Research Article

Genomic and phylogenetic analyses of an adenovirus isolated from a corn snake (Elaphe guttata) imply a common origin with members of the proposed new genus Atadenovirus

Journal of General Virology 2002; 83(10):2403

PubMed

With thanks to our partners for supporting this archive.

Abstract

Approximately 60% of the genome of an adenovirus isolated from a corn snake (Elaphe guttata) was cloned and sequenced. The results of homology searches showed that the genes of the corn snake adenovirus (SnAdV-1) were closest to their counterparts in members of the recently proposed new genus Atadenovirus. In phylogenetic analyses of the complete hexon and protease genes, SnAdV-1 indeed clustered together with the atadenoviruses. The characteristic features in the genome organization of SnAdV-1 included the presence of a gene homologous to that for protein p32K, the lack of structural proteins V and IX and the absence of homologues of the E1A and E3 regions. These characteristics are in accordance with the genus-defining markers of atadenoviruses. Comparison of the cleavage sites of the viral protease in core protein pVII also confirmed SnAdV-1 as a candidate member of the genus Atadenovirus. Thus, the hypothesis on the possible reptilian origin of atadenoviruses (Harrach, Acta Veterinaria Hungarica 48, 484490, 2000) seems to be supported. However, the base composition of DNA sequence (>18 kb) determined from the SnAdV-1 genome showed an equilibrated GC content of 51%, which is unusual for an atadenovirus.
Adenoviruses occur worldwide and have been demonstrated in every class of the subphylum Vertebrata (Russell & Benk, 1999 ). The adenoviruses isolated from mammals and especially those from humans are well characterized. The genomes of several adenoviruses originating from birds (Chiocca et al., 1996 ; Hess et al., 1997 ; Pitcovski et al., 1998 ; Ojkic & Nagy, 2000 ) and a single frog isolate (Davison et al., 2000 ) have also been fully sequenced. However, there are no molecular data concerning the genome structure of reptilian adenoviruses, although the frequency of reports on the occurrence of adenoviruses in reptiles is increasing, obviously due to the growing popularity of reptiles as pets (Essbauer & Ahne, 2001 ).

Adenovirus infections have been detected by examination by light and electron microscopy of histopathological sections in different species of Reptilia, including Nile crocodile (Crocodylus niloticus) (Jacobson et al., 1984 ), savannah monitor (Varanus exanthematicus) (Jacobson & Kollias, 1986 ), Jacksons chameleon (Chamaeleo jacksoni) (Jacobson & Gardiner, 1990 ), Rankins dragon lizard (Pogona henrylawsoni) (Frye et al., 1994 ), rosy boa (Lichanura trivirgata) (Schumacher et al., 1994 ), bearded dragon (Pogona vitticeps) (Jacobson et al., 1996 ) and mountain chameleon (Chameleo montium) (Kinsel et al., 1997 ). Recently, the presence of adenoviral DNA in liver sections from a boa constrictor (Boa constrictor) and intestinal tract samples from a Mojave rattlesnake (Crotalus scutulatus scutulatus) was confirmed by in situ hybridization (Ramis et al., 2000 ; Perkins et al., 2001 ). The sequence of the oligonucleotides used as labelled probes was taken from the penton gene of fowl adenovirus type 10 (Sheppard & Trist, 1992 ).

In spite of the seemingly growing incidence and interest in the diagnosis of diseases attributed to adenovirus infection in reptiles, there are very few cases in which the virus was successfully isolated. Jacobson et al. (1985) obtained adenovirus from a boa constrictor (Boa constrictor) and W. Ahne and his co-workers isolated an adenovirus strain from a royal python (Python regius) (Ogawa et al., 1992 ) and from a moribund corn snake (Elaphe guttata) showing clinical signs of pneumonia (Juhasz & Ahne, 1992 ). The physico-chemical properties and cytopathogenicity of this latter virus were also determined (Juhasz & Ahne, 1992 ). The purpose of our study was to obtain genomic sequence data from the corn snake adenovirus (SnAdV-1) in order to characterize its genome and to determine the phylogenetic relationship between SnAdV-1 and other adenoviruses.

Virus purification and cloning.
Adenovirus strain 145/88 was propagated in VH-2 (Russells viper heart) cell culture (Juhasz & Ahne, 1992 ) and concentrated by ultracentrifugation. The quantity of DNA extracted from the virions was not sufficient for physical mapping; therefore, random cloning of the virus genome was initiated with the use of PstI and SmaI restriction enzymes. The fragments were cloned and then subcloned into the phagemid pBluescript II KS (Stratagene) for nucleotide sequence determination.

DNA sequencing.
The clones were purified with the Concert Rapid Plasmid Miniprep System (GibcoBRL) and sequenced by following the PRISM Ready Reaction Dye Deoxy Cycle sequencing protocol (Perkin Elmer) on an ABI 373A automated DNA sequencer (Applied Biosystems) using T3, T7, M13-20 and M13 Reverse primers. The sequences were read with the Applied Biosystems 373A DNA Sequencer Data Analysis Program and were processed by the program LASERGENE (DNASTAR). The genes encoded by the sequences were identified by the BLAST homology search program (Altschul et al., 1990 ) and compared with the non-redundant NCBI database or our own database of adenovirus sequences (http://www.vmri.hu/blast.htm).

PCR.
PCR amplification of the missing parts of genome sequence between previously sequenced and identified fragments was attempted with primers designed on the basis of known sequences and checked with the program PRIMER DESIGNER version 2.0 (Scientific and Educational Software). Two primers that gave a successful amplification between two PstI clones were 23 nucleotides (nt) long and had the following sequences: forward, 5 GAGAGTAGTAGCTCCACCTGAAG 3; reverse, 5 ATGATGAGCCGGAGACGGAGCCT 3. The PCR product was cut with PstI enzyme and also cloned into the pBluescript II KS phagemid.

Phylogenetic analyses.
For phylogenetic analyses, the hexon and protease genes were chosen. Multiple alignments of 39 hexon and 33 protease amino acid (aa) sequences were carried out with the MULTALIN computer program (Corpet, 1988 ). Since only homologous residues can be used in phylogenetic calculations (Harrach & Benk, 1998 ), the highly variable regions were removed from both genes leaving 781 and 202 aa in the hexon and protease alignments respectively. Phylogenetic trees were constructed with the programs included in the PHYLIP (Phylogeny Inference Package, version 3.572c) program package (Felsenstein, 1989 ). For distance matrix analysis, the aligned sequences were processed first with PROTDIST (Dayhoffs PAM 001 scoring matrix) and then with the FITCH program (global rearrangements). For bootstrap analysis, the SEQBOOT program was run before PROTDIST and FITCH. The most probable tree was calculated with the CONSENSE program. The trees were visualized by the TREEVIEW program (Page, 1996 ).

Genome size and organization
The inner part of the randomly cloned SnAdV-1 genome sequence was assembled; however, the two ends and a fragment (probably larger) from the right-hand side are missing. Since the BLAST homology search results most frequently showed the duck adenovirus 1 (DAdV-1) [syn. egg drop syndrome (EDS) virus] genes as closest relatives of the SnAdV-1 counterparts, the putative physical and genetic map presented in Fig. 1 was compared to the DAdV-1 genome. A fragment of approximately 1700 bp, located close to the left-hand end between the IVa2 protein and DNA polymerase genes and not obtained in the random cloning, was successfully amplified by PCR. The genes of the following known adenoviral proteins were identified by using the BLAST homology search program (Altschul et al., 1990 ): IVa2, DNA polymerase, terminal protein precursor (pTP), 52K, pIIIa, protein III, pVII, pX, pVI, hexon, protease, DNA-binding protein (DBP), 100K, pVIII and fibre. The estimated relative position of these SnAdV-1 genes corresponded to that in other adenoviruses.



(17K):

Fig. 1. Cloning strategy and putative genome organization of SnAdV-1 isolated from a corn snake compared to that of DAdV-1. A fragment missed by the random cloning between two PstI clones was amplified by PCR and cloned.

On the left-hand end of the sequenced genome part, a homologue of the p32K gene (Khatri & Both, 1998 ) was identified on the l (leftward-transcribed) strand. This gene encodes a structural protein first described as p28K (Vrati et al., 1996 ) from ovine adenovirus isolate 287 (OAV287) (Boyle et al., 1994 ). The exact size of the precursor protein was later determined to be 32·1 kDa and this protein is now designated p32K (Both, 2002 ). A homologue of p32K, referred to as p24K, was also identified in DAdV-1 (Hess et al., 1997 ). To our present knowledge, protein p32K (on the left-hand end of the genome) exists only in members of the proposed genus Atadenovirus; thus, PCR using primers designed to detect this characteristic gene will give specific diagnostic information about the presence of atadenoviruses (Péter Él, unpublished results). Although the function or exact location of the processed p32K in the virion is not yet known, its hypothetical DNA-binding and/or packaging function is supported by several facts. Firstly, from looking at conserved amino acid patterns, a degree of homology could be detected between the C terminus of p32K proteins and the so-called small acid-soluble proteins (SASPs) of certain bacteria (Péter Él, unpublished results). SASPs play an important role in spore formation in certain bacteria. Secondly, as discussed below, no homologues of protein V exist in atadenoviruses; thus, the essential role of protein V in stabilizing the viral DNA in the capsid and in trafficking it after uncoating to the nucleus should be fulfilled by another protein. The p32K protein is a likely candidate for such a function, since a bipartite nuclear localization signal typical of certain adenoviral core proteins (Dingwall & Laskey, 1991 ; Russell & Kemp, 1995 ) is also present in every p32K amino acid sequence studied so far. The left-terminal genome fragment supposedly containing the C-terminal end of the p32K homologue gene of SnAdV-1 could not be cloned, however. Thus the full size of this gene has not been determined either.

The sequence of a 5922 bp genome fragment encompassing the complete genes of pVII, pX, pVI, hexon, protease and DBP was fully determined, deposited in GenBank and analysed in detail. The putative hexon and protease genes of SnAdV-1 consisted of 2730 and 606 nt encoding 909 and 201 aa residues respectively. The presence of the gene for structural protein V was excluded based on the results of sequence analysis and homology searches. The protein V gene is normally located between the genes for pVII and pX, but in SnAdV-1 the distance between the stop codon of pVII and the first methionine of pX was only 19 nt. In mastadenoviruses, protein IX is encoded by the r (rightward-transcribed) strand immediately after the E1B region, but no homologous gene could be identified in SnAdV-1 (data not shown). Apparently, the presence of these genes (of proteins V and IX) is exclusively characteristic of members of the genus Mastadenovirus.

In mastadenoviruses, the E3 region is located between the genes for the pVIII and fibre proteins. In our SnAdV-1 sequence, similarly to atadenoviruses (Vrati et al., 1995 ), no homologues of any E3 genes could be identified at this location or in any ORF on the r strand. However, on the complementary l strand, the presence of the U exon was confirmed based on its homology with the corresponding region of OAV287 and DAdV-1. The role of the U exon, which was originally described in human adenovirus 40 (HAdV-40) (Davison et al., 1993 ), is unknown, but it has been found in almost all adenovirus types examined so far. The sequence of the U exon seems to be well conserved in each genus, but shows large differences between the genera (Davison et al., 2000 ).

Phylogenetic analysis
For phylogenetic analyses, the hexon and protease genes were chosen, because the sequences of these genes were available for many adenovirus types from a large number of different hosts. The results of the distance matrix analysis on the amino acid sequences of these two genes are presented in Fig. 2(a, b). Four clearly separated groups could be distinguished on both trees. This result was supported by maximal (100%) bootstrap values in the case of the longer, and therefore more reliable, hexon gene, while the tree for the protease gene was characterized by slightly lower (83100%) bootstrap values. Interestingly, while the two clusters corresponding to the two genera (Mastadenovirus and Aviadenovirus) consist exclusively of adenovirus types isolated from mammals or birds, respectively, the other two clusters comprise viruses from a variety of hosts. It is tempting to hypothesize that this variety resulted from several host switches of the adenoviruses.



(24K):

Fig. 2. Unrooted phylogenetic trees of 39 hexon (a) and 33 protease (b) sequences showing the clustering of atadenoviruses and their distinctness from mastadenoviruses, aviadenoviruses and siadenoviruses. The length of the branches indicates the phylogenetic distance between the different viruses and the scale bar represents ten mutations per 100 sequence positions. The virus types constituting the separate genera are circled. Bootstrap values are given for 100 data sets, but not shown for human and simian adenoviruses. The bootstrap calculations have not confirmed the MAdV-1, EAdV-2 and PAdV-3 order on the protease tree (*). The order most often found was MAdV-1, PAdV-3 and EAdV-2 (with bootstrap values of 56 and 48 for the two latter nodes). Virus types are represented usually by the shortened forms of the ICTV abbreviations (Benk et al., 2000 ) containing the host designation and type number. Abbreviations of the adenovirus types: B, bovine; C, canine; D, duck; E, equine; F, fowl; Fr, frog; G, goat; M, murine; O, ovine; Od, odocoileus; P, porcine; S, simian; Sn, snake; Rus, bovine adenovirus strain Rus; and T, turkey. Human adenoviruses are marked by their serotype number only. The aligned sequences and the accession numbers in the GenBank or EMBO database are as follows. Complete genome sequences: B2, AF252854; B3, AF030154; B4, AF036092; C1, Y07760; C2, U77082; D1, Y09598; F1, U46933; F9, AF083975; Fr1, AF224336; H2, J01917; H5, M73260; H12, X73487; H17, AF108105; H40, L19443; M1, U95843; OAV287, U40837; P3, AF083132; P5, AF289262; S21, AR101858; S25, AF394196; and T3 (THEV), AF074946. Further hexon sequences: B5, AF207658; B6, AF207659; B7, AF238232; B8, AF238233; E1, L79955; E2, L80007; F10, U26220; G1, AF207660; H3, X76549; H4, AF065062; H7, X76551; H16, X74662; H19, AF161565, X98359, Y17250; H41, X51783; H48, U20821; Od1, AF198354; Rus strain, P. Él, unpublished; and Sn1, AY082603. Protease sequences are: B1, P. S. Evans, unpublished; B6, R. Szathmáry, unpublished; B7, X53989; B10, AF027599; E2, L80007; H3, X13271; H4, M16692; H41, M21163; O3, AF153447; O5, R. Szathmáry, unpublished; Rus strain, P. Él, unpublished; and Sn1, AY082603. The protease and hexon amino acid sequence alignment is available at http://www.vmri.hu/∼harrach.

The genus Siadenovirus (Davison & Harrach, 2002 ) comprises only two known members, an adenovirus isolate originating from leopard frog (Rana pipiens) (Clark et al., 1973 ; Davison et al., 2000 ) and the former group II aviadenovirus which causes different diseases (haemorrhagic enteritis, marble spleen disease, splenomegaly) in different bird species (turkey, pheasant, chicken) (Pierson & Domermuth, 1997 ; Pitcovski et al., 1998 ). This virus is referred to as THEV (or turkey adenovirus 3). There are as yet insufficient data to hand to draw reliable conclusions about the host origin of this genus.

In contrast the other new genus, Atadenovirus (Benk & Harrach, 1998 ), where SnAdV-1 is clustered, is already represented by numerous isolates. As well as the fully sequenced OAV287 (Vrati et al., 1996 ) and DAdV-1 (Hess et al., 1997 ), the adenovirus of a New Zealand marsupial animal, the brushtail possum (Trichosurus vulpecula) (Thomson et al., 2002 ), also fell into this cluster. Moreover, five of the ten accepted bovine adenovirus (BAdV) types (4 to 8), the particular features of which were recognized more than 30 years ago (Bartha, 1969 ), are candidate atadenoviruses (Benk et al., 2000 ). More recently, caprine adenovirus type 1, isolated in the United States (Lehmkuhl & Cutlip, 1999 ), and the adenovirus which caused a fatal epizooty among mule deer (Odocoileus hemionus) in California (Woods et al., 1996 ; Sorden et al., 2000 ), were also confirmed as candidate atadenoviruses (Lehmkuhl et al., 2001 ).

On both trees, SnAdV-1 formed the first bifurcation on the branch of atadenoviruses followed by DAdV-1. Similar tree topology was obtained with other (partial) genes (Benk et al., 2002 ), either with nucleotide or amino acid sequences (data not shown).

Intergenic distances and GC content
In the part of the SnAdV-1 genome examined, gene overlaps or short intergenic distances similar to those in the atadenoviruses were observed. For example, between the end of the hexon and the start of the protease gene, a 4 nt overlap is present in SnAdV-1. In the mastadenoviruses and aviadenoviruses examined so far there is a short distance between these two genes, while in OAV287, DAdV-1, BAdV-4 and BAdV-7 the two genes overlap by the same length (Dán et al., 1998 ; Harrach et al., 1997 ). The C-terminal part of the DBP coded on the l strand was also identified, and the distance between the putative stop codon of the DBP and the protease gene of SnAdV-1 was found to be 14 nt. The proteaseDBP distance is only 5, 7, 11 and 28 nt for BAdV-7, BAdV-4, DAdV-1 and OAV287, respectively, which is relatively short compared to the corresponding sequences in mastadenoviruses and aviadenoviruses.

The GC content of the SnAdV-1 hexon and protease genes was found to be 52% and 50%, respectively. The GC content for the genome sequence determined so far (more than 12 kbp) was 51·8% with an average, seemingly even distribution throughout the genome (approximately 10% variations). In contrast to SnAdV-1, the base composition of the genome of all atadenoviruses sequenced so far is heavily biased towards AT and their GC content ranges between 33·6% (OAV287) and 43·0% (DAdV-1). The reason for this difference is still unknown.

Protease cleavage sites
We have analysed in detail the sequence of the SnAdV-1 protease as well as several precursor proteins (pVII, pX, pVI) which are substrates for the protease. The active site of the adenoviral protease was first determined in HAdV-2 and found to be the H54E71C122 triad, similar to that in papain (Ding et al., 1996 ). In all other adenovirus serotypes examined so far, except for HAdV-5, the glutamic acid (E) is replaced by aspartic acid (D). By amino acid alignment, a similar putative active site (H55D72C122) of the protease of SnAdV-1 was identified. Interestingly, the P137 residue, which is highly conserved in mastadenoviruses and thought to be critical for protease encapsidation and activation (Rancourt et al., 1995 ), is missing in the studied aviadenoviruses (Chiocca et al., 1996 ; Ojkic & Nagy, 2000 ), atadenoviruses (Harrach et al., 1997 ; Barbezange et al., 2000 ) and in THEV (Pitcovski et al., 1998 ). However, it is present in frog adenovirus 1 (FrAdV-1) (Davison et al., 2000 ) and we have also found it in SnAdV-1. Another important conserved residue, C104, was also identified in the SnAdV-1 protease sequence. In HAdV-2, this residue forms a disulfide bond with C10 of the 11 aa cofactor, pVIc (cleaved by the protease from pVI), thus enhancing enzyme activity (Webster et al., 1993 ).

Adenoviral protease activity is absolutely required for the synthesis of infectious virions (Weber, 1995 ). Two consensus recognition sequences, (M/L/I)XGGX (type I) and (M/L/I)XGXG (type II), have been identified (Webster et al., 1989 ; Anderson, 1990 ) in the precursor protein substrates (pTP, pIIIa, pVII, pX, pVI and pVIII) of different human and mammalian adenoviruses. During the study of the unique genome arrangement and novel proteins of OAV287 (the first representative of atadenoviruses to be fully sequenced), a novel protease cleavage site (M/L/I)XAXG (type III) was identified (Vrati et al., 1996 ). Furthermore, a potential protease cleavage site on the pVII proteins was identified by peptide sequencing at the motif NTGWG (type IIb), which is present in members of all four genera (Vrati et al., 1996 ). The type I cleavage site appears in pVII of mastadenoviruses and siadenoviruses and type II in pVII of aviadenoviruses (Fig. 3). Type III cleavage sites could be identified in all the sequenced pVII proteins of all virus types that were proposed to belong to the genus Atadenovirus. In pVII of SnAdV-1, the IRATG sequence was demonstrated (Fig. 3).



(72K):

Fig. 3. Amino acid sequence alignment of the N-terminal portion of core protein pVII from different adenovirus types proposed to belong to four genera. The putative protease cleavage signals are boxed and their type is shown (I, II, IIb, III). Cleavage occurs after the fourth residue. Members of the four proposed genera are separated by blank lines. Abbreviations and accession numbers of the sequences are identical with those listed in the legends of Fig. 2 with the exception of F10 (L08450), H4 (U70921) and Po1, possum adenovirus type 1 (AF249333). The alignment was performed with the MULTALIN computer program (http://prodes.toulouse.inra.fr/multalin/multalin.html) and edited with the GENEDOC program (http://www.psc.edu/biomed/genedoc).

In the pX sequence of SnAdV-1, only one protease cleavage site (MRGGF), close to the C-terminal region, was found. In OAV287 (Vrati et al., 1996 ) and in other atadenoviruses only one cleavage sequence exists in a similar position. Some mastadenoviruses (Rusvai et al., 2000 ) and aviadenoviruses (Sheppard & Trist, 1993 ; Chiocca et al., 1996 ), however, have a second cleavage sequence close to the N terminus of pX.

In pVI of SnAdV-1, a type I (MSGGF) and a type II (MLGDG) motif were found 24 aa downstream and 15 aa upstream from the N and C termini, respectively. Protease cleavage at the second site of the SnAdV-1 pVI would generate an 11 aa peptide (GVCYRSKRYCY), which appears to be the counterpart of the HAdV-2 pVIc cofactor (Webster et al., 1993 ). Considering the pVI sequence of all the known adenovirus types, the consensus sequence of the pVIc cofactor seems to be G(V/L)XXXXXXXC(F/Y).

It appears that the type of protease cleavage recognition sequence is conserved within each genus and might be considered as single, shared derived characteristic. However, a broader consensus, valid for all types of adenoviral protease cleavage sites, could be summarized in the formulae (N/M/L/I)X(A/G)XG or (M/L/I)XGGX.

Conclusions
From the analysis of the DNA sequence of the randomly cloned SnAdV-1 genome fragments, several important conclusions can be drawn concerning the genetic affiliation of this virus or, in a broader sense, perhaps even that of reptilian adenoviruses. The arrangement of the part of the genome of SnAdV-1 studied so far resembles the typical genome organization of atadenoviruses; it is characterized by gene overlaps, short intergenic distances and, most importantly, by the presence of a homologue of the gene for p32K. The results of the phylogenetic analyses performed with sequences of two major viral proteins (hexon and protease) clearly indicated that SnAdV-1 belongs to the cluster of atadenoviruses. Finally, the protease cleavage motifs conserved in the pVII, pX and pVI amino acid sequences further support SnAdV-1 as a new member of the genus Atadenovirus. It is, however, astonishing that the base composition of the SnAdV-1 DNA did not show the bias towards AT content, a feature shared by all atadenoviruses studied to date and thought to be characteristic for the genus.

The variety of host origins of the members of the genus Atadenovirus remains an intriguing question. The possible reptilian origin was suggested (and supported by this work) when the phylogenetic tree of adenoviruses was compared with that of the host animals; the branches of the two genera (Mastadenovirus and Aviadenovirus) overlapped the clusters containing mammals and birds whereas the branch containing the atadenoviruses was positioned at a distance corresponding to lower vertebrates (Harrach, 2000 ). If we accept that adenoviruses might have co-evolved and co-speciated with their animal hosts, the observed variety of host origin in the two new genera might be explained by interspecies transmission, i.e. host switches of adenoviruses. The phylogenetic trees presented in Fig. 2(a, b) do not contradict this theory. We presume that some reptilian adenoviruses changed host three times, to birds (DAdV-1), to marsupials (the brushtail possum) and to ruminants. The seemingly elevated pathogenicity of these viruses, causing egg drop syndrome (McFerran & Smyth, 2000 ) or haemorrhagic disease (Woods et al., 1996 ) in the new hosts (insufficient time for adaptation and attenuation), also seems to support our speculation. Further evidence, including DNA sequence data from other adenovirus strains from additional species of reptiles, is needed to confirm the reptilian origin of atadenoviruses.

The support of the Faculty of Veterinary Sciences of the Szent István University, Budapest, for S.L.F., by a grant (NKB-2001-KUT-5-004) dedicated to PhD students, is highly appreciated. This work was also supported by the Hungarian Scientific Research Fund grants OTKA T030073 and T034461.

Footnotes

The GenBank accession number of the sequence reported in this paper is AY082603.

References

Altschul, S. F., Gish, W., Miller, W., Myers, E. W. & Lipman, D. J. (1990). Basic local alignment search tool. Journal of Molecular Biology 215, 403-410.[Medline]

Anderson, C. W. (1990). The proteinase polypeptide of adenovirus serotype 2 virions. Virology 177, 259-272.[Medline]

Barbezange, C., Benk, M., Dán, Á. & Harrach, B. (2000). DNA sequencing and phylogenetic analysis of the protease gene of ovine adenovirus 3 suggest that adenoviruses of sheep belong to two different genera. Virus Research 66, 79-80.[Medline]

Bartha, A. (1969). Proposal for subgrouping of bovine adenoviruses. Acta Veterinaria Academiae Scientiarum Hungaricae 19, 319-321.[Medline]

Benk, M. & Harrach, B. (1998). A proposal for establishing a new (third) genus within the Adenoviridae family. Archives of Virology 143, 829-837.[Medline]

Benk, M., Harrach, B. & Russell, W. C. (2000). Family Adenoviridae. In Virus Taxonomy. Seventh Report of the International Committee on Taxonomy of Viruses , pp. 227-238. Edited by M. H. V. van Regenmortel, C. M. Fauquet, D. H. L. Bishop, E. B. Carstens, M. K. Estes, S. M. Lemon, J. Maniloff, M. A. Mayo, D. J. McGeoch, C. R. Pringle & R. B. Wickner. San Diego:Academic Press.

Benk, M., Él, P., Ursu, K., Ahne, W., LaPatra, S. E., Thomson, D. & Harrach, B. (2002). First molecular evidence for the existence of distinct fish and snake adenoviruses. Journal of Virology (in press).

Both, G. W. (2002). Atadenovirus. In The Springer Index of Viruses , pp. 2-8. Edited by C. A. Tidona & G. Darai. Berlin:Springer-Verlag.

Boyle, D. B., Pye, A. D., Kocherhans, R., Adair, B. M., Vrati, S. & Both, G. W. (1994). Characterization of Australian ovine adenovirus isolates. Veterinary Microbiology 41, 281-291.[Medline]

Chiocca, S., Kurzbauer, R., Schaffner, G., Baker, A., Mautner, V. & Cotton, M. (1996). The complete DNA sequence and genomic organization of the avian adenovirus CELO. Journal of Virology 70, 2939-2949.[Abstract]

Clark, H. F., Michalski, F., Tweedell, K. S., Yohn, D. & Zeigel, R. F. (1973). An adenovirus, FAV-1, isolated from the kidney of a frog (Rana pipiens). Virology 51, 392-400.[Medline]

Corpet, F. (1988). Multiple sequence alignment with hierarchical clustering. Nucleic Acids Research 16, 10881-10890.[Abstract/Free Full Text]

Dán, Á., Ruzsics, Zs., Russell, W. C., Benk, M. & Harrach, B. (1998). Analysis of the hexon gene sequence of bovine adenovirus type 4 provides further support for a new adenovirus genus (Atadenovirus). Journal of General Virology 79, 1453-1460.[Abstract]

Davison, A. J. & Harrach, B. (2002). Siadenovirus. In The Springer Index of Viruses , pp. 29-33. Edited by C. A. Tidona & G. Darai. New York:Springer-Verlag.

Davison, A. J., Telford, E. A., Watson, M. S., McBride, K. & Mautner, V. (1993). The DNA sequence of adenovirus type 40. Journal of Molecular Biology 234, 1308-1316.[Medline]

Davison, A. J., Wright, K. M. & Harrach, B. (2000). DNA sequence of frog adenovirus. Journal of General Virology 81, 2431-2439.[Abstract/Free Full Text]

Ding, J., McGrath, W. J., Sweet, R. M. & Mangel, W. F. (1996). Crystal structure of the human adenovirus proteinase with its 11 amino acid cofactor. EMBO Journal 15, 1778-1783.[Medline]

Dingwall, C. & Laskey, R. A. (1991). Nuclear targeting sequencesa consensus? Trends in Biochemical Sciences 16, 478-481.[Medline]

Essbauer, S. & Ahne, W. (2001). Viruses of lower vertebrates. Journal of Veterinary Medicine. B, Infectious Diseases and Veterinary Public Health 48, 403-475.

Felsenstein, J. (1989). PHYLIPPhylogeny inference package. Cladistics 5, 164-166.

Frye, F. L., Munn, R. J., Gardner, M., Barten, S. L. & Hadfy, L. B. (1994). Adenovirus-like hepatitis in a group of related Rankins dragon lizards (Pogona henrylawsoni). Journal of Zoo and Wildlife Medicine 25, 167-171.

Harrach, B. (2000). Reptile adenoviruses in cattle? Acta Veterinaria Hungarica 48, 484-490.

Harrach, B. & Benk, M. (1998). Phylogenetic analysis of adenovirus sequences; proof of the necessity of establishing a third genus in the Adenoviridae family. In Adenovirus Methods and Protocols 21, pp. 309339. Edited by W. S. M. Wold. Totowa, NJ: Humana Press.

Harrach, B., Meehan, B. M., Benk, M., Adair, B. M. & Todd, D. (1997). Close phylogenetic relationship between egg drop syndrome virus, bovine adenovirus serotype 7, and ovine adenovirus strain 287. Virology 229, 302-308.[Medline]

Hess, M., Blöcker, H. & Brandt, P. (1997). The complete nucleotide sequence of the egg drop syndrome virus: an intermediate between mastadenoviruses and aviadenoviruses. Virology 238, 145-156.[Medline]

Jacobson, E. R. & Kollias, G. V. (1986). Adenovirus-like infection in a savannah monitor. Journal of Zoo Animal Medicine 17, 149-151.

Jacobson, E. R. & Gardiner, C. H. (1990). Adeno-like virus in esophageal and tracheal mucosa of a Jacksons chameleon (Chamaeleo jacksoni). Veterinary Pathology 27, 210-212.[Medline]

Jacobson, E. R., Gardiner, C. H. & Foggin, C. M. (1984). Adenovirus-like infection in two Nile crocodiles. Journal of the American Veterinary Medical Association 185, 1421-1422.[Medline]

Jacobson, E. R., Gaskin, J. M. & Gardiner, C. H. (1985). Adenovirus-like infection in a boa constrictor. Journal of the American Veterinary Medical Association 187, 1226-1227.[Medline]

Jacobson, E. R., Kopit, W., Kennedy, F. A. & Funk, R. S. (1996). Coinfection of a bearded dragon (Pogona vitticeps) with adenovirus- and dependovirus-like viruses. Veterinary Pathology 33, 343-346.[Abstract]

Juhasz, A. & Ahne, W. (1992). Physico-chemical properties and cytopathogenicity of an adenovirus-like agent isolated from corn snake (Elaphe guttata). Archives of Virology 130, 429-439.

Khatri, A. & Both, G. W. (1998). Identification of transcripts and promoter regions of ovine adenovirus OAV287. Virology 245, 128-141.[Medline]

Kinsel, M. J., Barbiers, R. B., Manharth, A. & Murnane, R. D. (1997). Small intestinal adeno-like virus in a mountain chameleon (Chameleo montium). Journal of Zoo and Wildlife Medicine 28, 498-500.[Medline]

Lehmkuhl, H. D. & Cutlip, R. C. (1999). A new goat adenovirus isolate proposed as the prototype strain for goat adenovirus serotype 1. Archives of Virology 144, 1611-1618.[Medline]

Lehmkuhl, H. D., Hobbs, L. A. & Woods, L. W. (2001). Characterization of a new adenovirus isolated from black-tailed deer in California. Archives of Virology 146, 1687-1196.

McFerran, J. B. & Smyth, J. A. (2000). Avian adenoviruses. Revue Scientifique et Technique Office International des Epizooties 19, 589-601.

Ogawa, M., Ahne, W. & Essbauer, S. (1992). Reptilian viruses: adenovirus-like agent isolated from royal python (Python regius). Journal of Veterinary Medicine. B, Infectious Diseases and Veterinary Public Health 39, 732-736.

Ojkic, D. & Nagy, É. (2000). The complete nucleotide sequence of fowl adenovirus type 8. Journal of General Virology 81, 1833-1837.[Abstract/Free Full Text]

Page, R. D. M. (1996). TreeView: an application to display phylogenetic trees on personal computers. Computer Applications in the Biosciences 12, 357-358.[Free Full Text]

Perkins, L. E., Campagnoli, R. P., Harmon, B. G., Gregory, C. R., Steffens, W. L., Latimer, K., Clubb, S. & Crane, M. (2001). Detection and confirmation of reptilian adenovirus infection by in situ hybridization. Journal of Veterinary Diagnostic Investigations 13, 365-368.

Pierson, F. W. & Domermuth, C. H. (1997). Haemorrhagic enteritis, marble spleen disease, and related infections. In Diseases of Poultry , pp. 624-633. Edited by B. W. Calnek, H. J. Barnes, C. W. Beard, L. R. McDougald & Y. M. Saif. Ames, IA:Iowa State University Press.

Pitcovski, J., Mualem, M., Rei-Koren, Z., Krispel, S., Shmueli, E., Peretz, Y., Gutter, B., Gallili, G. E., Michael, A. & Goldberg, D. (1998). The complete DNA sequence and genome organization of the avian adenovirus, haemorrhagic enteritis virus. Virology 249, 307-315.[Medline]

Ramis, A., Fernandez-Bellon, H., Majo, N., Martinez-Silvestre, A., Latimer, K., Campagnoli, R., Harmon, B. G., Gregory, C. R., Steffens, W. L., Clubb, S. & Crane, M. (2000). Adenovirus hepatitis in a boa constrictor (Boa constrictor). Journal of Veterinary Diagnostic Investigations 12, 573-576.

Rancourt, C., Keyvani-Amineh, H., Sircar, S., Labrecque, P. & Weber, J. M. (1995). Proline 137 is critical for adenovirus protease encapsidation and activation but not enzyme activity. Virology 209, 167-173.[Medline]

Russell, W. C. & Kemp, G. D. (1995). Role of adenovirus structural components in the regulation of adenovirus infection. Current Topics in Microbiology and Immunology 199, 81-98.

Russell, W. C. & Benk, M. (1999). Animal adenoviruses. In Encyclopedia of Virology , pp. 14-21. Edited by A. Granoff & R. G. Webster. New York:Academic Press.

Rusvai, M., Harrach, B., Bánrévi, A., Evans, P. S. & Benk, M. (2000). Identification and sequence analysis of the core protein genes of bovine adenovirus 2. Virus Research 70, 25-30.[Medline]

Schumacher, J., Jacobson, E. R., Burns, R. & Tramontin, R. R. (1994). Adenovirus-like infection in two rosy boas (Lichanura trivirgata). Journal of Zoo and Wildlife Medicine 25, 461-465.

Sheppard, M. & Trist, H. (1992). Characterization of the avian adenovirus penton base. Virology 188, 881-886.[Medline]

Sheppard, M. & Trist, H. (1993). The identification of genes for the major core proteins of fowl adenovirus serotype 10. Archives of Virology 132, 443-449.[Medline]

Sorden, S. D., Woods, L. W. & Lehmkuhl, H. D. (2000). Fatal pulmonary oedema in white-tailed deer (Odocoileus virginianus) associated with adenovirus infection. Journal of Veterinary Diagnostic Investigations 12, 378-380.

Thomson, D., Meers, J. & Harrach, B. (2002). Molecular confirmation of an adenovirus in brushtail possums (Trichosurus vulpecula). Virus Research 83, 189-195.[Medline]

Vrati, S., Boyle, D., Kocherhans, R. & Both, G. W. (1995). Sequence of ovine adenovirus homologues for 100K hexon assembly, 33K, pVIII, and fiber genes: early region E3 is not in the expected location. Virology 209, 400-408.[Medline]

Vrati, S., Brookes, D. E., Strike, P., Khatri, A., Boyle, D. B. & Both, G. W. (1996). Unique genome arrangement of an ovine adenovirus: identification of new proteins and proteinase cleavage sites. Virology 220, 186-199.[Medline]

Weber, J. M. (1995). Adenovirus endopeptidase and its role in virus infection. Current Topics in Microbiology and Immunology 199, 227-235.

Webster, A., Russell, S., Talbot, P., Russell, W. C. & Kemp, G. D. (1989). Characterization of the adenovirus proteinase: substrate specificity. Journal of General Virology 70, 3225-3234.[Abstract/Free Full Text]

Webster, A., Hay, R. T. & Kemp, G. (1993). The adenovirus protease is activated by a virus-encoded disulphide-linked peptide. Cell 72, 97-104.[Medline]

Woods, L. W., Swift, P. K., Barr, B. C., Horzinek, R. C., Nordhausen, R. W., Stillian, M. H., Patton, J. F., Oliver, M. N., Jones, K. R. & MacLachlan, N. J. (1996). Systemic adenovirus infection associated with high mortality in mule deer (Odocoileus hemionus) in California. Veterinary Pathology 33, 125-132.[Abstract]

Received 13 May 2002; accepted 28 June 2002.