Research Article

Selection of antigenic variants in maedi-visna virus infection

Journal of General Virology 2002; 83(10):2543

PubMed

Abstract

In order to analyse the pattern of sequence variation in maedivisna virus (MVV) in persistently infected sheep and to answer the question of whether antigenic variants are selected in a long-term MVV infection, an 87 bp variable region in the env gene of ten antigenic variants and 24 non-variants was sequenced. Nine of the ten antigenic variants had mutations in this region, comprising 24 point mutations and a deletion of 3 bp. Twenty-three of the point mutations (96%) were non-synonymous. There was only a single mutation in this region in the 24 non-variants. A type-specific neutralizing antibody response appeared in all the sheep 25 months post-infection, and in most sheep more broadly reacting neutralizing antibodies appeared up to 4 years later. All the antigenic variants were neutralized by the broadly reacting sera. It is noteworthy that the antigenic variants were isolated at a time when only the type-specific antibodies were acting, before the broadly reacting antibodies appeared. The same picture emerged when molecularly cloned virus was used for infection. Three sheep were infected with a molecularly cloned virus, and of six virus isolates, one was an antigenic variant. This variant arose in the absence of broadly reacting antibodies. The results indicate that there is selection for mutants that escape neutralization.
Maedivisna virus (MVV) establishes a lifelong infection of sheep, leading either to progressive meningoencephalomyelitis, characterized by weakness or paralysis of the hind legs (visna) or lung lesions of progressive pneumonia (maedi) (Sigurdsson & Pálsson, 1958 ). MVV is a member of the Lentivirus subfamily of retroviruses, and its primary target cells are considered to be of the monocyte lineage (Gendelman et al., 1986 ). MVV elicits an immune response in the host, both humoral and cell-mediated (Griffin et al., 1978 ; Larsen et al., 1982 ; Sihvonen, 1981 ; Thormar & Helgadóttir, 1965 ; Torsteinsdóttir et al., 1992 ), and the persistence of the virus in the face of a strong immune response has long been a puzzle. It has been proposed that one way for the virus to escape the immune response is by continuous change of epitopes through mutation (Gudnadóttir, 1974 ). Antigenic variation has indeed been documented for all lentiviruses (Burns et al., 1993 ; Ellis et al., 1987 ; Gudnadóttir, 1974 ; Kono et al., 1973 ; McGuire et al., 1988 ; McKeating et al., 1989 ; Montelaro et al., 1984 ; Narayan et al., 1977 ; Siebelink et al., 1993 ; Wolfs et al., 1991 ), but its significance for pathogenicity has been disputed (Cheevers et al., 1999 ; Lutley et al., 1983 ; Thormar et al., 1983 ; Wolinsky et al., 1996 ). The envelope genes of the lentiviruses are divided into regions of variable and conserved sequences. We have mapped a type-specific neutralization epitope in the fourth variable domain of MVV gp135 (Skraban et al., 1999 ). Mutations responsible for antigenic variation have also been mapped in the variable regions of the env gene in human immunodeficiency virus type 1 (HIV-1), simian immunodeficiency virus (SIV) and feline immunodeficiency virus (FIV) (Choi et al., 1994 ; Siebelink et al., 1993 ; Wolfs et al., 1991 ). In a previous study from this laboratory on antigenic drift in MVV, a group of 20 sheep were infected intracerebrally with MVV, and virus was isolated from the blood and cerebrospinal fluid over a period of 7·5 years (Lutley et al., 1983 ; Pétursson et al., 1976). All the sheep mounted a high type-specific neutralizing antibody response 25 months after infection, but the appearance of more broadly reacting neutralizing antibodies was irregular. Using type-specific antisera, it was found that of 61 virus isolates from blood, ten were antigenic variants. However, no correlation was found between the appearance of antigenic variants and the progression of disease (Lutley et al., 1983 ). In this study, a variable region where we have mapped mutations resulting in escape from neutralization (Skraban et al., 1999 ) was sequenced in these ten antigenic variants and 24 virus isolates that were not antigenic variants. Evidence for positive selection in this region is discussed. Virus strains and cells.
Visna virus 1514 has been described previously (Pétursson et al., 1976 ). The molecularly cloned virus KV1772kv72/67 is derived from visna virus K1772, which was selected for neurovirulence by serial passage of strain K1514 and retains the antigenic phenotype of K1514 (Andrésson et al., 1993 ).

Virus was propagated in monolayers of sheep choroid plexus cells (SCP) (Sigurdsson et al., 1960 ). Choroid plexus cells were grown at 37 °C in a humidified atmosphere of 5% CO2 in Dulbeccos modified Eagles medium (DMEM) supplemented with 200 units/ml penicillin and 100 units/ml streptomycin and either 10% or 1% lamb serum (for expansion of uninfected cells or for virus propagation, respectively). Virus isolation was by explantation and cocultivation.

Macrophage cultures were established as follows. Heparinized blood (100 ml) was collected from normal sheep, and peripheral blood mononuclear cells obtained by sedimentation on Histopaque-1077 (Sigma) were washed repeatedly in PBS and resuspended at a concentration of 12x106 cells/ml in growth medium supplemented with 5x10-5 M mercaptoethanol. After incubation at 37 °C in a humidified atmosphere of 5% CO2 for 24 h, supernatant and unattached cells were removed, and adherent cells were further incubated for at least 7 days before they were infected.

Infections were carried out at an m.o.i. of 0·20·5 TCID50. Each experiment was repeated at least two times. The replication of virus differed somewhat between macrophage preparations; however, differences between virus strains were very consistent within each experiment.

RT assay.
Viral particles from 0·5 ml of cell-free supernatants from infected cells were pelleted at 14000 r.p.m. in a microcentrifuge at 4 °C for 1 h. RT activity was determined as described previously (Andrésdóttir et al., 1998 ).

Neutralization tests.
Neutralization tests were carried out as published previously (Lutley et al., 1983). Briefly, 102 TCID50 of the virus in 0·1 ml was mixed with 0·1 ml of twofold dilutions of serum, mixtures were held at 4 °C for 48 h and then inoculated into four SCP cultures, which were observed for 23 weeks. Neutralization titres of the sera were calculated as the reciprocal of the serum dilution that caused complete neutralization in 50% of inoculated cultures.

Infection of cells and lysis for PCR.
SCP cells were infected with visna virus at an m.o.i. of 3 TCID50. When syncytia appeared (usually 23 days after infection), the monolayers of SCP cells were washed three times with PBS and the cells were suspended in 1 ml PBS using glass beads to remove the cells from the plastic. The cells were harvested and resuspended in 100 µl lysis buffer (10 mM TrisHCl, pH 8·0, 1 mM EDTA, 0·5% Triton X-100, 0·001% SDS, 300 µg/ml proteinase K) and incubated overnight at 37 °C. The enzyme was inactivated at 96 °C for 15 min. Three µl of the lysate were used for PCR amplification.

PCR, cloning and sequencing.
PCR was performed using DyNAzyme II DNA polymerase (Finnzymes Oy) and subjecting the samples to 30 cycles of 94 °C for 30 s, 53 °C for 30 s and 72 °C for 1 min. The PCR products were sequenced directly after purification of single strands using a biotin-labelled primer and streptavidin-coated magnetic beads, as specified by the manufacturer (Dynal). The following primer set was used for PCR amplification: 5' GAGGGATCAAGGATAAAAATGG 3' and 5' BioGGTATCGYTGCAGYAACAT 3'. Sequencing was performed using the primer 5' ATAGCACCATAACAGGAA 3'. The PCR products were also cut with XbaI and Sau3A and cloned into M13mp18 and M13mp19 for sequencing.

DyNAzyme, the DNA polymerase used in these studies, is one of the most accurate polymerases on the market, according to the producers (Finnzymes Oy). Our sequencing data support this statement, since we did not find any mutation in 5500 bases sequenced from PCR products of cloned DNA.

Neutralization of virus isolates
The origin of the virus isolates studied here has been reported (Lutley et al., 1983 ). Twenty sheep were inoculated with 0·3 ml of MVV strain K1514 with a titre of 106·5 TCID50/ml, and virus was isolated from blood and cerebrospinal fluid over a period of 78 years. During this time, eight animals had to be sacrificed because they had developed clinical visna.

Using type-specific antiserum that neutralized the infecting strain K1514 but not a heterologous strain K796, it was found that ten (16%) of 61 virus isolates from blood escaped neutralization. These antigenic variants were isolated from six sheep and appeared randomly in time, except in one sheep (no. 1557) where the last four isolates from blood were variants. No correlation could be found between the replication of antigenic variants and disease progression (Lutley et al., 1983 ). Early appearance of neutralizing antibodies did, however, correlate with late onset of disease (Georgsson et al., 1993 ).

Sequencing of a variable region in the env gene of the ten antigenic variants and 24 non-variants
We have mapped mutations changing a type-specific neutralization response in two molecular clones of visna virus to a highly variable region in the MVV outer glycoprotein (Skraban et al., 1999 ). We selected this region for sequencing in a number of virus isolates: the ten antigenic variants detailed above, and 24 isolates that were not antigenic variants. PCR was performed on virus isolated in SCP cells from experimentally infected sheep over the period 19731981 (Lutley et al., 1983) and fresh sheep samples were thus not available. Macrophages are considered to be the natural target cells of MVV, and the growth in SCP cells may select for SCP-tropic variants. However, we believe that the use of the SCP isolates is legitimate, since the infecting MVV strain, K1514, is permissive in SCP cells and we have shown that the cell tropism resides in the LTR (Agnarsdóttir et al., 2000 ). The neutralization titres of a type-specific antiserum to the infecting strain K1514, against the virus isolates, are listed in Table 1, as are the titres of a polyvalent antiserum obtained late in infection from a sheep infected with strain 1514 (serum taken at 72 months after infection from sheep 1521, see Fig. 2). The antigenic variants that were not neutralized by the type-specific antiserum were all readily neutralized by the polyvalent serum.


Table 1. Neutralization of antigenic variants with type-specific serum 1514, 796 and polyvalent serum



(34K):

Fig. 2. Neutralization titres of sequential serum samples from 17 MVV-infected sheep. Closed circles indicate neutralization titres for the infecting virus, K1514; open circles indicate neutralization titres for the heterologous virus, K796. Arrowheads indicate virus isolations; antigenic variants are denoted by asterisks.

The amino acid sequences were determined both by direct sequencing of PCR products, and also by sequencing one clone from all the antigenic variants and five of the non-variants. All the antigenic variants except one had mutations in the region analysed, with 25 mutations in all, of which 24 were point mutations and one was a deletion of three base pairs (Fig. 1). Sixteen of the point mutations were independent, and of these, 15 (94%) were non-synonymous. A single mutation was identified in the 24 non-variant isolates. In all cases, agreement was found between the clone that was sequenced and the PCR products. The mutations were clustered in three regions: in two linear epitopes (Skraban et al., 1999 ) and in a potential N-linked glycosylation site, in which four independent mutations were found. In addition, there were two independent mutations in a cysteine residue, which may play a part in the three-dimensional structure of this region. Most of the strains had more than one mutation; only one strain had a single mutation, and this occurred in the glycosylation site.



(29K):

Fig. 1. Deduced amino acid sequences between aa 553 and 581 in the Env protein of the ten antigenic variants (top) and 24 non-variants (bottom) compared with strain K1514. Linear epitopes and a potential glycosylation site (NES) are underlined.

More than one antigenic variant was isolated from two sheep, two from sheep 1551 and four from 1557. The two from sheep 1551 had arisen independently, but the four from sheep 1557 were clearly related.

The time points of the virus isolations are listed in Fig. 1. Two of the antigenic variants were isolated 6 months post-infection, one after 15 months and the others later. The accumulation of mutations in the antigenic variants as opposed to non-variants cannot be explained by the antigenic variants being isolated at later time points, because nine of the non-variants were isolated 30 months post-infection or later.

Two clones of strain K1514 have been sequenced (Braun et al., 1987; Sonigo et al., 1985 ). The two clones diverge by nine nucleotides of 1965 in the SU of the env gene. Six of these mutations are non-synonymous and three are synonymous. We sequenced the entire genes for the SU of Env from three antigenic variants that were isolated from sheep 1557. We found 23 mutations that were not present in either of the two sequenced K1514 strains, counting mutations at each site only once. Four of these mutations were in the epitope region and all were non-synonymous. Of the remaining 19 mutations, ten (53%) were non-synonymous and nine (47%) were synonymous. The sequences have been submitted to GenBank.

Time of emergence of the antigenic variants with respect to neutralization profiles
Sera were drawn from all sheep at regular intervals and tested for neutralization of the infecting virus (K1514) and a heterologous visna virus, K796, which was not neutralized by type-specific antiserum against K1514 (Fig. 2). A type-specific neutralization response appeared in all sheep 25 months after infection. A more broadly reactive neutralizing response, which also neutralized strain K796 appeared much more irregularly. It appeared within a year in ten sheep and up to 4 years later in three others. Four additional sheep either developed low levels of neutralizing antibodies against K796 very late or did not develop any. In Fig. 2, the time points of virus isolations are illustrated by arrowheads, and asterisks indicate neutralization escape mutants. Sixty-one blood isolates from 17 sheep were tested for neutralization with type-specific antiserum against K1514. Ten virus isolates from six sheep were not neutralized by the type-specific antiserum. Thirty-two virus strains were isolated at time points when there was no antibody against K796, and 29 were isolated in the presence of the broadly acting antibodies. All the escape mutants, except for one, were isolated at time points when only the type-specific antibodies were acting, before the emergence of the broadly reactive antibodies. One escape mutant was isolated just after the appearance of the broadly reactive antibodies when the neutralization titre for K796 had reached 8 (Fig. 2, sheep 1521). The association between the appearance of the antigenic variants and the presence of type-specific neutralizing antibodies but absence of the broadly reacting antibodies was shown to be statistically significant using Fishers exact test (P=0·0135). The time function was not taken into account in this calculation. However, since the broadly reacting antibodies appeared later than the type-specific neutralizing antibodies, on the whole, virus isolated in the presence of the broadly reacting antibodies were isolated later and would therefore be expected to have accumulated more mutations.

Neutralizing antibody response following infection with a molecularly cloned virus
Three sheep (1951, 1954 and 1956) were infected intracerebrally with 0·4 ml of the molecularly cloned MVV KV1772kv72/67 with a titre of 107·3 TCID50/ml. Sera were collected every other week and tested for neutralization of two MVV strains: the infecting molecularly cloned strain, KV1772kv72/67, which has the same neutralization type-specificity as the strain K1554, and another molecularly cloned strain, LV1-1KS1, which is derived from strain K796 and is heterologous to KV1772kv72/67. All sheep had developed type-specific neutralizing antibodies by 12 weeks post-infection. The neutralization titre rose rapidly and was maintained throughout the 3 years that the sheep were kept alive. Antibodies that neutralized the heterologous strain LV1-1KS1 appeared later in two of the sheep, and not at all in one sheep (Fig. 3). Two virus isolates from each sheep were tested for neutralization by type-specific antiserum against the infecting strain, KV1772kv72/67, and a broadly reactive antiserum that neutralized both KV1772kv72/67 and the heterologous strain, LV1-1KS1. One isolate from sheep 1954 was not neutralized by the type-specific antiserum, and this antigenic variant arose in the absence of broadly reactive antibodies. All isolates were neutralized by the broadly reactive antiserum. The neutralization epitope region was sequenced in the six virus isolates. Eight mutations were found in this region in the antigenic variant, and these were distributed similarly to the mutations we had found in the other antigenic variants. There were mutations in the two linear epitopes, in one of the cysteines and in the potential glycosylation site. We sequenced two-thirds of the env gene in this variant and found it to be hypermutated compared with other virus isolates (data not shown). There were no mutations in the epitope region in the five isolates that were not antigenic variants (Fig. 4).



(10K):

Fig. 3. Neutralization titres of sequential serum samples from three sheep infected with the molecularly cloned virus, KV1772kv72/67. Closed circles indicate neutralization titres for the infecting virus; open circles indicate neutralization titres for the heterologous virus, LV1-1KS1. Arrows indicate virus isolations; the antigenic variant is denoted by an asterisk.


(17K):

Fig. 4. Deduced amino acid sequences between aa 553 and 581 in the Env protein of the six virus isolates from sheep infected with the molecularly cloned virus, KV1772kv72/67. Linear epitopes and a potential glycosylation site (NES) are underlined.

Neutralization of antigenic variants by autologous antisera
To determine whether type-specific neutralizing antibodies developed against the antigenic variants when they appeared, autologous antisera from two sheep were tested. The broadly reactive antibodies would mask any new type-specific antibodies against the antigenic variants, but in sheep where no broadly reactive antibodies appeared, type-specific antibodies against newly arising antigenic variants should be detectable. All four antigenic variants that arose in sheep 1557 were tested against autologous sera taken at 2, 6, 12, 36, 60 and 80 months after infection (see Fig. 2). None of the antigenic variants was neutralized by any of the autologous sera. Two autologous antisera from sheep 1954, taken at 36 and 48 months (Fig. 3) were also tested against the antigenic variant isolated from this sheep. This antigenic variant was not neutralized by either of the autologous antisera.

Replication rates of antigenic variants
To test the possibility that selection of the antigenic escape mutants could be explained by increased replication rates, we determined the rate of replication of two antigenic variants. The first was the antigenic variant that arose in the sheep infected with the molecularly cloned virus (isolate 1954-1636). Blood-derived macrophages were infected with the molecularly cloned virus KV1772kv72/67 or the antigenic variant 1954-1636 at an m.o.i. of 0·2. Virus replication was monitored by measuring RT activity daily in the cell supernatants. The replication rate of the antigenic variant was considerably slower than that of the parent virus, KV1772kv72/67 (Fig. 5). The other antigenic variant that was tested was isolate 165 from sheep 1521 (see Fig. 2). This antigenic variant had a Cys→Tyr mutation (Fig 1) and could be expected to have a disrupted three-dimensional structure, possibly affecting replication proficiency. Cultures of blood-derived macrophages were inoculated with four virus isolates from this sheep: an isolate taken at 2 months after infection (isolate 1521-49), 15 months (isolate 1521-165, the antigenic variant), 30 months (isolate 1521-256) and 60 months (isolate 1521-522). The antigenic variant (isolate 1521-165) grew distinctly slower than the other virus isolates (Fig. 6). Both antigenic variants (1954-1636 and 1521-165) had emerged in the presence of type-specific neutralizing antibodies, despite the fact that they were impaired in growth.



(16K):

Fig. 5. Growth curves of the molecularly cloned strain KV1772kv72/67 and the antigenic variant 1954-1636 in blood-derived macrophages. Virus replication was monitored by RT assays as described in Methods.


(16K):

Fig. 6. Growth curves in blood-derived macrophages of an antigenic variant (isolate 165) and three non-variant isolates (49, 256 and 522) from sheep 1521, as measured by RT activity.
We have previously shown that mutations in a highly variable region of the env gene result in antigenic escape (Skraban et al., 1999 ). We therefore chose this region for sequencing in a number of virus isolates, both antigenic variants and non-variants. Nine of the ten antigenic variants were mutated in this region, and all but one had multiple mutations. The finding that 94% of the mutations were non-synonymous differs markedly from the findings observed in eukaryotic genes (Li et al., 1985 ) and is suggestive of selection for mutations in this region. Other regions of the full-length gp135 genes of the three variants that were sequenced had a higher number of synonymous mutations, pointing to less selection pressure in these regions. We sequenced PCR products directly in order to detect the consensus sequence of the isolates. We also sequenced one clone from each antigenic variant, and we did not find any difference in sequence. However, it is very likely that the virus isolates were mixed to some extent, and this may explain why one of the antigenic variants apparently did not have mutations in the region: if only a minority of the sample was mutated and escaped neutralization, this would explain why the mutation was not detected in the PCR sequencing. Another explanation would be that the mutation responsible for the antigenic variation resided in a different region of the env gene. Seven antigenic variants were mutated in a potential glycosylation site and five of the mutations clearly arose independently. The Env proteins of lentiviruses are heavily glycosylated (Leonard et al., 1990 ) and a number of studies have shown that glycans modulate the antigenicity of the viral proteins, either by masking neutralization epitopes or by inducing conformational changes in the Env protein (Back et al., 1994 ; Javaherian et al., 1994 ; Reitter et al., 1998 ; Schønning et al., 1996 ). We have provided evidence that the neutralization epitope residing in this region is conformational (Skraban et al., 1999 ). The frequent mutations in the glycosylation site in the antigenic variants are in accordance with the results of Javaherian et al. (1994) who found that glycosylation was required for preservation of the neutralization domain of SIV mac, and adds weight to the notion that the glycan moiety is required for the conformation of the epitope (Li et al., 1993 ).

In an MVV infection, type-specific neutralizing antibodies appear 25 months after infection, and in most sheep, other more broadly neutralizing antibodies appear up to 4 years later. The broadening of the neutralizing antibody response has been suggested to be due to mutants arising in the virus population that were antigenically related to the heterologous test strain (Pétursson et al., 1976 ). The low level of heterogeneity in the env genes of the virus isolates that were isolated in the presence of broadly reactive antibodies suggests, however, that the development of broadly reactive antibodies is more likely due to a reaction to conserved epitopes that are less immunogenic. The finding that all the antigenic variants were neutralized by the broadly active serum is further evidence for the conserved nature of these epitopes. Similar results have been obtained in studies of SIV (Clements et al., 1995 ) and HIV-1 (Zhang et al., 1999 ).

The role of humoral immunity in lentiviral infections is still a matter of controversy. It has been disputed whether antigenic variants of lentiviruses arise as a result of immune selection. Although antigenic variants can be selected in the presence of antibodies in vitro (Dubois-Dalq et al., 1979 ; Yoshida et al., 1997 ), the functional role of antibodies under in vivo conditions is uncertain. It has been proposed that since neutralizing epitopes are located in regions that tolerate high variability and because of the high mutation rate of the lentiviruses, mutants with a selective disadvantage will be selected against, resulting in enrichment of variants with mutations in the neutralizing epitopes. These may then acquire dominance in the virus population, either accompanying another mutation, resulting in a more fit variant, or by bottleneck transmission (Domingo et al., 1993 ). It is also possible that a change in the neutralization epitope coincides with a change in a recognition site for a receptor or coreceptor, as has been found in HIV (McKnight et al., 1995 ). The region of the env gene that was compared in this study has indeed been shown to be highly variable, both between distantly related MVVs (Sargan et al., 1991 ) and the more closely related Icelandic maedi and visna viruses (Andrésdóttir et al., 1998 ). This region is within the fourth variable domain (V4) of MVV, which is analogous to V4 identified in the caprine arthritisencephalitis virus surface glycoprotein (Valas et al., 2000 ). The higher proportion of non-synonymous nucleotide substitutions in this region than in other regions of the Env protein is suggestive of positive selection in this region. However, since we sequenced PCR products derived from virus propagated in SCP cells, we cannot rule out the possibility that growth in cell culture could have selected some of the mutations. The finding that the antigenic variants emerged at time points when only the type-specific antibodies were acting strongly suggests, however, that the type-specific antibodies provide the selective force. The correlation of early appearance of neutralizing antibodies with late onset of disease (Georgsson et al., 1993 ) is further evidence that the antibodies are effective in limiting the spread of virus in the body.

Two clones of MVV strain K1514 used as inoculum in this study have been sequenced. The two genes of gp135 have been found to differ by nine mutations or 0·5% (Braun et al., 1987 ; Sonigo et al., 1985 ). The sheep were inoculated with 106107 TCID50 of virus. It is therefore likely that some of the mutations resulting in antigenic variation may have been present in the inoculum, whereas others have evolved in the sheep.

It appears that there is enrichment of virus variants that escape neutralization in the presence of type-specific neutralizing antibodies. When the broadly neutralizing antibodies appear, the escape variants have no advantage, and some of them may be impaired in replication, and therefore they are not isolated as frequently. The escape mutants that we tested for growth rate in this study did in fact grow more slowly than the parent strains, while the growth rate of other antigenic variants may not be affected (Skraban et al., 1999 ). The humoral immune response therefore seems to be effective at limiting the spread of virus in an MVV infection, but the fact remains that there is no evidence for involvement of the antigenic variants in progression of the disease.

We thank Svava Högnadóttir for expert technical assistance. This work was supported by The University of Iceland Research Fund and the Icelandic Research Fund for Graduate Students.

Footnotes

The sequences of the env gene of the three antigenic variants have been submitted to GenBank, accession numbers AF4740057.

b Present address: deCode Genetics, Reykjavík, Iceland.

c Present address: SigmaAldrich Fine Chemicals, St Louis, MO 63103, USA.

References

Agnarsdóttir, G., Thorsteinsdóttir, H., Óskarsson, T., Matthíasdóttir, S., Haflidadóttir, B. S., Andrésson, Ó. S. & Andrésdóttir, V. (2000). The long terminal repeat is a determinant of cell tropism of maedivisna virus. Journal of General Virology 81, 1901-1905.[Abstract/Free Full Text]

Andrésdóttir, V., Tang, X., Agnarsdóttir, G., Andrésson, Ó. S., Georgsson, G., Skraban, R., Torsteinsdóttir, S., Rafnar, B., Benediktsdóttir, E., Matthíasdóttir, S., Árnadóttir, S., Högnadóttir, S., Pálsson, P. A. & Pétursson, G. (1998). Biological and genetic differences between lung- and brain-derived isolates of maedivisna virus. Virus Genes 16, 281-293.[Medline]

Andrésson, Ó. S., Elser, J. E., Tobin, G. J., Greenwood, J. D., Gonda, M. A., Georgsson, G., Andrésdóttir, V., Benediktsdóttir, E., Carlsdóttir, H. M., Mantyla, E. O., Rafnar, B., Pálsson, P. A., Casey, J. W. & Pétursson, G. (1993). Nucleotide sequence and biological properties of pathogenic proviral molecular clone of neurovirulent visna virus. Virology 193, 89-105.[Medline]

Back, N. K. T., Smit, L., de Jong, J.-J., Keulen, W., Schutten, M., Goudsmit, J. & Tersmette, M. (1994). An N-glycan within the human immunodeficiency virus type 1 gp120 V3 loop affects virus neutralization. Virology 199, 431-438.[Medline]

Braun, M. J., Clements, J. E. & Gonda, M. A. (1987). The visna virus genome: evidence for a hypervariable site in the env gene and sequence homology among lentivirus envelope proteins. Journal of Virology 61, 4046-4054.[Abstract/Free Full Text]

Burns, D. P. W., Collignon, C. & Desrosiers, R. C. (1993). Simian immunodeficiency virus mutants resistant to serum neutralization arise during persistent infection of rhesus monkeys. Journal of Virology 67, 4104-4113.[Abstract/Free Full Text]

Cheevers, W. P., Cordery-Cotter, R., McGuire, T. C. & DeMartini, J. C. (1999). Neutralizing antibody responses and evolution of antigenic variants in monozygotic twin lambs infected with phenotypically distinct ovine lentiviruses. Virology 258, 382-388.[Medline]

Choi, W. S., Collignon, C., Thiriart, C., Burns, D. P. W., Stott, E. J., Kent, K. A. & Desrosiers, R. C. (1994). Effects of natural sequence variation on recognition by monoclonal antibodies that neutralize simian immunodeficiency virus infectivity. Journal of Virology 68, 5395-5402.[Abstract/Free Full Text]

Clements, J. E., Montelaro, R. C., Zink, M. C., Amedee, A. M., Miller, S., Trichel, A. M., Jagerski, B., Hauer, D., Martin, L. N., Bohm, R. P. & Murphey-Corb, M. (1995). Cross-protective immune responses induced in rhesus macaques by immunization with attenuated macrophage-tropic simian immunodeficiency virus. Journal of Virology 69, 2737-2744.[Abstract]

Domingo, E., Díez, J., Martínez, M. A., Hernández, J., Holguín, A., Borrego, B. & Mateu, M. G. (1993). New observations on antigenic diversification of RNA viruses. Antigenic variation is not dependent on immune selection. Journal of General Virology 74, 2039-2045.[Abstract/Free Full Text]

Dubois-Dalq, M., Narayan, O. & Griffin, D. E. (1979). Cell surface changes associated with mutation of visna virus in antibody-treated cell cultures. Virology 92, 353-366.[Medline]

Ellis, T. M., Wilcox, G. E. & Robinson, W. F. (1987). Antigenic variation of caprine arthritis encephalitis virus during persistent infection of goats. Journal of General Virology 68, 3145-3152.[Abstract/Free Full Text]

Gendelman, H. E., Narayan, O., Kennedy-Stoskopf, S., Kennedy, P. G. E., Ghotbi, Z., Clements, J. E., Stanley, J. & Pezeshkpour, G. (1986). Tropism of sheep lentiviruses for monocytes: susceptibility to infection and virus gene expression increase during maturation of monocytes to macrophages. Journal of Virology 58, 67-74.[Abstract/Free Full Text]

Georgsson, G., Torsteinsdóttir, S., Pétursson, G., Pálsson, P. A. & Andrésson, Ó. S. (1993). Role of the immune response in visna, a lentiviral central nervous system disease of sheep. In Animal models of HIV and other retroviral infections , pp. 183-195. Edited by P. Racz, N. L. Levtin & J. C. Gluckman. Basel:Karger.

Griffin, D. E., Narayan, O. & Adams, R. J. (1978). Early immune responses in visna, a slow disease of sheep. Journal of Infectious Diseases 138, 340-350.[Medline]

Gudnadóttir, M. (1974). Visna-maedi in sheep. Progress in Medical Virology 18, 336-349.[Medline]

Javaherian, K., Langlois, A. J., Montefiori, D. C., Kent, K. A., Ryan, K. A., Wyman, P. D., Stott, J., Bolognesi, D. P., Murphey-Corb, M. & Larosa, G. J. (1994). Studies of the conformation-dependent neutralizing epitopes of simian immunodeficiency virus envelope protein. Journal of Virology 68, 2624-2631.[Abstract/Free Full Text]

Kono, Y., Kobayashi, K. & Fukunaga, Y. (1973). Antigenic drift of equine infectious anemia virus in chronically infected horses. Archiv für die gesamte Virusforschung 41, 1-10.[Medline]

Larsen, H. J., Hyllseth, B. & Krogsrud, J. (1982). Experimental maedi virus infection in sheep: early cellular and humoral immune response during three years following parenteral inoculation. American Journal of Veterinary Research 43, 379-383.[Medline]

Leonard, C. K., Spellman, M. W., Riddle, L., Harris, R. J., Thomas, J. N. & Gregory, T. J. (1990). Assignment of intrachain disulfide bonds and characterization of potential glycosylation sites of the type 1 recombinant HIV envelope glycoprotein (gp120) expressed in Chinese hamster ovary cells. Journal of Biological Chemistry 265, 10373-10382.[Abstract/Free Full Text]

Li, W.-H., Wu, C.-I. & Luo, C.-C. (1985). A new method for estimating synonymous and nonsynonymous rates of nucleotide substitution considering the relative likelihood of nucleotide and codon changes. Molecular Biology and Evolution 2, 150-174.[Abstract]

Li, Y., Luo, L., Rasool, N. & Kang, C. Y. (1993). Glycosylation is necessary for the correct folding of human immunodeficiency virus gp120 in CD4 binding. Journal of Virology 67, 584-588.[Abstract/Free Full Text]

Lutley, R., Pétursson, G., Pálsson, P. A., Georgsson, G., Klein, J. & Nathanson, N. (1983). Antigenic drift in visna: virus variation during long-term infection of Icelandic sheep. Journal of General Virology 64, 1433-1440.[Abstract/Free Full Text]

McGuire, T. C., Norton, L. K., ORourke, K. I. & Cheevers, W. P. (1988). Antigenic variation of neutralization-sensitive epitopes of caprine arthritisencephalitis lentivirus during persistent arthritis. Journal of Virology 62, 3488-3492.[Abstract/Free Full Text]

McKeating, J. A., Gow, J., Goudsmit, J., Pearl, L. H., Mulder, C. & Weiss, R. A. (1989). Characterization of HIV-1 neutralization escape mutants. AIDS 3, 777-784.[Medline]

McKnight, A., Weiss, R. A., Shotton, C., Takeuchi, Y., Hoshino, H. & Clapham, P. R. (1995). Change in tropism upon immune escape by human immunodeficiency virus. Journal of Virology 69, 3167-3170.[Abstract]

Montelaro, R. C., Perekh, B., Orrego, A. & Issel, C. J. (1984). Antigenic variation during persistent infection by equine infectious anemia virus, a retrovirus. Journal of Biological Chemistry 259, 10539-10544.[Abstract/Free Full Text]

Narayan, O., Griffin, D. E. & Chase, J. (1977). Antigenic shift of visna virus in persistently infected sheep. Science 197, 376-378.[Abstract/Free Full Text]

Pétursson, G., Nathanson, N., Georgsson, G., Panitch, H. & Pálsson, P. A. (1976). Pathogenesis of visna. I. Sequential virologic, serologic, and pathologic studies. Laboratory Investigation 35, 402-412.[Medline]

Reitter, J. N., Means, R. E. & Desrosiers, R. C. (1998). A role for carbohydrates in immune evasion in AIDS. Nature Medicine 4, 679-684.[Medline]

Sargan, D. R., Bennet, I. D., Cousens, C., Roy, D. J., Blacklaws, B. A., Dalziel, R. G., Watt, N. J. & McConnell, I. (1991). Nucleotide sequence of EV1, a British isolate of maedivisna virus. Journal of General Virology 72, 1893-1903.[Abstract/Free Full Text]

Schønning, K., Jansson, B., Olofsson, S., Nielsen, J. O. & Hansen, J.-E. S. (1996). Resistance to V3-directed neutralization caused by an N-linked oligosaccharide depends on the quaternary structure of the HIV-1 envelope oligomer. Virology 218, 134-140.[Medline]

Siebelink, K. H. J., Rimmelzwaan, G. F., Bosch, M. L., Meloen, R. H. & Osterhaus, A. D. M. E. (1993). A single amino acid substitution in hypervariable region 5 of the envelope protein of feline immunodeficiency virus allows escape from virus neutralization. Journal of Virology 67, 2202-2208.[Abstract/Free Full Text]

Sigurdsson, B. & Pálsson, P. A. (1958). Visna of sheep. A slow demyelinating infection. British Journal of Experimental Pathology 39, 519-528.[Medline]

Sigurdsson, B., Thormar, H. & Pálsson, P. A. (1960). Cultivation of visna virus in tissue culture. Archiv für die gesamte Virusforschung 10, 368-380.

Sihvonen, L. (1981). Early immune responses in experimental maedi. Research in Veterinary Science 30, 217-222.[Medline]

Skraban, R., Matthíasdóttir, S., Torsteinsdóttir, S., Agnarsdóttir, G., Gudmundsson, B., Georgsson, G., Meloen, R. H., Andrésson, Ó. S., Staskus, K. A., Thormar, H. & Andrésdóttir, V. (1999). Naturally occurring mutations within 39 amino acids in the envelope glycoprotein of maedivisna virus alter the neutralization phenotype. Journal of Virology 73, 8064-8072.[Abstract/Free Full Text]

Sonigo, P., Alizon, M., Staskus, K., Klatzmann, D., Cole, S., Danos, O., Retzel, E. & Wain-Hobson, S. (1985). Nucleotide sequence of the visna lentivirus: relationship to the AIDS virus. Cell 42, 369-382.[Medline]

Thormar, H. & Helgadóttir, H. (1965). A comparison of visna and maedi viruses. II. Serological relationship. Research in Veterinary Science 6, 456-465.[Medline]

Thormar, H., Barshatzky, M. R., Arnesen, K. & Kozlowski, P. B. (1983). The emergence of antigenic variants is a rare event in long-term visna virus infection in vivo. Journal of General Virology 64, 1427-1432.[Abstract/Free Full Text]

Torsteinsdóttir, S., Georgsson, G., Gísladóttir, E., Rafnar, B., Pálsson, P. A. & Pétursson, G. (1992). Pathogenesis of central nervous system lesions in visna: cell-mediated immunity and lymphocyte subsets in blood, brain and cerebrospinal fluid. Journal of Neuroimmunology 41, 149-158.[Medline]

Valas, S., Benoit, C., Baudry, C., Perrin, G. & Mamoun, R. Z. (2000). Variability and immunogenicity of caprine arthritisencephalitis virus surface glycoprotein. Journal of Virology 74, 6178-6185.[Abstract/Free Full Text]

Wolfs, T. F. W., Zwart, G., Bakker, M., Valk, M., Kuiken, C. L. & Goudsmit, J. (1991). Naturally occurring mutations within HIV-1 V3 genomic RNA lead to antigenic variation dependent on a single amino acid substitution. Virology 185, 195-205.[Medline]

Wolinsky, S. M., Korber, B. T. M., Neumann, A. U., Daniels, M., Kunstman, K. J., Whetsell, A. J., Furtado, M. R., Cao, Y., Ho, D. D., Safrit, J. T. & Koup, R. A. (1996). Adaptive evolution of human immunodeficiency virus-type 1 during the natural course of infection. Science 272, 537-541.[Abstract]

Yoshida, K., Nakamura, M. & Ohno, T. (1997). Mutations of the HIV type 1 V3 loop under selection pressure with neutralizing monoclonal antibody NM-01. AIDS Research and Human Retroviruses 13, 1283-1290.[Medline]

Zhang, P. F., Chen, X., Fu, D. W., Margolick, J. B. & Quinnan, G. V.Jr (1999). Primary virus envelope cross-reactivity of the broadening neutralizing antibody response during early chronic human immunodeficiency virus type 1 infection. Journal of Virology 73, 5225-5230.[Abstract/Free Full Text]

Received 7 February 2002; accepted 5 June 2002.