Abstract
The virus isolate used in this study was the same as in previous investigations (Boulila et al., 1990 ; Boscia et al., 1995 ); it was propagated in the grapevine hybrid LN33 and purified from young roots and petioles as described (Boulila et al., 1990 ). Viral RNA was extracted from purified virus particles by the SDSphenol method (Diener & Schneider, 1968 ) and stored in ethanol at -70 °C until use.
Cloning and sequencing.
The cloning strategy is shown in Fig. 1. Random primer-generated cDNA was cloned in pGEM-4Z and/or pUC18. The initial clones, encompassing fragments of the virus replication-related proteins and coat protein, were sequenced and used for further cloning, either by primer extension or PCR, to fill the gaps between adjacent clones.
|
To determine the presence of poly(A) at the 3' terminus, viral RNA was first submitted to oligo(dT) cellulose chromatography; oligo(dT)-primed cDNAs were then synthesized, cloned and sequenced. The presence of a poly(A) tail was further confirmed by generating dT-primed cDNAs and amplifying the 3' end with an oligo(dT) and the 3'-proximal GFkV-specific primers Fk19 (5' GTCCTCCTACACCTCCCTGTCCAT 3') and Fk3 (5' CCTCATCCGCGGAGTTATCGAAT 3'), complementary to nt 66096632 and 69997021 of the GFkV genome, respectively.
The 5' end nucleotides were determined using a 5'/3' RACE kit (Roche). Briefly, first strand cDNA was made using AMV RT and the primer FkV5As (5' AAAGGATGCAGAGCACGAAGCGA 3'; complementary to nt 129151 of the viral genome). The cDNA preparation was divided into two aliquots to be dA- and dG-tailed separately, according to the manufacturers instructions. Fragments containing the 5' end were then generated by PCR using dC or dT primers combined with the internal GFkV-specific primer FkV55As (5' ACTTGGACAGGGTGGCGTCAAA 3'), complementary to positions 2950. Amplified products were cloned using the pGEM-T Easy Vector System (Promega).
All cDNAs, regardless of the vector used, were cloned and subcloned into competent Escherichia coli DH5α cells, propagated, and manually sequenced on both strands by the dideoxy chain termination method (Sanger et al., 1977 ).
Sequence analysis.
Nucleic acid and deduced amino acid products were analysed using the DNA Strider 1.1 program (Marck, 1988 ). Protein sequences were aligned with CLUSTAL W (Thompson et al., 1994 ). The GFkV nucleotide and deduced protein sequences were compared with other viral sequences from the GenBank and EMBL databases using the FASTA (Pearson & Lipman, 1988 ) and BLAST (Altschul et al., 1990 ) programs. Tentative phylogenetic trees were constructed, and bootstrap analysis performed with the NEIGHBOR, SEQBOOT, PROTDIST and CONSENSE programs of the PHYLIP package (Felsenstein, 1989 ).
Northern blot.
Viral nucleic acid preparations, extracted separately from T and B fractions, were analysed electrophoretically under semi-denaturing conditions in 1% TBE agarose and stained with ethidium bromide. The gel was incubated in 40 mM NaOH and 2·5 mM EDTA for 20 min and treated with 2xSSC solution prior to capillary transfer of nucleic acids to Hybond-N+ nylon membranes using 20xSSC buffer. Membranes were then hybridized at 55 °C with a DIG-labelled cRNA probe complementary to nucleotides 69997454, according to the manufacturers instructions (Roche).
Genome organization
Computer-assisted analysis of the GFkV sequence showed the presence of four main ORFs (Fig. 1). The first two ORFs were in the same frame, separated by a double stop codon.
ORF 1 started with an AUG at position 292 and ended with an amber stop codon (UAG) at position 6141. The initiation codon was located in a very favourable translation context (Kozak, 1987 ), fitting perfectly with the consensus sequence [-GCCG(A)CCAUGG- versus -CCCACCAUGG-]. This ORF encoded a putative polypeptide of 1950 aa with a molecular mass of 215·4 kDa (p215), identified as the replication-associated polyprotein (RP) as it contains the conserved motifs of MTR (Rozanov et al., 1992 ; Koonin & Dolja, 1993 ), protease (P-PRO) (Gorbalenya et al., 1991 ), NTPase/helicase (Gorbalenya & Koonin, 1989 ) and RdRp of positive-strand RNA viruses (Koonin, 1991 ; Koonin & Dolja, 1993 ).
Multiple alignment of GFkV RP with the corresponding polyproteins of tymoviruses and OBDV showed similarities in both sequence and position of conserved motifs (Fig. 2). In particular:
|
(i) The motifs of the putative MTR domain, a hallmark of the alpha-like plant viruses presumably involved in methylation of the 5' cap structure (Mi & Stollar, 1991 ), were found near the N terminus of the GFkV RP (aa 164341). Although the presence of a cap structure in GFkV RNA was not experimentally demonstrated, the presence of the MTR motifs and of a guanidine in the first position of the viral genomic RNA suggest that GFkV RNA is capped. Comparison of the GFkV MTR with the corresponding domains of tymo- and marafiviruses showed identity ranging from 46% with Erysimum latent virus (ErLV; Srifah et al., 1992 ) to 56% with OBDV (see also Sabanadzovic et al., 2000 ).
(ii) As with tymoviruses and OBDV (Dreher et al., 2000 ; Edwards et al., 1997 ) the MTR domain was followed by an amino acid sequence containing the conserved domain of the putative P-PRO found in a number of alpha-like viruses (Rozanov et al., 1995 ). TYMV P-PRO, the prototype of this group of proteases was shown to be cis-acting and composed of aa 731885 of the TYMV RP protein (Bransom & Dreher, 1994 ; Rozanov et al., 1995 ). All amino acids involved in protease activity and their relative distances (Cys-814 and His-900) were conserved in GFkV RP, which also possessed the CLL and HF/Y motifs conserved in tymoviruses and OBDV (Fig. 3).
|
(iii) NTPase/helicase motifs IVI were identified between nt 1043 and 1270 of GFkV RP. The level of identity of this region with the NTPases/helicases of tymo- and marafiviruses ranged from 48% with Physalis mottle virus (PhyMV; Ranjith-Kumar et al., 1998 ) to 54% with OBDV.
(iv) The highest level of identity of GFkV RP and the comparable proteins of tymo- and marafiviruses is in the putative RdRp, ranging from 59% with Ononis yellow mosaic virus (OYMV; Ding et al., 1989 ) to 68% with OBDV. This is in line with the previously reported phylogenetic analysis of this region (Sabanadzovic et al., 2000 ).
A significant difference with tymo- and marafiviruses was represented by the absence from the GFkV genome of the highly conserved 16 nt long subgenomic RNA promoter referred to as the tymobox, located near the end of the viral replicase of all sequenced tymoviruses (Ding et al., 1990a ) and marafiviruses (Edwards et al., 1997 ; Bradel et al., 2000 ). Further evidence of the absence of a tymobox was provided by the unsuccessful attempts to amplify this genomic region using tymobox-specific primers. An additional difference with tymoviruses was the absence from the GFkV genome of an ORF with the same size and location of ORF 2 of tymoviruses, which encodes the overlapping protein (OP), a proline-rich putative movement protein (Dreher et al., 2000 ).
ORF 2 started at position 6367, ended with an opal stop codon at position 7059 and encoded a 230 aa product with a molecular mass of 24·5 kDa (p24), identified as the viral capsid protein (CP). The overall degree of amino acid identity between GFkV CP and CPs of tymoviruses ranged from 23% with OYMV (Ding et al., 1989 ) to 31% with Calopogonium yellow vein virus (Gibbs et al., 1997 ) and Cacao yellow mosaic virus (Ding et al., 1990b ). Identity with the coat proteins of Poinsettia mosaic virus (PnMV) (Bradel et al., 2000 ) and OBDV was 28 and 29%, respectively. The GFkV CP gene contained the PFQ amino acid triplet conserved in all sequenced tymoviruses and marafiviruses (Edwards et al., 1997 ; Hammond et al., 1997 ).
Whereas phylogenetic analysis of RP domains placed GFkV closed to OBDV than tymoviruses (Fig. 4A), analysis of CP sequences placed GFkV in a somewhat intermediate position between tymoviruses and OBDV (Fig. 4B). This was particularly evident when the C-terminal sequences of viral CPs downstream the PFQ motif were used for analysis (not shown).
|
The third and fourth ORFs overlapped the CP gene towards the 3' terminus. ORF 3 started at position 6590, ended with an amber stop codon at position 7519, and encoded a 309 aa polypeptide with a molecular mass of 31·4 kDa (p31), rich in proline (33%) and serine (16%). These two amino acids were also highly represented in the putative expression product of ORF 4, with a molecular mass of 15·9 kDa (p16).
Comparison of the polypeptides encoded by ORFs 3 and 4 with proteins from GenBank and EMBL showed similarity with some proline-rich proteins (i.e. extensin-like and hydroxyproline-rich glycoprotein D) and, marginally, with the putative movement protein of tymoviruses. However, the information currently available does not allow any conclusions regarding the potential involvement of these proteins in the intercellular transport of GFkV.
Noncoding regions
The 5' noncoding region (5'NCR) of GFkV was 291 nt long, much longer than the comparable regions of tymoviruses of which the longest are the 5'NCR of OYMV (171 nt) and OBDV (114 nt) (Ding et al., 1989 ; Edwards et al., 1997 ). The GFkV 5'-terminal sequence was determined from five independent RACEPCR-generated clones and was the same in both dG- and dA-tailed clones. All dA-tailed clones had the 5' sequence 5' (A)nGCACAT 3', whereas all dG-tailed clones had the sequence 5' (G)nCACAT 3'. It was concluded that the GFkV 5' end is likely to have the sequence 5' GCACATTAG 3'.
Analysis of the GFkV 5'NCR showed a prevalence of pyrimidines (235 nt) over purines (56 nt), suggesting that the presence of a pyrimidine-rich region may facilitate translation of the viral RP, being complementary to the sequence present near the 3' terminus (5' GGAAG 3') of wheat 18S ribosomal RNA, as hypothesized for OYMV (Ding et al., 1989 ) and PhyMV (Ranjith-Kumar et al., 1998 ). In GFkV, a sequence complementary to 18S ribosomal RNA was found at position 263267, near the start codon of ORF 1.
The 3'NCR of GFKV RNA was shorter than that of tymoviruses (Ranjith-Kumar et al., 1998 ) and OBDV (Edwards et al., 1997 ) and consisted of 35 nt, excluding the poly(A) tail. Sequencing of four independent clones corresponding to the viral 3' end revealed the presence of a 3'-terminal poly(A) tract from 13 to 24 residues in length. This feature places GFkV closer to OBDV, known to have a polyadenylated 3' terminus (Edwards et al., 1997 ), than to tymoviruses, whose genome terminates with a tRNA-like structure (Dreher et al., 2000 ).
Subgenomic RNAs
Northern blot analysis showed that the top component of GFkV contains at least two subgenomic RNAs with an estimated size of ca. 1300 and 1000 nt, respectively, whereas the bottom fraction contained both genomic and subgenomic RNAs (Fig. 5). The presence of subgenomic RNA in purified virus preparations has been reported for tymoviruses and marafiviruses (Bradel et al., 2000 ).
|
Thus, GFkV resembles members of the Tymovirus and Marafivirus genera in particle structure and outward appearance, physico-chemical and hydrodynamic properties, and partially in intracellular behaviour (Castellano & Martelli, 1984 ; Boulila et al., 1990 ; Dreher et al., 2000 ; Edwards, 2000 ). In addition, its RP and CP are phylogenetically related, though to different extents, to representatives of both genera (see also Sabanadzovic et al., 2000 ). By contrast, there are a number of biological and molecular traits that separate GFkV from members of the above two genera. Differences with tymoviruses lie in restriction of GFkV to the phloem, lack of mechanical transmissibility and of a known vector, cytopathology (vesiculation affects mitochondria rather than chloroplasts), genome size (7·5 kb versus 6·3 kb), CP size (28 kDa versus 20 kDa), genome organization, localization and number (4 versus 3) of ORFs, and type of 3'-terminal structure [poly(A) tail versus tRNA-like structure].
Differences with marafiviruses reside in the lack of a known vector, natural host range (Vitis versus Gramineae), cytopathology (marafiviruses apparently do not induce organellar vesiculation), genome size (7·5 kb versus 6·5 kb), number and size of CP subunits (one with a molecular mass of 28 kDa versus two with molecular masses of 24 and 21 kDa, respectively), genome organization and number of ORFs (4 versus 2). Thus, the general biology and molecular properties of GFkV do not fit those characterizing either the genus Tymovirus or the genus Marafivirus. The differences are significant enough to support the notion that GFkV should be the representative of a diverse new genus in the Tymovirus lineage (Koonin & Dolja, 1993 ).
The authors wish to thank Dr R. W. Hammond, ARS-USDA, Beltsville, MD, USA, for providing the sequence of Maize rayado fino virus prior to publication.Footnotes
Sequence data from this article have been deposited with EMBL under accession no. AJ309022.References
Boscia, D., Martelli, G. P., Savino, V. & Castellano, M. A. (1991). Identification of the agent of grapevine fleck disease. Vitis 30, 97-105.
Boscia, D., Elicio, V., Savino, V. & Martelli, G. P. (1995). Production of monoclonal antibodies to grapevine fleck virus. Plant Pathology 44, 160-163.
Boulila, M., Boscia, D., Di Terlizzi, B., Castellano, M. A., Minafra, A., Savino, V. & Martelli, G. P. (1990). Some properties of a phloem-limited non mechanically-transmissible grapevine virus. Journal of Phytopathology 129, 151-158.
Bradel, G. B., Preil, W. & Jeske, H. (2000). Sequence analysis and genome organization of Poinsettia mosaic virus (PnMV) reveal closer relationship to marafiviruses than to tymoviruses. Virology 271, 289-297.[Medline]
Bransom, K. L. & Dreher, T. W. (1994). Identification of the essential cysteine and histidine residues of the turnip yellow mosaic virus protease. Virology 198, 148-154.[Medline]
Castellano, M. A. & Martelli, G. P. (1984). Ultrastructure and nature of vesiculated bodies associated with isometric virus-like particles in diseases grapevines. Journal of Ultrastructural Research 89, 56-64.
Diener, T. O. & Schneider, I. R. (1968). Virus degradation and nucleic acid release in single phenol systems. Archives of Biochemistry and Biophysics 124, 401-412.[Medline]
Ding, S. W., Keese, P. & Gibbs, A. (1989). Nucleotide sequence of the ononis yellow mosaic tymovirus genome. Virology 172, 555-563.[Medline]
Ding, S. W., Howe, J., Keese, P., MacKenzie, A., Meek, D., Osorio-Keese, M., Skotnicki, M., Srifah, P., Torronen, M. & Gibbs, A. J. (1990a). The tymobox, a sequence shared by most tymoviruses: its use in molecular studies of tymoviruses. Nucleic Acids Research 18, 1181-1187.[Abstract]
Ding, S. W., Mackenzie, A., Torronen, M. & Gibbs, A. (1990b). Nucleotide sequence of the virion protein gene of cacao yellow mosaic tymovirus. Nucleic Acids Research 18, 5886.[Medline]
Dreher, T. W., Haenni, A. L. & Mayo, M. A. (2000). Genus Tymovirus. In Virus Taxonomy. Seventh Report of the International Committee on Taxonomy of Viruses , pp. 964-969. Edited by M. H. V. van Regenmortel, C. M. Fauquet, D. H. L. Bishop, E. B. Carstens, M. K. Estes, S. M. Lemon, J. Maniloff, M. A. Mayo, D. J. McGeoch, C. R. Pringle & R. B. Wickner. San Diego:Academic Press.
Edwards, M. C. (2000). Genus Marafivirus. In Virus Taxonomy. Seventh Report of the International Committee on Taxonomy of Viruses , pp. 769-773. Edited by M. H. V. van Regenmortel, C. M. Fauquet, D. H. L. Bishop, E. B. Carstens, M. K. Estes, S. M. Lemon, J. Maniloff, M. A. Mayo, D. J. McGeoch, C. R. Pringle & R. B. Wickner. San Diego:Academic Press.
Edwards, M. C., Zhang, Z. & Weiland, J. J. (1997). Oat blue dwarf marafivirus resembles the tymoviruses in sequence, genome organization, and expression strategy. Virology 232, 217-229.[Medline]
Felsenstein, J. (1989). PHYLIPPhylogeny Inference Package, version 3.2. Cladistics 5, 164-166.
Gibbs, A. J., Mackenzie, A. M. & Abdul-Samad, N. (1997). A tymovirus from Calopogonium mucunoides in Malaysia is not clitoria yellow vein tymovirus. Archives of Virology 142, 1697-1702.[Medline]
Gorbalenya, A. E. & Koonin, E. V. (1989). Viral proteins containing the purine-NTP sequence pattern. Nucleic Acids Research 17, 8413-8440.[Abstract]
Gorbalenya, A. E., Koonin, E. V. & Lai, M. M. C. (1991). Putative papain-related thiol proteases of positive-strand RNA viruses. FEBS Letters 288, 201-205.[Medline]
Hammond, R. W., Kogel, R. & Ramirez, P. (1997). Variability of geographically distinct isolates of maize rayado fino virus in Latin America. Journal of General Virology 78, 3153-3159.[Abstract]
Hellendoorn, K., Mat, A. W., Gultyaev, A. P. & Pleij, C. W. A. (1996). Secondary structure model of the coat protein gene of turnip yellow mosaic virus RNA: long, C-rich, single-stranded regions. Virology 224, 43-54.[Medline]
Koenig, R. (1988). Polyhedral plant viruses with monopartite RNA genomes. Introduction and summary of important properties. In The Plant Viruses. Polyhedral Virions with Monopartite RNA Genomes , pp. 1-12. Edited by R. Koenig. New York & London:Plenum Press.
Koonin, E. V. (1991). The phylogeny of RNA-dependent RNA polymerases of positive-strand RNA viruses. Journal of General Virology 72, 2197-2206.[Abstract]
Koonin, E. V. & Dolja, V. V. (1993). Evolution and taxonomy of positive-strand RNA viruses: Implications of comparative analysis of amino acid sequences. Critical Reviews in Biochemistry and Molecular Biology 28, 375-430.[Abstract]
Kozak, M. (1987). An analysis of 5'-noncoding sequences from 699 vertebrate messenger RNAs. Nucleic Acids Research 20, 8125-8132.
Marck, C. (1988). DNA Strider: a C program for the fast analysis of DNA and protein sequences on the Apple Macintosh family of computers. Nucleic Acids Research 16, 1829-1836.[Abstract]
Martelli, G. P. (1993). Graft-transmissible Diseases of Grapevines. Handbook for Detection and Diagnosis. Rome: FAO Publication Division.
Mi, S. & Stollar, V. (1991). Expression of Sindbis virus nsP1 and methyltransferase activity in Escherichia coli. Virology 178, 429-434.
Pearson, W. R. & Lipman, D. J. (1988). Improved tools for biological sequence comparison. Proceedings of the National Academy of Sciences USA 85, 2444-2448.[Abstract]
Ranjith-Kumar, C. T., Gopinath, K., Jacob, A. N. K., Srividhya, V., Elango, P. & Savithri, H. (1998). Genomic sequence of physalis mottle virus and its evolutionary relationship with other tymoviruses. Archives of Virology 143, 1489-1500.[Medline]
Rozanov, M. N., Koonin, E. V. & Gorbalenya, A. E. (1992). Conservation of the putative methyltransferase domain: a hallmark of the Sindbis-like supergroup of positive-strand RNA viruses. Journal of General Virology 73, 2129-2134.[Abstract]
Rozanov, M. N., Drugeon, G. & Haenni, A.-L. (1995). Papain-like proteinase of turnip yellow mosaic virus: a prototype of a new viral proteinase group. Archives of Virology 140, 273-288.[Medline]
Sabanadzovic, S., Abou-Ghanem, N., Castellano, M. A., Digiaro, M. & Martelli, G. P. (2000). Grapevine fleck virus-like viruses in Vitis. Archives of Virology 145, 553-565.[Medline]
Sanger, F., Nicklen, S. & Coulson, A. R. (1977). DNA sequencing with chain-terminating inhibitors. Proceedings of the National Academy of Sciences USA 74, 5463-5467.[Abstract]
Srifah, P., Keese, P., Weiller, G. & Gibbs, A. (1992). Comparisons of the genomic sequences or erysimum latent virus and other tymoviruses: a search for the molecular basis of their host specificities. Journal of General Virology 73, 1437-1447.[Abstract]
Thompson, J. D., Higgins, D. G. & Gibson, T. J. (1994). CLUSTAL W: improving the sensitivity of progressive multiple alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Research 22, 4673-4680.[Abstract]
Received 30 January 2001; accepted 5 April 2001.