each tree. The optimal tree is the one with the minimum sum of branch lengths. The starting tree was obtained via neighbour-joining. Tree bisectionreconnection (TBR) branch swapping was performed. Topological constraints were not enforced. The midpoint rooting option in PAUPDISPLAY was adopted as advocated by Hatwell & Sharp (2000) . The bootstrap method (100 replicates) with a heuristic search was used to assign confidence levels to groupings in the minimum evolution tree. The bootstrap program created a 50% majority-rule consensus tree whose confidence values were mapped onto the optimal minimum evolution tree (Fig. 2).
Table 2. JCV strain origins
Table 2 for strain details.
Statistical parameters were evaluated with the Sigmastat statistical software, version 2.0 (Jandel Corp., San Rafael, CA, USA).
Reference sequences
For the GenBank reference numbers for strains used in construction of the phylogenetic trees see Table 2.
The number of positives for JCV excretion and the genotypes identified are shown in Table 3. In total, 155 strains were identified in 153 individuals from the 350 tested with an overall excretion rate for JCV DNA of 44%. The percentage positive in each cohort ranged from 31% in the German control group to 84% in the samples obtained in Hungarian Roma from Budapest. In the German control group a 70-year-old woman excreted JCV Types 1A/2B and a 43-year-old woman JCV Types 1B and 2B. This phenomenon was described previously and interpreted as double infection with two different genotypes (Agostini et al., 1996a ).
Table 3. JCV excretion and genotype distribution
Distribution of JCV Type 1 and its subtypes and Type 4
Representative European cohorts examined in Poland, Hungary, Germany and Spain excreted predominantly JCV Type 1 (Table 3). The relative proportion of the JCV Type 1 subtypes changes from East to Southwest Europe (Table 3). Type 1A was the dominant subtype of Type 1 in the Polish and Hungarian groups but was not excreted by the Basques or the Spanish control groups in which only Type 1B was found, along with Type 4 strains not present in the Hungarian controls. The subtype difference for Type 1 strains in the cohorts located furthest east (Poland and Hungary) and the most western (Spanish controls in San Sebastián and Badalona) is statistically highly significant (Chi-Square test, P<0·001). In the German control group Types 1A and 1B were about equally distributed, consistent with its intermediate geographical location.
In contrast to the predominance of Type 1A (East) or Type 1B (Southwest) in majority cohorts, the predominant JCV genotype present among Basques was Type 4, while a closely related variant of Type 4 was the strain most frequently found among Spanish Gypsies. Compared to the Spanish control groups, this difference in the distribution of JCV Type 1 and Type 4 was statistically significant in both the Basques and the Gitanos (Table 3). However, the Basques and Gypsies in Spain did not differ significantly from each other in that each displayed a majority of Type 4 strains. With two Type 4 strains out of six (33%) in the group of German Sintis and two Type 4 strains out of 16 (12·5%) in the group of Hungarian Roma, there was a tendency toward increased Type 4 excretion compared to the local control population, although these differences in Hungary and Germany did not reach statistical significance. This suggests that the Hungarian Roma in Budapest and the Sinti in Freiburg may have had more genetic admixture or close social contact with the majority population than did the Gitanos in Badalona, thus retaining Type 4 strains at a much lower level.
JCV regulatory region
The JCV regulatory region could be amplified by PCR and sequenced from 97 of the 153 JLP-15- and -16-positive samples (63%). The genotypes defined by the JLP-15 and -16 fragment were confirmed in these samples by the typing sites to the early side of ori using primers JRR-25 and -28 (Type 1 and 4, 5017-A, 5026 -C, 5039-C; Type 2, 5017-T, 5026 -T, 5039-G). Primers JRR-25 and -28 could not amplify the single Type 3A strain found in the Gitano group.
Ninety-one of the sequences (94%) had an archetypal JCV regulatory region with none of the deletions and duplications typical for isolates of PML strains. Four of the rearranged regulatory regions had deletions of from 2 to 13 bp; two sequences showed duplication of 12 and 13 bp, respectively. For details, see Table 4 in which the nucleotide numbering is based on the archetype sequence of Japanese strain CY (Yogo et al., 1990 ). As described previously (Agostini et al., 1997b ), bracketed nucleotide numbers indicate consecutive fragments after rearrangement of the primary sequence. Nucleotides denoted alphabetically rather than by number could be located on either side of the deleted segment. None of these minor rearrangements involved those parts of the viral regulatory region right of ori that were never deleted in isolates from PML brains (Agostini et al., 1997b , 1998c ). The parts always retained are [151][61,62][7285][256...] of the archetypal sequence.
Table 4. Regulatory rearrangements in urinary JCV strains
At position 217-A all strains differed from the Japanese isolate CY (217-G). This nucleotide change seems to be a common feature of European strains and was also found in European Americans (Agostini et al., 1996b ). In addition, all Type 4 strains from Gitanos had a 56-G found neither in the Spanish control cohort nor in European Roma or Sinti. Only a single Type 1B strain from Germany showed this nucleotide change. Other variable sites were: 83-C to G (found in three Type 1B strains from Germany), 108-G to A (in nine Type 1A strains, Germany/Poland; two Type 4 strains, Spain), 109-A to T (in one Type 1B strain, Germany), 170-C to T (in one Type 1A strain, Germany), 184-A to C (in one Type 1B strain, Germany), 192-T to C with 194-C to G (in one Type 4 strain, Basque) and 211-C to T with 212-A to T and 213-G to C (in one Type 4 strain, Basque).
JCV genotypes in Basques, Sinti, Roma and Gitanos
The genotypes in the Spanish samples and in the Hungarian Gypsies largely conformed to the genotypes previously described (Fig. 1). However, all the Type 4 strains in the Gitanos had 1870-T in the VP1 gene, and all but one of them had 1849-T in addition to the regulatory region change at position 56 (see above). We have given these distinctive Type 4 variant strains the name Rom-1. The two Type 4 strains found in Sintis had the usual 1870-C and 1849-A, but showed a unique 1851-G not found in other Type 4 strains from Germany. While a German and a Polish Type 4 strain showed variants at both 1850-G and 1870-G, three Basque strains had one or the other of these mutations, but not both (Fig. 1).
Phylogenetic analysis
The origins and strain designations of 36 JCV complete genome sequences are given in Table 2. For phylogenetic reconstruction the rearranging regulatory region to the late side of ori was excluded, leaving the coding regions with introns and intergenic regions (∼4854 bp). Results obtained with the minimum evolution method are shown in Fig. 2. The two Gitano and three Basque Type 4 strains are closely related to the previously sequenced Type 4 strain (#402) from the USA (Agostini et al., 1998a ). The Gitano strains (#406 and 407) were more closely related to each other than to the Basque strains (#403, 404 and 405). A German strain (#408) from a 69-year-old German was most closely related to one of the Basque strains (#404).
Also included in the phylogenetic analysis are strains from Guam (Type 2E: #234E) and from Kerala in South India (Type 2D: #231D and #232D), all of which fall within the broad Asian group of strains (Type 2/Type 7 clade). Additional strains from a South Indian hill tribe (#704, #705 and #706) fall into the Type 7 group. The Type 3 clade, predominant in East Africa, is more closely related to the Asian clades (Type 2 and Type 7) than it is to the Type 6 strain (#601) representative of those found in West and Central Africa (Guo et al., 1996 ; Chima et al., 1998 ). However, the significance of this apparent Asian/African link for human dispersal remains to be established.
The most common JCV genotypes in East, Central and Southwest Europe are Type 1 and Type 4, but populations differ with respect to the genotypes and subtypes excreted in their urine. Type 1 appears in two subtypes, Type 1A and 1B. Type 1A is the predominant JCV genotype in East Europe (Poland and Hungary) whereas Type 1B is more frequent in Spain in the Southwest. Type 4, as well as Type 1B, had distinctive variants as defined in the VP1 typing region and the regulatory region. Two Type 4 variants were found in both Germany and Poland, and another among Gitanos (Rom-1).Hungarians, whose language is in the FinnoUgric branch of the Uralic family, show the same major genotype as non-FinnoUgric speakers of Central Europe, although possibly with a lower representation of Type 4. The Altaic family of languages that includes Turkish and Mongolian, as well as Japanese, is known to show Type 2 genotypes in Mongolia (Guo et al., 1998 ) and in Japan (Sugimoto et al., 1997 ). The boundary region in Eastern Europe or Western Asia where the predominance of the Type 1/Type 4 clade switches over to Type 2 remains to be identified.
The divergence in genotype DNA sequences occurring during JCV evolution (13% difference) has not yet been dated in a way that could calibrate a reliable molecular clock. The significance of the Type 1/Type 4 division within the European group is not yet clear, but Type 4 may characterize an early European population, probably one pushed to the periphery of Europe at various places with pockets remaining in the interior. In this scenario, the Basques (majority Type 4) may descend more directly from an early modern Iberian population, while the Gitanos may have migrated from one of the peripheral European populations in the East. Closely related but variant strains such as the Rom-1 variants are not unexpected in descendants of insular bands perennially rejecting assimilation. If JCV Type 4 strains represent a viral-epidemiological trace of an early modern European population, the dominant Type 1 strains in Central Europe may reflect the genetic contribution of later agriculturalists coming from the Middle East. The migrations which may have led to the more recent differentiation of Type 1A (North and Central Europe) and Type 1B (Southwest Europe), remain obscure. While it is now clear that Type 4 strains originally found in the USA originated in Europe, rather than appearing recently in the New World as originally proposed (Agostini et al., 1996b ), the major source of the Type 4 strains in the USA is still uncertain.
The JCV evidence indicates that Gitanos, Roma and Sinti are not of Asian stock despite their presumed origins in Northwest India. Both the Basque and Gitano strains fall unequivocally into the European group of strains (the Type 1/Type 4 clade) (Figs 1 and 2). Neither the Gitanos in Spain, the Hungarian Roma nor the Basques in our study carried the Type 2A or Type 7 strains characteristic of Asia, except for a single Type 2A strain in the Basque cohort. It might be argued that the Gitanos in Spain and the Roma and Sinti in Central and East Europe have simply acquired the strains most frequently present in their neighbours. While this may be true in Hungary and Germany, it appears not to be true in Spain where they have a much higher proportion of Type 4 strains than does the control group, and their Type 4 strains represent a distinctive variant not seen in the Spanish population.
The regulatory region rearrangements found in these European strains support earlier findings that European-American urinary strains have a predominantly archetypal configuration of the regulatory region to the late side of ori (Agostini et al., 1998c ), as do those in Asia (Yogo et al., 1990 ). The minor deletion and duplications were all unique within the populations tested. This further supports the hypothesis that the infectious form of JCV has an archetypal configuration of its control region with rearrangements occurring after the primary infection (Yogo et al., 1991 ). In this study of urinary JCV strains we found no indication for stable rearranged JCV strains circulating locally in a population (Elsner & Dörries, 1998 ), but additional studies are required. The portion of the JCV regulatory region that was duplicated in strain Pol-13 (Table 4) is a preferred site for duplications (Agostini et al., 1997b ). It is located close to the third NF-1 site (204-TGG...CCA-216) but is not essential for JCV replication since it is sometimes deleted in JCV strains from PML tissue.
Phylogenetically, the worldwide distribution of JCV genotypes mirrors the migrations and genetics of the human family (Sugimoto et al., 1997 ; Agostini et al., 1997c ). There are distinctive viral genotypes found in Africa, Europe and Asia. Another migration carried Type 2-related strains to Papua New Guinea and Oceania as indicated by new variants found there (Jobes et al., 1999 ; Ryschkewitsch et al., 2000 ). A similar picture emerges from traditional biochemical genetics of protein polymorphisms (Cavalli-Sforza et al., 1994 ). Recently, the genetics of a non-recombining region of chromosome 21 has provided support for the concept of prehistoric human migrations to Asia, Europe, Oceania and the Americas (Jin et al., 1999 ). Viral genetics may contribute its own unique signature to human dispersals, whether attributable to Out of Africa 1, Out of Africa 2, the Neolithic Revolution, or migrations attested by historical references.
This work was supported in part by a grant from the University of Freiburg, Germany. The excellent technical assistance of Mrs A. Mattes and Mrs B. Flügel is gratefully acknowledged. We thank Dr Andrés Marco and Mercé Serra who helped to locate and obtain samples from the Gypsy population in Barcelona and Dr Samuel Komoly for obtaining urine samples from Budapest.Footnotes
b Present address: Applied Biosystems, 850 Lincoln Centre Drive, Foster City, CA 94404, USA.References
Agostini, H. T., Brubaker, G. R., Shao, J., Levin, A., Ryschkewitsch, C. F., Blattner, W. A. & Stoner, G. L. (1995). BK virus and a new type of JC virus excreted by HIV-1 positive patients in rural Tanzania. Archives of Virology 140, 1919-1934.[Medline]
Agostini, H. T., Ryschkewitsch, C. F., Singer, E. J. & Stoner, G. L. (1996a). Co-infection with two JC virus genotypes in brain, cerebrospinal fluid or urinary tract detected by direct cycle sequencing of PCR products. Journal of Neurovirology 2, 259-267.[Medline]
Agostini, H. T., Ryschkewitsch, C. F. & Stoner, G. L. (1996b). Genotype profile of human polyomavirus JC excreted in urine of immunocompetent individuals. Journal of Clinical Microbiology 34, 159-164.
Agostini, H. T., Ryschkewitsch, C. F., Brubaker, G. R., Shao, J. & Stoner, G. L. (1997a). Five complete genomes of JC virus Type 3 from Africans and African Americans. Archives of Virology 142, 637-655.[Medline]
Agostini, H. T., Ryschkewitsch, C. F., Singer, E. J. & Stoner, G. L. (1997b). JC virus regulatory region rearrangements and genotypes in progressive multifocal leukoencephalopathy: two independent aspects of virus variation. Journal of General Virology 78, 659-664.[Abstract]
Agostini, H. T., Yanagihara, R., Davis, V., Ryschkewitsch, C. F. & Stoner, G. L. (1997c). Asian genotypes of JC virus in Native Americans and in a Pacific Island population: markers of viral evolution and human migration. Proceedings of the National Academy of Sciences, USA 94, 14542-14546.
Agostini, H. T., Ryschkewitsch, C. F., Singer, E. J. & Stoner, G. L. (1998a). JC virus Type 1 has multiple subtypes: three new complete genomes. Journal of General Virology 79, 801-805.[Abstract]
Agostini, H. T., Ryschkewitsch, C. F. & Stoner, G. L. (1998b). Complete genome of a JC virus genotype Type 6 from the brain of an African American with progressive multifocal leukoencephalopathy. Journal of Human Virology 1, 267-272.[Medline]
Agostini, H. T., Ryschkewitsch, C. F. & Stoner, G. L. (1998c). Rearrangements of archetypal regulatory regions in JC virus genomes from urine. Research in Virology 149, 163-170.[Medline]
Agostini, H. T., Jobes, D. V., Chima, S. C., Ryschkewitsch, C. F. & Stoner, G. L. (1999). Natural and pathogenic variation in the JC virus genome. In Recent Research in Developmental Virology , pp. 683-701. Edited by S. G. Pandalai. Trivandrum, India: Transworld Research Network.
Ault, G. S. & Stoner, G. L. (1992). Two major types of JC virus defined in progressive multifocal leukoencephalopathy brain by early and late coding region DNA sequences. Journal of General Virology 73, 2669-2678.
Bischoff, J. L., Soler, N., Maroto, J. & Julia, R. (1989). Abrupt Mousterian/Aurignacian boundary at c. 40 ka bp: accelerator 14C dates from LArbreda cave (Catalunya, Spain). Journal of Archaeological Science 16, 563-576.
Bofill-Mas, S., Pina, S. & Girones, R. (2000). Documenting the epidemiologic patterns of polyomaviruses in human populations by studying their presence in urban sewage. Applied and Environmental Microbiology 66, 238-245.
Cavalli-Sforza, L. L. (2000). Genes, Peoples, and Languages. New York: North Point Press.
Cavalli-Sforza, L. L., Menozzi, P. & Piazza, A. (1994). The History and Geography of Human Genes. Princeton, NJ: Princeton University Press.
Chang, D. C., Wang, M. L., Ou, W. C., Lee, M. S., Ho, H. N. & Tsai, R. T. (1996). Genotypes of human polyomaviruses in urine samples of pregnant women in Taiwan. Journal of Medical Virology 48, 95-101.[Medline]
Chang, D., Sugimoto, C., Wang, M., Tsai, R. T. & Yogo, Y. (1999). JC virus genotypes in a Taiwan aboriginal tribe (Bunun): implications for its population history. Archives of Virology 144, 1081-1090.[Medline]
Chima, S. C., Ryschkewitsch, C. F. & Stoner, G. L. (1998). Molecular epidemiology of human polyomavirus JC in the Biaka pygmies and Bantu of Central Africa. Memorias do Instituto Oswaldo Cruz Rio de Janeiro 93, 615-623.
Chima, S. C., Ryschkewitsch, C. F., Fan, K. J. & Stoner, G. L. (2000). Polyomavirus JC genotypes in an urban United States population reflect the history of African origin and genetic admixture in modern African Americans. Human Biology 72, 837-850.[Medline]
Chowdhury, M., Taylor, J. P., Chang, C.-F., Rappaport, J. & Khalili, K. (1992). Evidence that a sequence similar to TAR is important for induction of the JC virus late promoter by human immunodeficiency virus type 1 Tat. Journal of Virology 66, 7355-7361.
Cruz Fernandez Castro, M. (1995). A History of Spain: Iberia in Prehistory. Oxford: Blackwell.
Duarte, C., Mauricio, J., Pettitt, P. B., Suoto, P., Trinkaus, E., van der Plicht, H. & Zilhao, J. (1999). The early Upper Paleolithic human skeleton from the Abrigo do Lagar Velho (Portugal) and modern human emergence in Iberia. Proceedings of the National Academy of Sciences, USA 96, 7604-7609.
Elsner, C. & Dörries, K. (1998). Human polyomavirus JC control region variants in persistently infected CNS and kidney tissue. Journal of General Virology 79, 789-799.[Abstract]
Fraser, A. (1995). The Gypsies. Oxford: Blackwell.
Frisque, R. J., Bream, G. L. & Cannella, M. T. (1984). Human polyomavirus JC virus genome. Journal of Virology 51, 458-469.
Gabunia, L., Vekua, A., Lordkipanidze, D., Swisher, C. C.III, Ferring, R., Justus, A., Nioradze, M., Tvalchrelidze, M., Antón, S. C., Bosinski, G., Jöris, O., De Lumley, M. A., Majsuradze, G. & Mouskhelishvili, A. (2000). Earliest Pleistocene hominid cranial remains from Dmanisi, Republic of Georgia: taxonomy, geological setting, and age. Science 288, 1019-1025.
Gallia, G. L., Houff, S. A., Major, E. O. & Khalili, K. (1997). JC virus infection of lymphocytes revisited. Journal of Infectious Diseases 176, 1603-1609.[Medline]
Gamble, C. (1986). The Palaeolithic Settlement of Europe. Cambridge: Cambridge University Press.
Guo, J., Kitamura, T., Ebihara, H., Sugimoto, C., Kunitake, T., Takehisa, J., Na, Y. Q., Al-Ahdal, M. N., Hallin, A., Kawabe, K., Taguchi, F. & Yogo, Y. (1996). Geographical distribution of the human polyomavirus JC virus type A and B and isolation of a new type from Ghana. Journal of General Virology 77, 919-927.
Guo, J., Sugimoto, C., Kitamura, T., Ebihara, H., Kato, A., Guo, Z., Liu, J., Zheng, S. P., Wang, Y. L., Na, Y. Q., Suzuki, M., Taguchi, F. & Yogo, Y. (1998). Four geographically distinct genotypes of JC virus are prevalent in China and Mongolia: implications for the racial composition of modern China. Journal of General Virology 79, 2499-2505.[Abstract]
Hatwell, J. N. & Sharp, P. M. (2000). Evolution of human polyomavirus JC. Journal of General Virology 81, 1191-1200.
Heilbronn, R., Albrecht, I., Stephan, S., Bürkle, A. & zur Hausen, H. (1993). Human cytomegalovirus induces JC virus DNA replication in human fibroblasts. Proceedings of the National Academy of Sciences, USA 90, 11406-11410.
Jin, L., Underhill, P. A., Doctor, V., Davis, R. W., Shen, P. D., Cavalli-Sforza, L. L. & Oefner, P. J. (1999). Distribution of haplotypes from a chromosome 21 region distinguishes multiple prehistoric human migrations. Proceedings of the National Academy of Sciences, USA 96, 3796-3800.
Jobes, D. V., Chima, S. C., Ryschkewitsch, C. F. & Stoner, G. L. (1998). Phylogenetic analysis of 22 complete genomes of the human polyomavirus JC virus. Journal of General Virology 79, 2491-2498.[Abstract]
Jobes, D. V., Friedlaender, J. S., Mgone, C. S., Koki, G., Alpers, M. P., Ryschkewitsch, C. F. & Stoner, G. L. (1999). A novel JC virus variant found in the Highlands of Papua New Guinea has a 21-base pair deletion in the agnoprotein gene. Journal of Human Virology 2, 350-358.[Medline]
Loeber, G. & Dörries, K. (1988). DNA rearrangements in organ-specific variants of polyomavirus JC strain GS. Journal of Virology 62, 1730-1735.
Ou, W.-C., Tsai, R.-T., Wang, M., Fung, C.-Y., Hseu, T.-H. & Chang, D. (1997). Genomic cloning and sequence analysis of Taiwan-3 human polyomavirus JC virus. Journal of the Formosan Medical Association 96, 511-516.[Medline]
Renfrew, C. (1987). Archaeology and Language: The Puzzle of Indo-European Origins. New York: Cambridge University Press.
Richards, M., Corte-Real, H., Forster, P., Macaulay, V., Wilkinson-Herbots, H., Demaine, A., Papiha, S., Hedges, R., Bandelt, H.-J. & Sykes, B. (1996). Paleolithic and Neolithic lineages in the European mitochondrial gene pool. American Journal of Human Genetics 59, 185-203.[Medline]
Ryschkewitsch, C. F., Friedlaender, J. S., Mgone, C. S., Jobes, D. V., Agostini, H. T., Chima, S. C., Alpers, M. P., Koki, G., Yanagihara, R. & Stoner, G. L. (2000). Human polyomavirus JC variants in Papua New Guinea and Guam reflect ancient population settlement and viral evolution. Microbes & Infection 2, 987-996.[Medline]
Stoner, G. L., Agostini, H. T., Ryschkewitsch, C. F. & Komoly, S. (1998). JC virus excreted by multiple sclerosis patients and paired controls from Hungary. Multiple Sclerosis 4, 45-48.
Stoner, G. L., Jobes, D. V., Fernandez Cobo, M., Agostini, H. T., Chima, S. C. & Ryschkewitsch, C. F. (2000). JC virus as a marker of human migration to the Americas. Microbes & Infection 2, 1905-1911.[Medline]
Sugimoto, C., Kitamura, T., Guo, J., Al-Ahdal, M. N., Shchelkunov, S. N., Otova, B., Ondrejka, P., Chollet, J. Y., El-Safi, S., Ettayebi, M., Grésenguet, G., Kocagöz, T., Chaiyarasamee, S., Thant, K. Z., Thein, S., Moe, K., Kobayashi, N., Taguchi, F. & Yogo, Y. (1997). Typing of urinary JC virus DNA offers a novel means of tracing human migrations. Proceedings of the National Academy of Sciences, USA 94, 9191-9196.
Swofford, D. L. (2001). PAUP 4.0 Users Manual: Phylogenetic Analysis using Parsimony. Sunderland, MA: Sinauer Associates.
Tattersall, I. & Schwartz, J. H. (1999). Hominids and hybrids: the place of Neanderthals in human evolution. Proceedings of the National Academy of Sciences, USA 96, 7117-7119.
Yogo, Y., Kitamura, T., Sugimoto, C., Ueki, T., Aso, Y., Hara, K. & Taguchi, F. (1990). Isolation of a possible archetypal JC virus DNA sequence from nonimmunocompromised individuals. Journal of Virology 64, 3139-3143.
Yogo, Y., Kitamura, T., Sugimoto, C., Hara, K., Iida, T., Taguchi, F., Tajima, A., Kawabe, K. & Aso, Y. (1991). Sequence rearrangement in JC virus DNAs molecularly cloned from immunosuppressed renal transplant patients. Journal of Virology 65, 2422-2428.
Received 26 October 2000; accepted 12 January 2001.