Abstract
Vaccines based on peptides have a number of potential advantages over other forms of vaccine. First, there are none of the risks associated with using live attenuated virus vaccines. Second, epitopes stimulating a protective immune response can be selected. Third, potentially detrimental epitopes (e.g. those enhancing HIV infection; Robinson et al., 1987 , 1990 ) or those with sequence homology to cellular proteins (molecular mimicry; Beretta et al., 1987 ; Brenneman et al., 1988 ; Reiher et al., 1986 ; Vega et al., 1990 ; Young, 1988 ) can be excluded. We therefore designed this study to assess the ability of peptide immunogens to induce both humoral and CTL responses against SIVmac and to protect against challenge. As the restricting MHC class I molecule for only one SIVmac CTL epitope (p11C) was known at initiation of this study, rhesus monkeys were preselected for expression of the corresponding Mamu-A*01 molecule (Vogel et al., 1995 ).
Peptides.Peptides were synthesized in an Abimed AMS 422 multiple peptide synthesizer or in an LKB Biochrom Biolynx 4170 peptide synthesizer by Fmoc chemistry according to the manufacturer's protocols. Multiple antigenic peptides (MAPs) were synthesized on an Fmoc8-Lys4-Lys2-Lys-βAla-Wang-Resin, and then cleaved and purified in the same manner as the single peptides. P3CSS-peptides were prepared using protocols described previously (Prass et al., 1987 ; Wiesmüller et al., 1983 ) and are now available from EMC Microcollections GmbH, Tübingen, Germany.
Peptide sequences were as follows. SIVmac neutralization epitopes: gp130168190 (V2), KFNMTGLKRDKTKEYNET (Benichou et al., 1992 ; Kent et al., 1992 ); gp130410430 (V432), VEDRDVTNQRPKERHRRNYVP (Torres et al., 1993 ); gp130410430 (V432H), VEDRNTTNQKPKEQHKRNYVP (Torres et al., 1993 ). SIVmac CTL epitopes Gag3559 (p17), VWAANELDRFGLAESLLENKEGCQK (Yamamoto et al., 1990 ); Gag171195 (p27=peptide 11), VPGFQALSEGCTPYDINQMLNCVGD (Miller et al., 1991 ; Yamamoto et al., 1990 ); Gag181189 (p27), =p11C,C→M), CTPYDINQM (Allen et al., 1998 ); Nef108123, LRTMSYKLAIDMSHFI (Bourgault et al., 1992 ); Nef155178, DWQDYTSGPGIRYPKTFGWLWKLV (Bourgault et al., 1992 ). The p11C,C→M peptide is the minimal epitope contained within the P11 sequence and is required for preparation of the Mamu-A*01/peptide tetramers.
Cell lines.
MT-4 cells were obtained from the ATCC and C8166 cells from the MRC AIDS Reagent Project (UK). Molt-4/8 cells were kindly donated by Dr M. Hayami (Kyoto, Japan). Rhesus monkey B-lymphoblastoid cell lines (B-LCL) were generated as described previously (Vogel et al., 1995 ) by incubating PBMC with herpesvirus papio produced by S594 cells (kindly provided by Dr Letvin, NERPC, USA). All permanent cell lines were cultured in RPMI 1640 supplemented with 10% FCS, 2 mM L-glutamine, 100 µg neomycin, 100 U penicillin and 100 µg streptomycin per ml.
PBMC.
Peripheral blood mononuclear cells (PBMC) were separated from whole heparinized blood by Ficolldiatrizoate (Histopaque, Sigma) density-gradient centrifugation. The PBMC were either used immediately or stored in liquid nitrogen. PBMC were cultured in PBMC medium [RPMI 1640 supplemented with 20% FCS, 4 mM L-glutamine, 15 mM HEPES buffer, 2·5x10-5 M 2-mercaptoethanol, 100 µg neomycin, 100 U penicillin, 100 µg streptomycin and 500 IU recombinant IL-2 (Proleukin, EuroCetus) per ml]. Phytohaemagglutinin (PHA) blasts were prepared by addition of PHA (54 µg/ml; Murex Diagnostics) to the culture medium for the first 3 days of culture. The cytotoxicity assay was carried out in PBMC medium.
Virus reisolation and cell-associated virus load.
On the day of challenge and subsequent bleedings 1·5x106 PBMC from each monkey were cocultivated with 5x106 C8166 cells. After 28 days the cultures were analysed for the presence of SIVmac infection by immunoperoxidase staining (Norley et al., 1993 ).
For determining the virus load 10-fold dilutions of PBMC (106101 cells) were cocultivated with 1x106 C8166 cells in triplicate and analysed as above. The numbers of infected cells per 106 PBMC were then calculated using a Poisson distribution fitting model.
Rhesus macaques, immunization and challenge schedule.
Mamu-A*01-positive rhesus macaques (Macaca mulatta) were selected by 1-dimensional isoelectrofocussing (1-D IEF) as described previously (Watkins et al., 1988 ) and immunized according to the schedule described in Table 1. Two weeks after the last immunization all animals, including the two control animals, were challenged with 20 MID50 of the in vivo titrated SIVmac stock 5, prepared by passaging the European SIVmac251-32H 11/88 challenge virus once through rhesus PBMC.
Table 1. Immunization and challenge protocol
Neutralization test.
This was performed as described previously (Vogel et al., 1994 ).
In vitro stimulation of PBMC.
The presence of peptide-specific CTL was determined after in vitro stimulation of PBMC with peptide-pulsed stimulator cells. Briefly, stimulator cells were generated by incubation of 5x106 autologous B-LCL or PHA-activated PBMC with 50 µM peptide at 37 °C in a 5% CO2 humidified atmosphere. After 1 h, the cells were γ-irradiated (3000 rad), washed twice with PBS and added to 5x106 fresh autologous PBMC. After 1214 days, during which time the cultures were refed five times with PBMC medium, the in vitro stimulated PBMC were used as effectors in the cytotoxicity assay.
Limiting dilution analysis (LDA).
To estimate the peptide-specific CTL precursor frequency, PBMC were titrated (initial cell number 105 per well; 12 dilution steps at 1:2; 12 replicates per dilution) in microtitre plates. 105 peptide-pulsed stimulator cells were added to give a final volume of 200 µl per well. After 1214 days in vitro stimulation, well contents were analysed by cytotoxicity assay (see below) for the presence of peptide-specific CTL. Frequency calculations were made using the zero order term Poisson equation as described previously (Donnenberg et al., 1989 ).
Cytotoxicity assay.
Target cells were prepared by incubating autologous B-LCL or PHA-activated PBMC with synthetic peptides at a final concentration of 50 µM and Na251CrO4 at 0·5 mCi/ml for 3 h at 37 °C in a 5% CO2 humidified atmosphere followed by six washes in RPMI 1640. The in vitro stimulated PBMC were used as effector cells. The chromium release assay was performed using standard procedures in U-bottom 96-well microtitre plates. Briefly, autologous B-LCL or PHA-activated PBMC target cells were plated at 1x104 or 2x104 cells per well, respectively, effector cells were added and, after centrifugation at 2000 r.p.m. for 5 min, the plates were incubated for 4 h at 37 °C. Spontaneous and total release were determined by incubating targets with media or detergent, respectively. Radioactivity in harvested supernatants was measured using a γ-counter and the percent specific chromium release calculated using the following formula:%specific lysis=c.p.m.(effectors)-c.p.m.(spontaneous)/c.p.m.(total)-c.p.m. (spontaneous)x100.
Tetramer staining.
1x106 thawed PBMC were washed three times in FACS-buffer (PBS, 2% FCS) in a 96-well U-bottom plate. Cells (100 µl) were incubated for 40 min at room temperature in the dark with the Mamu-A*01/p11C,C→M-tetramer labelled either with PE or APC (1:200 dilution of stock), an anti-rhesus CD3FITC monoclonal antibody (10 µl; BioSource) and an anti-CD8PerCP monoclonal antibody (3 µl; BD). The Mamu-A*01 molecule was refolded with the p11C,C→M peptide and the tetramers were made as described previously (Altman et al., 1996 ). Plates were then washed four times with FACS-buffer. Finally, 450 µl 2% paraformaldehyde (PFA) in PBS was added to fix the stained cells. A CTL clone specific for these tetramers was stained in parallel with isotype controls [mouse IgG1FITC (Biosource); mouse IgG2aPE (Immunotech); mouse IgG1PerCP (BD); mouse IgG1APC (Immunotech), anti-CD3FITC, anti-CD8αPE (Immunotech), anti-CD8α-PerCP, or CD8α-APC (Immunotech) to establish compensation parameters]. Sample data were acquired on a Becton Dickinson FACSCalibur instrument and analysed using CellQuest software. Background staining of fresh PBMC from naive Mamu-A*01+ animals with tetrameric complexes was routinely less than 0·07%.
PCR.
Nested PCR analysis of rhesus PBMC was performed using standard protocols (Saiki et al., 1988 ) and the following SIVmac32H nef primers: SN9044N (5' GACCTACCTACAATATGGG 3') and SN9866C (5' TCAGCGAGTTTCCTTCTTGT 3') for the first 40 cycles and SN9272N (5' GAATACTCCATGGAGAAACC 3') and SN9763C (5' GGGTATCTAACATATGCCTC 3') for the second 40 cycles. To determine the frequency of proviral DNA carrying cells in peripheral blood, different amounts of PBMC (101105 cells) were analysed by PCR.
p27 assay.
This was was performed using the commercial SIV Core Antigen Assay (Coulter) according to manufacturer's protocol.
Plasma virus load.
The number of SIV RNA copies per ml of plasma was measured using real-time quantitative RTPCR. Briefly, viral RNA was isolated from 200 µl plasma using the High Pure Viral RNA kit (Roche) according to the manufacturers instructions. Eluted RNA was then subjected to a one-step RTPCR using the OneStep RTPCR kit (Qiagen) with the following reagent mix (volume: 40 µl mix plus 10 µl RNA sample): 1x Qiagen OneStep RTPCR buffer; 1·5 µM forward and reverse primers; 1 µM probe; 400 µM of each dNTP; 3 mM MgCl2; 20 U rRNasin; 2 µl Qiagen Enzyme Mix and 0·5 µM Rox dye. Primers and probe, synthesized by Eurogentec, Belgium, were as follows: Forward primer 5' CTAGTGGTGGAAACAGGAACA 3'; reverse primer 5' TGTTCTCGGGCTTAATGGCA 3'; probe 5' F CCAACAG-CACCATCTAGCGGCAGAGGT Q 3'. The probe was 3'-phosphorylated to prevent extension. The RT reaction was carried out at 50 °C for 30 min followed by an initial denaturation step of 15 min at 95 °C and 45 PCR cycles (95 °C 15 s; 60 °C 2 min). Reactions were performed in an ABI Prism 7700 Sequence Detector (Applied Biosystems). The number of SIV RNA copies was calculated by comparing the Threshold Cycle (CT) value with those of a dilution series of standard SIVmac RNA included in each reaction. All samples and standards were run in triplicate and means were used for calculations.
After three immunizations with an antigen dose of 0·1 mg/peptide, rhesus monkeys developed antibodies against both the neutralization epitopes delivered as MAP (group 2) and against some of the CTL epitopes (Table 1). In the majority of the macaques it was also possible to detect antibodies binding native SIVmac antigen. After a further three immunizations with 1 mg/peptide the antibody titres against all peptides increased and two macaques of group 2 that had been immunized with the neutralizing epitopes developed antibodies against rgp140 in ELISA and against gp130 in Western blot (data not shown). However, in none of the animals was it possible to detect neutralizing antibodies against SIVmac. After a break in the immunization schedule of 16 weeks, during which time antibody titres against all immunogens decreased, the animals were again immunized three times, this time using the mineral oil adjuvant Montanide ISA 51 in conjunction with both kinds of peptides (MAP and P3CSS-peptides). In most cases antibody titres again increased and the sera from one macaque of group 2 was shown to neutralize SIVmac in vitro (Fig. 1).
|
After three immunizations with the low antigen dose (0·1 mg/peptide) no peptide-specific CTL could be detected (data not shown), although it was possible to demonstrate p11-specific CTL in one monkey (Rh 67) following immunization with the high antigen dose (1 mg/peptide; Table 2). However, after one immunization utilizing the mineral oil adjuvant Montanide ISA 51, p11-specific CTL could be demonstrated in five out of six Mamu-A*01-positive rhesus macaques (Rh 67, 80, 84, 85, 86; Table 2). Despite being immunized a further three times it was not possible to demonstrate CTL at every bleeding. Indeed, on the day of challenge p11-specific CTL could only be demonstrated in macaques 67, 80 and 85. None of the animals developed CTL against the other CTL epitopes used even after infection (data not shown). It is likely that they did not possess the MHC class I molecule that binds these epitopes. The Mamu-A*01-negative rhesus 66 never developed p11-specific CTL.
Table 2. Demonstration of p11-specific CTL after immunization with P3CSS peptides by in vitro stimulation of PBMC with p11-pulsed stimulator cells*
Secondary antibody response after virus infection
With the exception of Rh 67, the monkeys showed little or no anamnestic antibody response to the peptides following challenge. In contrast, all animals showed a strong increase in antibody titres against rgp140 and whole SIVmac antigen after challenge. Rhesus monkey 67 showed an increase in anti-rgp140 antibodies as soon as 2 weeks post-challenge whereas in most others the titres increased from week 3 after challenge. Animals of group 2 (Rh 80 and 88), which possessed anti-rgp140 responses at the day of challenge, showed the strongest and fastest response after challenge. The pattern of antibody development against whole SIVmac antigen was very similar to that seen for rgp140. Most animals showed an increase in titre beginning 34 weeks after challenge and levelling off at 20 weeks.
As Fig. 1 shows, all animals had detectable neutralizing antibodies at 3 weeks post-challenge, although in contrast to the others rhesus monkey 66 showed a weak neutralizing response that had disappeared by week 8. Rhesus monkey 80, in which neutralizing antibodies had been detectable on the day of challenge, showed an anamnestic response with the titre already rising in the second week after challenge.
Post-challenge virus load measurements
After challenge with SIVmac32H all immunized animals and the two control animals became infected as demonstrated by virus reisolation, quantitative RTPCR (Fig. 2, Fig. 3) and provirus PCR (data not shown). The immunized, Mamu-A*01-positive macaques 67, 80 and 84 had a reduced cell-associated virus load in the peripheral blood as determined by limiting dilution virus reisolation. One immunized animal (Rh 86) showed a delayed primary peak in the number of infected cells and the Mamu-A*01-negative rhesus macaque 66 yielded the highest virus load. Although the p27 assay (Fig. 2) and the quantitative PCR showed a different picture from the cell-associated virus load, the reduced virus load of rhesus macaque 67 was confirmed. The discrepancy between the virus load as measured for infected cells in culture and that indicated by p27 assay and quantitative PCR may be caused by the fact that the latter methods also detect disrupted virus or defective proviruses, respectively.
|
|
Nevertheless the quantitative PCR also confirmed the delayed primary viraemia of rhesus macaque 86 (data not shown). The Mamu-A*01-negative rhesus macaque 66, which showed prolonged p27 viraemia and had the highest virus load (which increased again 15 weeks after challenge) finally developed AIDS-like symptoms during week 18 and was euthanized at week 20 after challenge.
In contrast, no beneficial effect of immunization was evident when assessed by the levels of viral RNA in the plasma (Fig. 3). Indeed, the two control macaques (Rh 14 and Rh 20) had the lowest set points (average virus load from week 8 onwards) of all animals tested (103·8 and 104·1 RNA copies/ml plasma respectively) compared to a mean of 104·8 for most (omitting Rh 86) of the immunized macaques (p=0·12). Rh 86 showed a higher set point of 106·0 copies/ml and in agreement with the results of the cell-associated virus load measurements, the Mamu-A*01-negative macaque (Rh 66) which rapidly developed simian AIDS showed the highest degree of plasma virus load (set point 107·6 RNA copies/ml plasma).
Correlation between CTL response and virus load
Although most animals had shown a positive p11-specific CTL response at one or more time points before challenge as measured by bulk culture, it was only possible to detect CTL using the limiting dilution assay in monkeys 67 and 85 (Fig. 4A). However, in contrast to the control animals, all immunized, Mamu-A*01-positive monkeys with the exception of Rh 86 had measurable frequencies of p11-specific CTL 1 week after challenge (Fig. 4A). By 2 weeks after challenge all immunized and control animals, except the Mamu-A*01-negative Rh 66, demonstrated p11-specific CTL. In Rh 67 the frequency of CTLp in the second week after challenge was extremely high, with 1 in 20 of all circulating PBMC being a p11-specific CTLp and in the ensuing weeks the frequency of CTLp in this animal remained in the range 1:201:50. Similarly, at 2 weeks post-challenge the frequency of circulating p11-specific CTLp in rhesus 80 was already 1:250 of the total PBMC.
|
With the advent of tetramer technology (Altman et al., 1996 ) it became possible to confirm these extraordinarily high CTLp frequencies. PBMC frozen at the time of sampling were thawed and tested in FACS for binding of the Mamu-A*01/p11C,C→M tetramer. The levels of tetramer-positive cells were, as indicated by previous reports (Tan et al., 1999 ), generally higher (1- to 10-fold) than the functional CTLp frequencies measured previously. In particular, for the two animals with the highest CTLp frequency as measured by LDA (Rh 67 and Rh 80) the proportion of CD8+ T-cells specific for the Mamu-A*01/p11C,C→M tetramer peaked at 25·4% and 19·5% respectively (Fig. 4B).
It was striking that Rh 67, which demonstrated the highest CTLp frequency (LDA and tetramer staining), also had the lowest peripheral cell-associated virus load, suggesting a possible correlation between the two. Indeed, comparison of the cell-associated virus load and the frequency of Mamu-A*01/p11C,C→M tetramer-positive cells at 4 weeks post-challenge revealed an inverse relationship with a correlation coefficient of 0·788 (Fig. 5A). Similarly, plotting the available data for 4 weeks post-challenge gave an R2 value of 0·782 for CTLp frequency (LDA) vs cell-associated virus load and 0·707 for tetramer-positive cells vs provirus containing cells (data not shown). These correlations broke down at later time-points as cell-associated virus loads became negligible.
|
However, the correlation between CTLp frequency and virus load was not seen at the level of plasma viraemia (Fig. 5B, R2=0·0). Even animals with extraordinarily high levels of CTLp fared no better than those with lower levels. For example, macaques 67 and 80, with post-challenge tetramer-positive cell frequencies of 25·4% and 9·5%, respectively, had plasma RNA set points as high, if not higher, than most other macaques (including controls) with tetramer-positive cells in the range 0·6 to 3·9%. The aim of this study was to stimulate SIVmac-specific antibodies and CTL in rhesus macaques using peptides and to assess the vaccine effect of such immunogens by challenge. Using MAPs and P3CSS-peptides as immunogens it was indeed possible to induce SIVmac-specific antibodies and in most cases CTL in rhesus monkeys. The P3CSS lipid tail appeared to function as an adjuvant, as reported previously (Lex et al., 1986 ), with the monkeys developing antibody responses to the CTL epitope peptides, responses not seen in non-immunized, infected monkeys. The peptide-specific antibodies induced by immunization could not only bind the relevant peptides but also virus proteins as demonstrated in ELISA and Western blot (data not shown). In addition, neutralizing epitopes as MAP stimulated a neutralizing response against SIVmac (Fig. 1) in at least one monkey. Although the V2 and V4 domains are known neutralizing epitopes (Schlienger et al., 1994 ; Torres et al., 1993 ), in this study they did not seem to play a major role in the neutralization of SIVmac. Although all animals developed strong neutralizing activity against SIVmac by the third week after virus challenge (Fig. 1) many developed no or low titre antibodies specific for the V2 and/or V4 peptides.
The SIV-specific antibody response after virus challenge was very complex, differing from monkey to monkey. Sera from rhesus macaque 67, which had a reduced virus load, were very reactive against some viral peptides and proteins. In addition, this monkey developed soon after challenge a reaction against gp130 in Western blot (data not shown). However, two of the best responders in terms of anti-gp140 antibodies, Rh 80 and Rh 88, had low and high virus loads respectively after challenge (Fig. 2). This indicates that antibodies against the envelope protein were not by themselves responsible for a reduction in virus load although possibly the neutralizing antibodies which were induced by immunization in rhesus macaque 80 (Fig. 1) played a part in reducing the subsequent load.
In comparison to the induction of CTL in mice (Defoort et al., 1992 ; Deres et al., 1989 ; Nardelli et al., 1992 ; Schild et al., 1991 ) the P3CSS-peptides alone did not perform as well in the rhesus monkeys, with p11-specific CTL detectable in only one monkey at one time-point (Table 2). However, after using the mineral oil adjuvant Montanide ISA 51 in conjunction with the P3CSS-peptides, p11-specific CTL could be demonstrated at one or more time-points prior to challenge in five out of six Mamu-A*01-positive rhesus monkeys (Table 2). It would therefore appear that whereas P3CSS modification is sufficient to induce CTL in mice, a stronger adjuvant' is needed for CTL induction in rhesus monkeys.
Of the four CTL epitopes used as immunogen it was only possible to induce a response to the p11 peptide of SIVmac Gag. This is almost certainly because the remaining three epitopes are not restricted by Mamu-A*01, as shown by the lack of CTL against these epitopes even after infection.
In four of the five immunized Mamu-A*01-positive macaques the p11-specific CTL activity was quickly boosted after infection and active CTLp were readily detectable in the LDA at 1 week post-challenge (Fig. 4A). This apparent anamnestic CTL response was not seen in the control animals which first became positive at 2 weeks post-challenge. The levels of p11-specific CTLp in circulation reached levels in some animals which had never previously been observed in SIV (or HIV) infection (up to 5% of the total PBMC). Such levels were at the time considered unlikely and raised questions about the validity of the limiting dilution CTL assay used. Since then, others have shown levels of CTL approaching these values (Borrow et al., 1997 ) and in particular the development of tetramer technology has made it clear that the frequency of virus-specific CTLp in circulation is much higher than was previously thought (Jordan et al., 1999 ; Kuroda et al., 1998 , 1999 ). Upon re-examining frozen PBMC for peptide-specific cells using tetramer staining, the high frequencies could indeed be confirmed, with up to 25% of all CD8+ T-cells binding the Mamu-A*01/p11C,C→M tetrameric complex. These are amongst the highest reported levels of tetramer-positive cells, with Jordan et al. (1999) , for example, finding up to 22% Mamu-A*01/p11C,C→M tetramer-positive CD8+ T-cells in the semen of SIV-infected macaques. Comparing the percentage of CD8+ T-cells binding the tetrameric complexes with the percentage of CD8+ T-cells with functional CTLp activity (calculated from CTLp frequency and percentage CD8+ cells) yielded only a 1- to 10-fold difference for tetramer-positive cells, which is in closer agreement than the average 24-fold difference observed by others (Tan et al., 1999 ).
Using tetramer technology it was also possible to detect Mamu-A*01/p11C,C→M-specific cells in some animals (Rh 67, Rh 80 and Rh 84) on the day of challenge, albeit at low levels (0·140·23%; data not shown). Others have been unable to detect Mamu-A*01/p11C,C→M tetramer staining in fresh PBMC after two DNA immunizations (Hanke et al., 1999 ) or after one immunization with recombinant MVA in most of their animals (Seth et al., 1998 ). This suggests that the vaccine regimen used in this study was indeed able to efficiently prime CTLs, allowing the animals to react with a strong anamnestic immune response upon infection with SIV. More recently, pre-challenge levels of over 1% tetramer-positive cells have been achieved by SIV gag DNA vaccination in combination with IL-2/Ig plasmid or protein (Barouch et al., 2000 ). Indeed, post-challenge levels in these animals reached as high as 40% and, more significantly, animals were protected from high virus loads and disease.
Although all immunized animals in this study were shown to be productively infected with SIVmac after challenge, three of the five Mamu-A*01-positive immunized animals (Rh 67, 84 and 80) yielded peak cell-associated virus loads 10-fold lower than the non-immunized macaques (Fig. 2). Interestingly, it was in these three monkeys that tetramer-positive cells were detected prior to challenge. Moreover, it was possible to show an inverse correlation between the cell-associated virus load and the frequency of p11-specific CTL soon after the infection (Fig. 5A), indicating a role for the CTL in controlling the number of infected cells during this phase. A similar inverse correlation between the levels of circulating CTL induced by an attenuated virus vaccine and the cell-associated virus load following challenge with wild-type SIVmac had been reported as early as 1995 (Gallimore et al., 1995 ). However, as with all vaccine studies which do not achieve sterilizing immunity, it is not possible in the study presented here to conclude with certainty that the correlation between CTLs and the reduction in the number of infected cells is directly the result of the immunizations, although the high frequencies observed in animal 67 and 80 (LDA and tetramer) are normally not observed in the PBMC of naive animals after challenge (Kuroda et al., 1998 ).
Given the correlation with infected cell numbers, the lack of correlation between the levels of CTLp and the plasma virus load as measured by RTPCR is interesting. It is possible that the circulating CTLp were able to recognize and eliminate those infected cells which were also in circulation but not the infected cells present in the gastrointestinal tract, the main reservoir for SIV replication (Veazey et al., 1998 ). Indeed, it appears that CTL induced systemically are less likely to migrate to mucosal tissues (Eo et al., 2001 ; Gallichan & Rosenthal, 1996 ). Irregardless of whether the very high levels of post-challenge CTLp in some animals were the consequence of peptide immunization or not, these cells were apparently unable to influence the plasma virus load. Indeed, the two non-immunized control animals appeared to control the virus more efficiently than those immunized with the lipopeptides. It is therefore possible that peptide immunization had the effect of focusing the post-challenge CTL response on a single dominant epitope (p11C,C→M) to the detriment of other epitopes in Gag (or elsewhere). If such a focused response is less efficient at controlling virus production than a weaker but broader response, then monoepitopic immunogens would have to be used and analysed with caution.
In conclusion, the results presented here show that by peptide immunization it was possible to induce humoral and CTL immune responses against SIVmac which were quickly boosted upon challenge. Two animals had remarkably high CTLp frequencies of 1:20 and 1:250 total PBMC. These two animals also had the highest Mamu-A*01/p11C,C→M tetramer staining values (25·4% and 19·5% of their CD8+ T-cells). The inverse correlation between the CTLp frequency (as measured by both functional CTLp limiting dilution assay and Mamu-A*01/p11C,C→M tetramer staining) and the peripheral cell-associated virus load indicates that the p11-specific CTL might have played a role in limiting the initial spread of virus. However, the apparent failure of high frequencies of epitope-specific CTLp to reduce plasma RNA levels may indicate that a broader response is required. Since the study was started the number of CTL epitopes with known MHC class I restriction element has dramatically increased (Allen et al., 2001 ; Evans et al., 1999 , 2000 ) and it is possible that the use of peptides representing multiple CTL epitopes in macaques expressing appropriate MHC class I molecules would be more effective, particularly if used in conjunction with strong adjuvants and the concurrent stimulation of T-help. Although the relatively weak antiviral responses achieved before challenge suggests that peptide immunogens alone would have limited use as a vaccine, the use of lipopeptides to specifically boost responses induced by priming with live recombinant vectors or DNA vaccines certainly merits further investigation.
This work was supported by contract no. 1506/TG04 to R.K. from the Federal Ministry of Health. D.I.W is an Elizabeth Glaser Scientist.We would like to thank Nicole Norley, Manuela Schütze and Anne Reckziegel for their excellent technical assistance. We would also like to thank Program EVA for donating many of the reagents used in this study.
References
Aichele, P., Hengartner, H., Zinkernagel, R. M. & Schulz, M. (1990). Antiviral cytotoxic T-cell response induced by in vivo priming with a free synthetic peptide. Journal of Experimental Medicine 171, 1815-1820.
Aliprantis, A. O., Yang, R. B., Mark, M. R., Suggett, S., Devaux, B., Radolf, J. D., Klimpel, G. R., Godowski, P. & Zychlinsky, A. (1999). Cell activation and apoptosis by bacterial lipoproteins through toll-like receptor-2. Science 285, 736-739.
Allen, T. M., Mothe, B. R., Sidney, J., Jing, P., Dzuris, J. L., Liebl, M. E., Vogel, T. U., O'Connor, D. H., Wang, X., Wussow, M. C., Thomson, J. A., Altman, J. D., Watkins, D. I. & Sette, A. (2001). CD8+ lymphocytes from simian immunodeficiency virus-infected rhesus macaques recognize 14 different epitopes bound by the major histocompatibility complex class I molecule mamu-A*01: implications for vaccine design and testing. Journal of Virology 75, 738-749.
Allen, T. M., Sidney, J., del Guercio, M. F., Glickman, R. L., Lensmeyer, G. L., Wiebe, D. A., DeMars, R., Pauza, C. D., Johnson, R. P., Sette, A. & Watkins, D. I. (1998). Characterization of the peptide binding motif of a rhesus MHC class I molecule (Mamu-A*01) that binds an immunodominant CTL epitope from simian immunodeficiency virus. Journal of Immunology 160, 6062-6071.
Altman, J. D., Moss, P. A. H., Goulder, P. J. R., Barouch, D. H., McHeyzer-Williams, M. G., Bell, J. I., McMichael, A. J. & Davis, M. M. (1996). Phenotypic analysis of antigen-specific T lymphocytes. Science 274, 94-96.
Barouch, D. H., Santra, S., Schmitz, J. E., Kuroda, M. J., Fu, T. M., Wagner, W., Bilska, M., Craiu, A., Zheng, X. X., Krivulka, G. R., Beaudry, K., Lifton, M. A., Nickerson, C. E., Trigona, W. L., Punt, K., Freed, D. C., Guan, L., Dubey, S., Casimiro, D., Simon, A., Davies, M. E., Chastain, M., Strom, T. B., Gelman, R. S., Montefiori, D. C., Lewis, M. G., Emini, E. A., Shiver, J. W. & Letvin, N. (2000). Control of viremia and prevention of clinical AIDS in rhesus monkeys by cytokine-augmented DNA vaccination. Science 290, 486-492.
Benichou, S., Legrand, R., Nakagawa, N., Faure, T., Traincard, F., Vogt, G., Dormont, D., Tiollais, P., Kieny, M. P. & Madaule, P. (1992). Identification of a neutralizing domain in the external envelope glycoprotein of simian immunodeficiency virus. AIDS Research and Human Retroviruses 8, 1165-1170.[Medline]
BenMohamed, L., Gras-Masse, H., Tartar, A., Daubersies, P., Brahimi, K., Bossus, M., Thomas, A. & Druilhe, P. (1997). Lipopeptide immunization without adjuvant induces potent and long- lasting B, T helper, and cytotoxic T lymphocyte responses against a malaria liver stage antigen in mice and chimpanzees. European Journal of Immunology 27, 1242-1253.[Medline]
Beretta, A., Grassi, F., Pelagi, M., Clivio, A., Parravicini, C., Giovinazzo, G., Andronico, F., Lopalco, L., Verani, P., Butto, S., Titti, F., Rossi, G. B., Viale, G., Ginelli, E. & Siccardi, A. G. (1987). HIV env glycoprotein shares a cross-reacting epitope with a surface protein present on activated human monocytes and involved in antigen presentation. European Journal of Immunology 17, 1793-1798.[Medline]
Borrow, P., Lewicki, H., Wei, X., Horwitz, M. S., Peffer, N., Meyers, H., Nelson, J. A., Gairin, J. E., Hahn, B. H., Oldstone, M. B. & Shaw, G. M. (1997). Antiviral pressure exerted by HIV-1-specific cytotoxic T lymphocytes (CTLs) during primary infection demonstrated by rapid selection of CTL escape virus. Nature Medicine 3, 205-211.[Medline]
Bourgault, I., Venet, A. & Levy, J. P. (1992). Three epitopic peptides of the simian immunodeficiency virus Nef protein recognized by macaque cytolytic T lymphocytes. Journal of Virology 66, 750-756.
Brenneman, D. E., Westbrook, G. L., Fitzgerald, S. P., Ennist, D. L., Elkins, K. L., Ruff, M. R. & Pert, C. B. (1988). Neuronal cell killing by the envelope protein of HIV and its prevention by vasoactive intestinal peptide. Nature 335, 639-642.[Medline]
Defoort, J. P., Nardelli, B., Huang, W., Ho, D. D. & Tam, J. P. (1992). Macromolecular assemblage in the design of a synthetic AIDS vaccine. Proceedings of the National Academy of Sciences, USA 89, 3879-3883.
Deres, K., Schild, H., Wiesmueller, K. H., Jung, G. & Rammensee, H. G. (1989). In vivo priming of virus-specific cytotoxic T lymphocytes with synthetic lipopeptide vaccine. Nature 342, 561-564.[Medline]
Donnenberg, A. D., Margolick, J. B. & Polk, B. F. (1989). Limiting dilution analysis of in vivo-activated (IL-2 responsive) peripheral blood lymphocytes in HIV-1-infected subjects. Clinical Immunology and Immunopathology 51, 91-98.[Medline]
Eo, S. K., Gierynska, M., Kamar, A. A. & Rouse, B. T. (2001). Prime-boost immunization with DNA vaccine: mucosal route of administration changes the rules. Journal of Immunology 166, 5473-5479.
Evans, D. T., OConnor, D. H., Jing, P., Dzuris, J. L., Sydney, J., DaSilva, J., Allen, T. M., Horton, H., Venham, J. E., Rudersdorf, A., Vogel, T., Pauza, C. D., Bontrop, R. E., DeMars, R., Sette, A., Hughes, A. L. & Watkins, D. I. (1999). Virus-specific cytotoxic T-lymphocyte responses select for amino acid variation in SIV Env and Nef. Nature Medicine 5, 1270-1276.[Medline]
Evans, D. T., Jing, P., Allen, T. M., OConnor, D. H., Horton, H., Venham, J. E., Piekarczyk, M., Dzuris, J., Dykhuzen, M., Mitchen, J., Rudersdorf, R. A., Pauza, C. D., Sette, A., Bontrop, R. E., DeMars, R. & Watkins, D. I. (2000). Definition of five new simian immunodeficiency virus cytotoxic T-lymphocyte epitopes and their restricting major histocompatibility complex class I molecules: evidence for an influence on disease progression. Journal of Virology 74, 7400-7410.
Gallichan, W. S. & Rosenthal, K. L. (1996). Long-lived cytotoxic T lymphocyte memory in mucosal tissues after mucosal but not systemic immunization. Journal of Experimental Medicine 184, 1879-1890.
Gallimore, A., Cranage, M., Cook, N., Almond, N., Bootman, J., Rud, E., Silvera, P., Dennis, M., Corcoran, T., Stott, J., McMichael, A. & Gotch, F. (1995). Early suppression of SIV replication by CD8+ Nef-specific cytotoxic T cells in vaccinated macaques. Nature Medicine 1, 1167-1173.[Medline]
Hanke, T., Samuel, R. V., Blanchard, T. J., Neumann, V. C., Allen, T. M., Boyson, J. E., Sharpe, S. A., Cook, N., Smith, G. L., Watkins, D. I., Cranage, M. P. & McMichael, A. J. (1999). Effective induction of simian immunodeficiency virus-specific cytotoxic T lymphocytes in macaques by using a multiepitope gene and DNA prime- modified vaccinia virus Ankara boost vaccination regimen. Journal of Virology 73, 7524-7532.
Hart, M. K., Weinhold, K. J., Scearce, R. M., Washburn, E. M., Clark, C. A., Palker, T. J. & Haynes, B. F. (1991). Priming of anti-human immunodeficiency virus (HIV) CD8+ cytotoxic T cells in vivo by carrier-free HIV synthetic peptides. Proceedings of the National Academy of Sciences, USA 88, 9448-9452.
Jordan, H. L., Kuroda, M. J., Schmitz, J. E., Steenbeke, T., Forman, M. A. & Letvin, N. L. (1999). Detection of simian immunodeficiency virus Gag-specific CD8+ T lymphocytes in semen of chronically infected rhesus monkeys by cell staining with a tetrameric major histocompatibility complex class I- peptide complex. Journal of Virology 73, 4508-4512.
Kast, W. M., Roux, L., Curren, J., Blom, H. J. J., Voordouw, A. C., Meloen, R. H., Kolakofsky, D. & Melief, J. M. (1991). Protection against lethal Sendai virus infection by in vivo priming of virus-specific cytotoxic T lymphocytes with a free synthetic peptide. Proceedings of the National Academy of Sciences, USA 88, 2283-2287.
Kent, K. A., Rud, E., Corcoran, T., Powell, C., Thiriart, C., Collignon, C. & Stott, E. J. (1992). Identification of two neutralizing and 8 non-neutralizing epitopes on simian immunodeficiency virus envelope using monoclonal antibodies. AIDS Research and Human Retroviruses 8, 1147-1151.[Medline]
Kuroda, M. J., Schmitz, J. E., Barouch, D. H., Craiu, A., Allen, T. M., Sette, A., Watkins, D. I., Forman, M. A. & Letvin, N. L. (1998). Analysis of Gag-specific cytotoxic T lymphocytes in simian immunodeficiency virus-infected rhesus monkeys by cell staining with a tetrameric major histocompatibility complex class Ipeptide complex. Journal of Experimental Medicine 187, 1373-1381.
Kuroda, M. J., Schmitz, J. E., Charini, W. A., Nickerson, C. E., Lord, C. I., Forman, M. A. & Letvin, N. L. (1999). Comparative analysis of cytotoxic T lymphocytes in lymph nodes and peripheral blood of simian immunodeficiency virus-infected rhesus monkeys. Journal of Virology 73, 1573-1579.
Lex, A., Wiesmueller, K. H., Jung, G. & Bessler, W. G. (1986). A synthetic analogue of Escherichia coli lipoprotein, tripalmitoyl pentapeptide, constitutes a potent immune adjuvant. Journal of Immunology 137, 2676-2681.[Abstract]
Livingston, B. D., Crimi, C., Grey, H., Ishioka, G., Chisari, F. V., Fikes, J., Chesnut, R. W. & Sette, A. (1997). The hepatitis B virus-specific CTL responses induced in humans by lipopeptide vaccination are comparable to those elicited by acute viral infection. Journal of Immunology 159, 1383-1392.[Abstract]
Miller, M. D., Yamamoto, H., Hughes, A. L., Watkins, D. I. & Letvin, N. L. (1991). Definition of an epitope and MHC class I molecule recognized by Gag-specific cytotoxic T lymphocytes in SIVmac-infected rhesus monkeys. Journal of Immunology 147, 320-329.[Abstract]
Mortara, L., Gras-Masse, H., Rommens, C., Venet, A., Guillet, J. G. & Bourgault-Villada, I. (1999). Type 1 CD4+ T-cell help is required for induction of antipeptide multispecific cytotoxic T lymphocytes by a lipopeptidic vaccine in rhesus macaques. Journal of Virology 73, 4447-4451.
Nardelli, B., Lu, Y. A., Shiu, D. R., Delpierre-Defoort, C., Profy, A. T. & Tam, J. P. (1992). A chemically defined synthetic vaccine model for HIV-1. Journal of Immunology 148, 914-920.[Abstract]
Norley, S. G. & Kurth, R. (1996). AIDS vaccination. In Concepts in Vaccine Development , pp. 353-558. Edited by S. H. E. Kaufmann. Berlin & New York:Walter de Gruyter.
Norley, S. G., Löwer, J. & Kurth, R. (1993). Insufficient inactivation of HIV-1 in human cryo poor plasma by β-propriolactone: results from a highly accurate virus detection method. Biologicals 21, 251-258.[Medline]
Posnett, D. N., McGrath, H. & Tam, J. P. (1988). A novel method for producing anti-peptide antibodies. Production of site-specific antibodies to the T cell antigen receptor beta-chain. Journal of Biological Chemistry 263, 1719-1725.
Prass, W., Ringsdorf, H., Bessler, W., Wiesmüller, K. H. & Jung, G. (1987). Lipopeptides of the N-terminus of Escherichia coli lipoprotein: synthesis, mitogenicity and properties in monolayer experiments. Biochimica et Biophysica Acta 900, 116-128.[Medline]
Reiher, W. E., Blalock, J. E. & Brunck, T. K. (1986). Sequence homology between acquired immunodeficiency syndrome virus envelope protein and interleukin 2. Proceedings of the National Academy of Sciences, USA 83, 9188-9192.
Robinson, W. E., Montefiori, D. C. & Mitchell, W. M. (1987). A human immunodeficiency virus type 1 (HIV-1) infection-enhancing factor in seropositive sera. Biochemical and Biophysical Research Communications 149, 693-699.[Medline]
Robinson, W. E., Kawamura, T., Lake, D., Masuho, Y., Mitchell, W. M. & Hersh, E. M. (1990). Antibodies to the primary immunodominant domain of human immunodeficiency virus type 1 (HIV-1) glycoprotein gp41 enhance HIV-1 infection in vitro. Journal of Virology 64, 5301-5305.
Saiki, R. K., Gelfand, D. H., Stoffel, S., Scharf, S. J., Higuchi, R., Horn, G. T., Mullis, K. B. & Erlich, H. A. (1988). Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science 239, 487-491.
Sastry, K. J., Nehete, P. N., Venkatnarayanan, S., Morkowski, J., Platsoucas, C. D. & Arlinghaus, R. B. (1992). Rapid in vivo induction of HIV-specific CD8+ cytotoxic T lymphocytes by a 15-amino acid unmodified free peptide from the immunodominant V3-loop of GP120. Virology 188, 502-509.[Medline]
Schild, H., Deres, K., Wiesmueller, K. H., Jung, G. & Rammensee, H. G. (1991). Efficiency of peptides and lipopeptides for in vivo priming of virus-specific cytotoxic T cells. European Journal of Immunology 21, 2649-2654.[Medline]
Schlienger, K., Montefiori, D. C., Mancini, M., Riviere, Y., Tiollais, P. & Michel, M. L. (1994). Vaccine-induced neutralizing antibodies directed in part to the simian immunodeficiency virus (SIV) V2 domain were unable to protect rhesus monkeys from SIV experimental challenge. Journal of Virology 68, 6578-6588.
Seth, A., Ourmanov, I., Kuroda, M. J., Schmitz, J. E., Carroll, M. W., Wyatt, L. S., Moss, B., Forman, M. A., Hirsch, V. M. & Letvin, N. L. (1998). Recombinant modified vaccinia virus Ankara-simian immunodeficiency virus gag pol elicits cytotoxic T lymphocytes in rhesus monkeys detected by a major histocompatibility complex class I/peptide tetramer. Proceedings of the National Academy of Sciences, USA 95, 10112-10116.
Tam, J. P. (1988). Synthetic peptide vaccine design: synthesis and properties of a high-density multiple antigenic peptide system. Proceedings of the National Academy of Sciences, USA 85, 5409-5413.
Tan, L. C., Gudgeon, N., Annels, N. E., Hansasuta, P., OCallaghan, C. A., Rowland-Jones, S., McMichael, A. J., Rickinson, A. B. & Callan, M. F. (1999). A re-evaluation of the frequency of CD8+ T cells specific for EBV in healthy virus carriers. Journal of Immunology 162, 1827-1835.
Torres, J. V., Malley, A., Banapour, B., Anderson, D. E., Axthelm, M. K., Gardner, M. B. & Benjamini, E. (1993). An epitope on the surface envelope glycoprotein (gp130) of simian immunodeficiency virus (SIVmac) involved in viral neutralization and T cell activation. AIDS Research and Human Retroviruses 9, 423-430.[Medline]
Troalen, F., Razafindratsita, A., Puisieux, A., Voeltzel, T., Bohuon, C., Bellet, D. & Bidart, J. M. (1990). Structural probing of human lutropin using antibodies raised against synthetic peptides constructed by classical and multiple antigen peptide system approaches. Molecular Immunology 27, 363.[Medline]
Veazey, R. S., DeMaria, M., Chalifoux, L. V., Shvetz, D. E., Pauley, D. R., Knight, H. L., Rosenzweig, M., Johnson, R. P., Desrosiers, R. C. & Lackner, A. A. (1998). Gastrointestinal tract as a major site of CD4+ T cell depletion and viral replication in SIV infection. Science 280, 427-431.
Vega, M. A., Guigo, R. & Smith, T. F. (1990). Autoimmune response in AIDS. Nature 345, 26.[Medline]
Vitiello, A., Ishioka, G., Grey, H. M., Rose, R., Farness, P., LaFond, R., Yuan, L., Chisari, F. V., Furze, J., Bartholomeuz, R. and others (1995). Development of a lipopeptide-based therapeutic vaccine to treat chronic HBV infection. I. Induction of a primary cytotoxic T lymphocyte response in humans. Journal of Clinical Investigation 95, 341349.
Vogel, T., Kurth, R. & Norley, S. (1994). The majority of neutralizing Abs in HIV-1-infected patients recognize linear V3 loop sequences. Studies using HIV-1MN multiple antigenic peptides. Journal of Immunology 153, 1895-1904.[Abstract]
Vogel, T., Norley, S., Beer, B. & Kurth, R. (1995). Rapid screening for Mamu-A1-positive rhesus macaques using a SIVmac Gag peptide-specific cytotoxic T-lymphocyte assay. Immunology 84, 482-487.[Medline]
Wang, C. Y., Looney, D. J., Li, M. L., Walfield, A. M., Ye, J., Hosein, B., Tam, J. P. & Wong-Staal, F. (1991). Long-term high-titer neutralizing activity induced by octameric synthetic HIV-1 antigen. Science 254, 285-288.
Watanari, E., Dietzchold, B., Szokan, G. & Herber-Katz, E. (1987). A synthetic peptide induces long-term protection from lethal infection with herpes simplex virus 2. Journal of Experimental Medicine 165, 459-470.
Watkins, D. I., Kannagi, M., Stone, M. E. & Letvin, N. L. (1988). Major histocompatibility complex class I molecules of nonhuman primates. European Journal of Immunology 18, 1425-1432.[Medline]
Wiesmüller, K. H., Bessler, W. & Jung, G. (1983). Synthesis of the mitogenic S-{2,3-Bis(palmitoyloxy)propyl}-N-palmitoylpentapeptide from E. coli lipoprotein. Hoppe-Seylers Zeitschrift fuer Physiologische Chemie 364, 593-606.
Yamamoto, H., Miller, M. D., Tsubota, H., Watkins, D. I., Mazzara, G. P., Stallard, V., Panicali, D. L., Aldovini, A., Young, R. A. & Letvin, N. L. (1990). Studies of cloned simian immunodeficiency virus-specific T lymphocytes. Gag-specific cytotoxic T lymphocytes exhibit a restricted epitope specificity. Journal of Immunology 144, 3385-3391.[Abstract]
Young, J. A. (1988). HIV and HLA similarity. Nature 333, 215.
Received 27 June 2001; accepted 24 September 2001.