Research Article

Human herpesvirus-8 (Kaposi's sarcoma-associated herpesvirus) ORF50 interacts synergistically with the tat gene product in transactivating the human immunodeficiency virus type 1 LTR

Journal of General Virology 2001; 82(8):1965

PubMed

With thanks to our partners for supporting this archive.

Abstract

Human herpesvirus-8 (HHV-8) is a lymphotropic virus associated with several AIDS-related neoplasms. Two ORFs play a critical role in the regulation of virus replication: ORF50, encoding an immediate-early transcriptional activator, and ORF57, encoding a post-transcriptional regulator. We analysed their effects on the activation of the human immunodeficiency virus type 1 (HIV-1) LTR. ORF50 interacted synergically with tat, inducing a 10-fold enhancement of HIV-1 LTR transactivation. This effect occurred both in BCBL-1 cells, latently infected with HHV-8, and in HL3T1 cells, an epithelial cell line non-permissive to HHV-8 infection. Also, ORF57 enhanced tat-induced transactivation of HIV-1 LTR, but only in BCBL-1 cells, suggesting that its action was likely mediated by the induction of other viral functions. Finally, when both ORFs were expressed, the enhancement of transactivation induced by ORF50 was partially inhibited. The findings suggest that ORF57 can modulate ORF50 activity and that ORF50 may render biologically active small amounts of tat.
Kaposis sarcoma (KS) is the most frequent neoplasm affecting patients with AIDS (Biggar et al., 1996 ). Originally discovered in KS lesions (Chang et al., 1994 ), human herpesvirus-8 (HHV-8), also called KS-associated herpesvirus (KSHV), has been established as a key factor in the pathogenesis of all clinical forms of KS (reviewed by Schulz, 1998 ). Furthermore, HHV-8 is implicated as a major agent in the formation of primary effusion lymphomas (PEL) and in Castlemans disease (Cesarman et al., 1995 ; Soulier et al., 1995 ).

Epidemiological and molecular observations suggest that both human immunodeficiency virus type 1 (HIV-1) and HHV-8 can play a role in the development of KS, by interacting at different levels. HHV-8 DNA is present in the peripheral blood of KS patients, and is found mainly in CD19+ B cells and macrophages (Whitby et al., 1995 ; Monini et al., 1999 ), while in KS tumours it resides primarily in endothelial lineage-derived spindle cells (Staskus et al., 1997 ). Although HHV-8 infection of spindle cells is predominantly latent, reactivation of virus from latency and subsequent lytic replication seem to be important events in KS development (Lukac et al., 1999 ). A critical step in reactivation of HHV-8 is the expression of ORF50, an immediate-early gene whose product can strongly activate viral promoters, including ORF57, in a dose-dependent manner (Lukac et al., 1999 ). HHV-8 ORF57 acts like a pleiotropic modulator of the expression of viral genes, it enhances the accumulation of several viral transcripts, and it synergizes with ORF50 in the enhancement of ORF50-responsive promoters (Kirshner et al., 2000 ). Both genes are expressed at early stages of infection, and are present as unspliced and spliced products (Lukac et al., 1998 , 1999 ; Kirshner et al., 2000 ; Bello et al., 1999 ). Studies performed on the homologue genes of herpesvirus saimiri (HVS) suggest that the precursor mRNA and the spliced transcript of ORF50 and ORF57 mRNAs have different functions. In HVS, both forms have a transactivating potential, but the spliced mRNA has a stronger activity than the unspliced molecule (Whitehouse et al., 1998a ). The spliced gene product of ORF57 transactivates the expression of lytic genes, whereas the unspliced product down-regulates the expression of immediate-early genes with activating functions, including ORF50 (Whitehouse et al., 1998b ; Cooper et al., 1999 ).

On the other hand, HIV-1 tat increases HHV-8 viral copy number in BCBL-1 cells as well as in peripheral blood mononuclear cells (PBMCs) from KS patients (Harrington et al., 1997 ), suggesting that HIV-1 tat can reactivate latent HHV-8. In addition to its well-known role as the main transactivator of HIV-1 gene expression, tat has a pleiotropic range of actions, affecting cellular functions, cell proliferation, apoptosis, immune response, activation of heterologous viral promoters and angiogenesis. Furthermore, tat is released from HIV-1-infected cells in an extracellular form, and can be taken up by infected and uninfected cells (Caputo et al., 1999 ).

Several lines of evidence have recently suggested that HIV-1 and HHV-8 can interact in vivo: they coinfect different cell types, including B-cells and monocytes (Monini et al., 1999 ), and HIV-1 replication stimulates HHV-8 production in PELs and in PBMC from KS patients (Varthakavi et al., 1999 ; Moore et al., 2000 ). Furthermore, it has been recently shown that HIV-1 can interact with B lymphocytes, by a complement-mediated binding to CD21 receptor (Moir et al., 2000 ), and that induction of CD4 and CXCR4 on B cells by CD40 stimulation leads to an increased susceptibility of these cells to HIV infection (Moir et al., 1999 ).

With the aim of detecting potential intracellular reciprocal effects between HHV-8 and HIV-1, in the present work we investigated the possibility of a direct influence of HHV-8 upon the state of activation of HIV-1 in cells either susceptible or not to HHV-8 infection. Our attention focussed on ORF50 and ORF57, due to their key transactivating role.

The spliced forms and the portions corresponding to the second large exon of ORF50 and ORF57 were cloned in the expression vector pCR3.1-Uni (Invitrogen) (Fig. 1A). The spliced genes were obtained from TPA-activated BCBL-1 cells, a B lymphocyte line derived from PEL and latently infected with HHV-8 (Renne et al., 1996 ). Poly(A)+ RNA was isolated and retrotranscribed with the specific 3' primers 50-B (nt 7461874637; 5' CGAACACTTCAGTCTCGGAA 3') or 57-B (nt 8353383552; 5' GGCAATCCTTAAGAAAGTGG 3'). The cDNA fragments were then amplified by PCR, using primer 50-B or 57-B in combination with the respective 5' primers 50-A (nt 7159471613; 5' AAAAATGGCGCAAGATGACA 3') or 57-A (nt 8207782096; 5' AGCAATGATAGACATGGACA 3'). The amplified fragments ORF50sp (2085 bp) and ORF57sp (1357 bp) were then cloned into pCR3.1 vector, to give the recombinant plasmids pCR-50sp and pCR-57sp. The truncated (3' end) portions of ORF50 and of ORF57 were cloned into the same vector, following direct PCR amplification using primers 50-C (nt 7270872727; 5' TGGTGGAAGATGTGTGCATT 3') and 50-B for ORF50e (1929 bp), and primers 57-C (nt 8267782696; 5' TGTGTCTGACGCCGTAAAGA 3') and 57-B for ORF57e (877 bp). Each PCR fragment was checked by sequence analysis prior to cloning into the expression vector.



(45K):

Fig. 1. (a) Schematic representation of ORF50 and ORF57 based on sequence data. The shaded areas represent sequences excised by splicing. Complete lines indicate stop codons and half lines indicate start codons. Solid lines represent the sequences cloned in expression vectors. The spliced forms were cloned into plasmids pCR-50sp and pCR-57sp. The 3' ends of molecules were cloned into plasmids pCR-50e and pCR-57e. (b) Northern blot analysis of mRNA from BCBL-1 cells. BCBL-1 cells were electroporated with plasmids containing ORF50e, ORF50sp, ORF57e or ORF57sp, and harvested 4 and 48 h after transfection. Control cells were mock-transfected with pCR-3.1 empty vector or treated with 20 ng/ml TPA, and harvested as above. The samples were run in duplicate, and the blots were hybridized with ORF50 (panel A), ORF57 (B), gB (C), T1.1 (D) and β-actin (E). The blots were stripped and elimination of labelled bands was confirmed by autoradiographic exposure. Panels (A), (B) and (C) show autoradiograms after 24 h exposure, panels (D) and (E) after 3 h exposure.

To determine the influence of ORF50 and ORF57 on HHV-8 transcription, the recombinant constructs were transfected alone or in combination into BCBL-1 cells. Briefly, 107 BCBL-1 cells were suspended in 0·5 ml serum-free medium containing 10 µg of HHV-8 plasmids, and electroporated at 250 mV and 460 µF. As a positive control, TPA-induced (20 ng/ml) BCBL-1 cells were utilized. Poly(A)+ RNAs were extracted 4, 24 and 48 h after transfection (mRNA isolation system, Boehringer) and analysed by Northern blot. Blots were hybridized with probes obtained by PCR amplification, specific for early and late HHV-8 functions, namely: ORF50, ORF57, ORF8 (coding for glycoprotein B), T1.1 (a marker of lytic replication). Blots were also hybridized with a β-actin probe, to provide an mRNA loading control. The results (Fig. 1B) showed that ORF50sp induced a strong transactivation of ORF57, gB and T1.1 expression, similar to what was observed with TPA stimulation. The enhancement was evident also in the samples treated with 50e, suggesting that the second exon of the gene includes the activation domain. ORF57 induced high levels of T1.1 mRNA, and to a lesser extent of ORF50 and gB, in both spliced and truncated forms, thus acting as a viral transactivator, as recently reported (Kirshner et al., 2000 ).

To determine their influence on HIV-1 LTR activation, the constructs were transfected, alone or in combination with a pRP-tat expression vector (Grossi et al., 1988 ) into BCBL-1 cells and into HL3T1 cells, a HeLa-derived epithelial cell line stably transfected with HIV-1 LTRCAT (Wright et al., 1986 ).

BCBL-1 cells were electroporated as described above with 10 µg of pCR-50 or pCR-57 plasmids and 1 µg of a reporter HIV-1 LTRCAT plasmid (Caputo et al., 1996 ), in the presence or absence of 1 µg of pRP-tat plasmid. Cells were then harvested after 48 h and the CAT assay was performed with 100 µg of proteins per sample (Davis et al., 1986 ).

Control cells were mock-transfected with equal amounts of the pRP and/or pCR-3.1 empty vectors (respectively 1 and 10 µg), in order to have identical final quantities of transfected DNA in all samples and to rule out promoter competition effects.

The results of the CAT assays are shown in Fig. 2(a). Both cloned forms of ORF50 and ORF57 had a negligible transactivating effect on the HIV-1 LTR when transfected alone, but enhanced significantly the activation induced by tat. Therefore, the effect of ORF50 and ORF57 is likely not due to a direct activation of HIV-1 LTR, but rather to an amplification of tat action. ORF50sp showed the highest activating ability, since it increased the percentage chloramphenicol acetylation (CAT activity) from 10·3% (pRP-tat alone) to 99% (pRP-tat plus pCR-50sp), with an increase of 9·9-fold. This ability was retained by the 3' end portion of the gene (ORF50e), which induced an increase of 7·6-fold in CAT activity (78·8%), suggesting that this portion likely contains the active domain. Interestingly, the two cloned forms of ORF57 also enhanced the activation of LTR induced by tat, since they increased CAT activity to 56·9% and 54·9% (respectively for pCR-57sp and pCR-57e), with an average increase of 5·5-fold. The transactivating activity was still present in the 3' end portion of the gene (ORF57e), suggesting that it includes the active part of the molecule.



(28K):

Fig. 2. HIV-1 LTR transactivation induced by ORF50 and ORF57. Panels (a) and (b) show the results of the CAT assay in BCBL-1 and HL3T1 cells, respectively. Cells were transfected with ORF50 and ORF57 expression plasmids, in the presence or absence of Tat, and harvested after 48 h for CAT analysis. The results represent mean values of duplicate samples from three different experiments, and are expressed as percentage chloramphenicol acetylation (CAT activity). Vertical bars show standard deviation (SD). CAT assays were performed using serial dilutions of samples, in order to avoid underestimation due to exhaustion of substrate. The results shown were obtained with 100 µg of proteins for BCBL-1 cells, and 25 µg of proteins for HL3T1 cells. Further dilutions of samples confirmed the ratio of enhancement of CAT activity.

However, the presence of both forms of ORF50 and ORF57 did not result in a further increase in tat-induced LTR activation, as shown by the percentage chloramphenicol acetylation values, which were, respectively, 32·5% and 48·7% for pCR-50sp plus pCR-57sp or -57e, and 58·8% and 40% for pCR-50e plus pCR-57sp or pCR-57e. TPA stimulation showed a less pronounced effect; nevertheless it could double CAT activity in the presence of tat (18·9%).

Since BCBL-1 cells are latently infected by HHV-8, to characterize the synergism between ORF50 or -57 and tat, transfection experiments were performed in cells which do not contain HHV-8 sequences. The expression plasmids encoding ORF50 or ORF57 were cotransfected with different amounts of pRP-tat plasmid into HL3T1 cells. Briefly, 6x105 cells were transfected by the calcium phosphate method, coprecipitating 10 µg of ORFs plasmids with 0·10·51 µg of pRP-tat. After 16 h incubation, the inoculum was removed and fresh complete medium was added. The cells were harvested for CAT analysis after 48 h. TPA stimulation (20 ng/ml) was also used in these cells. As shown in Fig. 2(b), the enhancing effect of ORF50sp and ORF50e in these cells was equally evident as in BCBL-1 cells, increasing CAT activity to 9·9- and 8·6-fold, respectively, compared with that induced by 0·1 µg of pRP-tat alone. The synergic action of ORF50 was especially evident for low amounts of pRP-tat (0·1 and 0·5 µg), whereas higher doses of tat induced a saturation of HIV-1 LTR activation, which was not further influenced by the presence of ORF50 (data not shown). In contrast, both forms of ORF57 induced only a slight increase in CAT activity (respectively 21·8% and 20·8%), suggesting that the effect observed in BCBL-1 cells was likely mediated by the induction of ORF50 and/or of other HHV-8 functions, as also suggested by Northern blot results. TPA stimulation of HL3T1 cells did not induce any significant increase of LTR transactivation induced by tat, suggesting that the effect observed in BCBL-1 cells was due to a specific induction of HHV-8 functions, and not to a general activating effect of TPA. The results suggest that ORF57 can have both a transactivating action and a post-transcriptional modulating effect, similarly to what was described for ORF57 of HVS (Whitehouse et al., 1998a ), and that positive or negative regulation depends upon the levels of ORF50. In fact, ORF57 slightly increases transcription from ORF50, but the transactivation associated with ORF50 is partially inhibited. These observations strengthen the notion that, similar to EpsteinBarr virus BMLF1 (Buisson et al., 1989 ), ORF57 acts post-transcriptionally, possibly affecting pre-mRNA splicing.

Alternatively, the observed inhibition may be due to promoter competition, since both ORFs were cloned into expression vectors driven by strong promoters. The results show also that the second exon of both ORF50 and ORF57 retains the activity observed in the complete gene, suggesting that the activation domain might be contained in this region. If this hypothesis is confirmed, HHV-8 would behave differently than HVS, where different functions of ORF50 and ORF57 are regulated by splice events.

To elucidate the nature of the interaction between ORF50/57 and tat, pCR-50 and pCR-57 recombinant plasmids were transfected into Jurkat-tat cells, a Jurkat cell clone transformed by pRP-tat and stably expressing Tat (Caputo et al., 1990 ). Briefly, 107 Jurkat-tat cells were electroporated with 10 µg of HHV-8 plasmids as described above. Mock controls were transfected with 10 µg of the pCR empty vector. TPA (20 ng/ml) stimulation was also used as a control. Poly(A)+ RNA was extracted after 24 and 48 h, and analysed by Northern blot for tat and β-actin transcripts. The synergic interaction of ORF50 and tat was confirmed in this cell system, as shown in Fig. 3(b). As expected, transfection of ORF57 did not influence tat transcription (Fig. 3a), whereas a slight increase of tat mRNA was observed in TPA-stimulated cells. Interestingly, transfection of ORF50 did not affect the levels of tat mRNA, suggesting that the synergistic effect observed in Jurkat-tat cells, as well as in BCBL-1 and HL3T1 cells, was likely due to a post-transcriptional enhancing action.



(39K):

Fig. 3. Results of transfection experiments performed on Jurkat cells stably transformed with tat. (a) Northern blot analysis of mRNA from Jurkat-tat cells; cells were electroporated with plasmids containing ORF50e, ORF50sp, ORF57e or ORF57sp, and harvested after 48 h. Control cells were mock-transfected with pCR-3.1 empty vector or treated with 20 ng/ml TPA, and harvested as above. The same blot was hybridized with tat and β-actin, in this order of hybridization. Elimination of labelled bands was obtained by stripping the blot, and confirmed by autoradiographic exposure. (b) CAT analysis results in Jurkat-tat cells. Cells were electroporated with the LTRCAT construct, in the presence or absence of plasmids pCR-50sp or pCR-57sp, and harvested after 48 h for CAT assay. The results are expressed as percentage chloramphenicol acetylation (CAT activity). The results reported were obtained with 100 µg of cellular proteins.

The findings are summarized as follows: (i) ORF50 interacts synergistically with HIV-1 tat, likely by a post-transcriptional mechanism, and increases LTR transactivation; (ii) ORF57 does not interact directly with tat in transactivating the HIV-1 LTR, and the transactivation is likely mediated by the induction of ORF50 or other HHV-8 functions; (iii) when both ORF50 and ORF57 are present at high levels, transactivation of HIV-1 LTR is partially inhibited.

These results show that the two viruses can interact in a reciprocal mode of action inside coinfected cells: thus, beside the influence exerted by HIV-1 upon HHV-8 reactivation and replication (Varthakavi et al., 1999 ), a direct effect of HHV-8 upon HIV-1 is also possible. The observation that ORF50 interacts with Tat at a post-transcriptional level suggests that the effect might be mediated by other factors. ORF50 might stimulate the production of cell factors enhancing transactivation by Tat. In fact, recent observations show that specific kinases associate directly with Tat and facilitate high-affinity binding to TAR (Zhou et al., 1998 ). Moreover, phosphorylation of RNA polymerase II correlates with Tat activation of transcription (Okamoto et al., 1996 ).

In dually infected individuals HIV-1 infection might transcriptionally activate the HHV-8 genome from latency, which could in turn lead to further amplification and/or reactivation of HIV-1 transcription. The recent observation that B cells might act as a reservoir for HIV-1 (Moir et al., 1999 , 2000 ) highlights the possibility of in vivo interactions between the two viruses.

The results presented here are relevant to the elucidation of the molecular mechanisms of a possible cooperation between HHV-8 and HIV-1 in the development of KS lesions, and suggest that the presence of ORF50 may render biologically active small amounts of tat which would not have any biologically significant effect per se. This would be particularly relevant in the development of KS, or of other associated neoplasms, due to the angiogenic properties of tat, which could be amplified by the presence of activated HHV-8.

This work was supported by the Italian Ministry of Health (Istituto Superiore di Sanità, AIDS project) and by MURST. We thank Linda M. Sartor for English revision of the manuscript.

References

Bello, L. J., Davison, A. J., Glenn, M. A., Whitehouse, A., Rethmeier, N., Schulz, T. F. & Clements, J. B. (1999). The human herpesvirus-8 ORF57 gene and its properties. Journal of General Virology 80, 3207-3215.[Abstract/Free Full Text]

Biggar, R. J., Rosemberg, P. S. & Cotè, T. (1996). AIDS/cancer match study group. Kaposis sarcoma and non-Hodgkins lymphoma following the diagnosis of AIDS. International Journal of Cancer 68, 754-58.

Buisson, M., Manet, E., Trescol-Biemont, M. C., Gruffat, H., Durand, B. & Sergeant, A. (1989). The EpsteinBarr virus (EBV) early protein EB2 is a posttranscriptional activator expressed under the control of EBV transcription factors EB1 and R. Journal of Virology 63, 5276-5284.[Abstract/Free Full Text]

Caputo, A., Sodroski, J. G. & Haseltine, W. A. (1990). Constitutive expression of HIV-1 Tat protein in human Jurkat T cells using a BK virus vector. Journal of Acquired Immune Deficiency Syndromes 3, 372-379.

Caputo, A., Grossi, M. P., Bozzini, R., Rossi, C., Betti, M., Marconi, P. C., Barbanti-Brodano, G. & Balboni, P. G. (1996). Inhibition of HIV-1 replication and reactivation from latency by tat transdominant negative mutants in the cysteine rich region. Gene Therapy 3, 235-245.[Medline]

Caputo, A., Betti, M., Boarini, C., Mantovani, I., Corallini, A. & Barbanti-Brodano, G. (1999). Multiple functions of human immunodeficiency virus type 1 Tat protein in the pathogenesis of AIDS. Recent Research and Development in Virology 1, 753-771.

Cesarman, E., Chang, Y., Moore, P. S., Said, J. W. & Knowles, D. M. (1995). Kaposis sarcoma-associated herpesvirus-like DNA sequences in AIDS-related body-cavity-based lymphomas. New England Journal of Medicine 332, 1186-1191.[Abstract/Free Full Text]

Chang, Y., Cesarman, E., Pessin, M. S., Lee, F., Culpepper, J., Knowles, D. M. & Moore, P. S. (1994). Identification of herpesvirus-like DNA sequences in AIDS-associated Kaposis sarcoma. Science 266, 1865-1869.[Abstract/Free Full Text]

Cooper, M., Goodwin, D. J., Hall, K. T., Stevenson, A. J., Meredith, D. M., Alexander, F. M. & Whitehouse, A. (1999). The gene product encoded by ORF57 of herpesvirus saimiri regulates the redistribution of the splicing factor SC-35. Journal of General Virology 80, 1311-1316.[Abstract]

Davis, L. G., Dibner, M. D. & Battey, J. F. (editors) (1986). Basic Methods in Molecular Biology. New York: Elsevier Science Publishing.

Grossi, M. P., Caputo, A., Rimessi, P., Chiccoli, L., Balboni, P. G. & Barbanti-Brodano, G. (1988). New BK virus episomal vector for complementary DNA expression in human cells. Archives of Virology 102, 275-283.[Medline]

Harrington, W.Jr, Sieczkowski, L., Sosa, C., Chan-a-Sue, S., Cai, J. P., Cabral, L. & Wood, C. (1997). Activation of HHV-8 by HIV-1 Tat. Lancet 349, 774-775.[Medline]

Kirshner, J. R., Lukac, D., Chang, J. & Ganem, D. (2000). Kaposis sarcoma-associated herpesvirus open reading frame 57 encodes a posttranscriptional regulator with multiple distinct activities. Journal of Virology 74, 3586-3597.[Abstract/Free Full Text]

Lukac, D. M., Renne, R., Kirshner, J. R. & Ganem, D. (1998). Reactivation of Kaposis sarcoma associated herpesvirus from latency by expression of the ORF50 transactivator, a homolog of the EBV R protein. Virology 282, 304-312.

Lukac, D. N., Kirshner, J. R. & Ganem, D. (1999). Transcriptional activation by the product of open reading frame 50 of Kaposis sarcoma-associated herpesvirus is required for lytic viral reactivation in B cells. Journal of Virology 73, 9348-9361.[Abstract/Free Full Text]

Moir, S., Lapointe, R., Malaspina, A., Ostrowski, M., Cole, C. E., Chun, T-W., Adelsberger, J., Baseler, M., Hwu, P. & Fauci, A. S. (1999). CD40-mediated induction of CD4 and XCXCR4 on B lymphocytes correlates with restricted susceptibility to human immunodeficiency virus type 1 infection: potential role of B lymphocytes as a viral reservoir. Journal of Virology 73, 7072-7980.

Moir, S., Malaspina, A., Li, Y., Chun, T-W., Lowe, T., Adelsberger, J., Baseler, M., Ehler, L. A., Liu, S., Davey, R. T., Mican, J. A. & Fauci, A. S. (2000). B cells of HIV-1-infected patients binds virions through CD21-complement interactions and transmit infectious virus to activated T cells. Journal of Experimental Medicine 192, 637-646.[Abstract/Free Full Text]

Monini, P., Colombini, S., Sturzl, M., Goletti, D., Cafaro, A., Sgadari, C., Butto, S., Franco, M., Leone, P., Fais, S., Leone, P., Melucci-Vigo, G., Chiozzini, C., Carlini, F., Ascherl, G., Cornali, E., Zietz, C., Ramazotti, E., Ensoli, F., Andreoni, M., Pezzotti, P., Reza, G., Yarchoan, R, Gallo, R. C. & Ensoli, B. (1999). Reactivation and persistence of human herpesvirus-8 infection in B cells and monocytes by Th-1 cytokines increased in Kaposis sarcoma. Blood 93, 4044-4058.[Abstract/Free Full Text]

Moore, A. Y., Hudnale, S. D., Rady, P. L., Wagner, R. F., Moore, T. O.Jr, Memar, O., Hughes, T. K. & Tyring, S. K. (2000). Differential expression of the HHV-8 vGCR cellular homolog gene in AIDS-associated and classic Kaposis sarcoma: potential role of HIV-1 Tat. Virology 267, 247-251.[Medline]

Okamoto, H., Sheline, C. T., Corden, J. L., Jones, K. A. & Peterlin, B. M. (1996). Trans-activation by human immunodeficiency virus Tat protein requires the C-terminal domain of RNA polymerase II. Proceedings of the National Academy of Sciences, USA 93, 11575-11579.[Abstract/Free Full Text]

Renne, R., Zhong, W., Herndier, B., McGrath, M., Abbey, N., Kedes, D. & Ganem, D. (1996). Lytic growth of Kaposis sarcoma-associated herpesvirus (human herpesvirus 8) in culture. Nature Medicine 2, 342-346.[Medline]

Schulz, T. (1998). Kaposis sarcoma-associated herpesvirus (human herpesvirus-8). Journal of General Virology 79, 1573-1591.[Medline]

Soulier, J., Grollet, L., Oksenhendler, E., Cacoub, P., Cazals-Hatem, D., Babinet, P., dAgay, M. F., Clauvel, J. P., Raphael, M., Degos, L. & Sigaux, F. (1995). Kaposis sarcoma-associated herpesvirus-like DNA sequences in multicentric Castlemans disease. Blood 86, 1276-1280.[Abstract/Free Full Text]

Staskus, K. A., Zhong, W., Gebhard, K., Herndier, B., Wang, H., Renne, R., Beneke, J., Pudney, J., Anderson, D. J., Ganem, D. & Haase, A. T. (1997). Kaposis sarcoma-associated herpesvirus gene expression in endothelial (spindle) tumor cells. Journal of Virology 71, 715-719.[Abstract]

Varthakavi, V., Browning, P. J. & Spearman, P. (1999). Human immunodeficiency virus replication in a primary effusion lymphoma cell line stimulate lytic-phase replication of Kaposis sarcoma-associated herpesvirus. Journal of Virology 73, 10329-10338.[Abstract/Free Full Text]

Whitby, D., Howard, M. R., Tenant-Flowers, M., Brink, N. S., Copas, A., Boshoff, C., Hatzioannou, T., Suggett, F. E., Aldam, D. M., Denton, A. S. and others (1995). Detection of Kaposis sarcoma associated herpesvirus in peripheral blood of HIV-infected individuals and progression to Kaposis sarcoma. Lancet 346, 799802.[Medline]

Whitehouse, A., Cooper, M., Hall, K. T. & Meredith, D. M. (1998a). The open reading frame (ORF) 50a gene product regulates ORF57 gene expression in herpesvirus saimiri. Journal of Virology 72, 1967-1973.[Abstract/Free Full Text]

Whitehouse, A., Cooper, M. & Meredith, D. M. (1998b). The immediate-early gene product encoded by open reading frame 57 of herpesvirus saimiri modulates gene expression at a posttranscriptional level. Journal of Virology 72, 857-861.[Abstract/Free Full Text]

Wright, C. M., Felber, B. K., Paskalis, H. & Pavlakis, G. N. (1986). Expression and characterization of the trans-activator of HTLV-III/LAV virus. Science 234, 988-992.[Abstract/Free Full Text]

Zhou, Q., Chen, D., Pierstorff, E. & Luo, K. (1998). Transcription elongation factor P-TEFb mediates Tat activation of HIV-1 transcription at multiple stages. EMBO Journal 17, 3681-3691.[Medline]

Received 23 February 2001; accepted 8 May 2001.