Research Article

Genetic variation and immunohistochemical differences among geographic isolates of Taura syndrome virus of penaeid shrimp

a,2 and Arun K. Dhar2

Department of Biological Sciences, California State University, 333 South Twin Oaks Valley Road, San Marcos, California 92096, USA1
Super Shrimp Inc., 1545 Tidelands Avenue, Suite J, National City, California 91950, USA2

Author for correspondence: Arun K. Dhar. Fax +1 858 547 8024. e-mail arun_dhar{at}hotmail.com

Journal of General Virology 2002; 83(12):3123

PubMed

With thanks to our partners for supporting this archive.

Abstract

Taura syndrome virus (TSV) is an important virus infecting penaeid shrimp in the western hemisphere. Genetic variation and immunohistochemical differences of 20 TSV isolates collected from the USA, Taiwan, Mexico and Nicaragua were compared. Capsid protein genes CP1 (546 bp) and CP2 (584 bp) were amplified by RTPCR and the cDNAs were sequenced. Pairwise comparison of nucleotide sequences showed a 02·4% difference in CP1 and a 03·5% difference in CP2. Phylogenetic analyses clustered the TSV isolates into two groups: one contained USA, Taiwan and some Mexican isolates, the other contained Mexican isolates only. Immunohistochemical analysis using a TSV-specific monoclonal antibody produced positive results for the USA and Taiwan isolates but negative results for the Mexican and Nicaraguan isolates. Molecular and immunohistochemical data suggest the existence of at least two TSV strains, one of which might have evolved following contact with a new penaeid host, Penaeus stylirostris.



Taura syndrome virus (TSV) is one of the most economically significant viruses infecting penaeid shrimp in the western hemisphere (Hasson et al., 1995 ; Brock et al., 1995 ). Penaeus vannamei, P. schmitti and P. setiferus are the most susceptible species, whereas P. stylirostris, P. monodon, P. japonicus, P. duorarum, P. chinensis and P. aztecus are considered TSV tolerant (Brock, 1997 ; Overstreet et al., 1997 ). TSV infection in P. vannamei, the principal host of the virus, consists of three histologically and clinically distinct phases: acute, transitional and chronic (Hasson et al., 1999a ). The TSV genome contains positive-sense ssRNA of ∼10 kb (Bonami et al., 1997 ). Sequence analyses revealed that TSV genome organization is similar to insect picornaviruses (Robles-Sikisaka et al., 2001 ; Mari et al., 2002 ).

Due to the extensive culture and international movement of P. vannamei, TSV has spread via infected stocks throughout the Americas and Taiwan (Anon., 1996 ; Hasson et al., 1999b ; Tu et al., 1999 ). However, the existence of possible genetic variants of TSV has not been reported. It was speculated that a single or very similar strains were responsible for TSV epizootics in P. vannamei farms from 1992 to 1996 based on the identical nature of the disease characteristics (Hasson et al., 1999b ), although sequence data to support this hypothesis were lacking. From summer 1999 to 2000, frequent TSV epizootics among farmed P. stylirostris in Mexico were characterized by high mortality, presence of severe acute phase histological lesions and positive results by PCR or in situ hybridization. However, immunohistochemistry (IHC) analyses of these samples using a TSV-specific monoclonal antibody (mAb) were negative (K. W. Hasson, unpublished data). Prior to 1999, severe acute phase TSV lesions in P. stylirostris were observed on only one occasion in a diagnostic case from Nicaragua during 1997 (K. W. Hasson, unpublished data). As P. stylirostris are characteristically TSV tolerant, it was speculated that the recent epizootics in Mexico might be due to the emergence of a previously unrecognized TSV strain (K. W. Hasson, unpublished data). Herein, we report the genetic variation and the IHC differences of TSV isolates from Taiwan, Mexico, Nicaragua and USA, demonstrating that at least two TSV strains are present in penaeid shrimp.

Of the TSV-infected P. stylirostris and P. vannamei collected during 2000 from different farms in Taiwan (Table 1, isolate no. 3) and Mexico (Table 1, isolate nos 419), 17 were selected for this study. Multiple TSV-infected shrimp originating from a given farm were considered as one isolate (Table 1). Samples were selected based on a definitive TSV diagnosis by histopathology, PCR and/or in situ hybridization, preservation in Davidsons AFA fixative or RF fixative for less than 48 h prior to embedding and submission of either frozen or ethanol-preserved samples from the same farm for sequence analysis. The only exception to this was the single Nicaraguan sample, which consisted of RF fixative-preserved tissue only. Archived TSV-infected P. vannamei tissues of Texas and Hawaii isolates (Tx TSV 1995 and Hi TSV 1994, Table 1) were used to induce experimental infections in specific-pathogen-free P. vannamei juveniles (∼6 g, n=6 per isolate) following published protocols (Hasson et al., 1995 ). The tails of moribund shrimp were frozen (-80 °C) for RNA extraction and cephalothoracies were injected with either Davidsons AFA or RF fixative for histological analysis (Bell & Lightner, 1988 ; Hasson et al., 1997 ).


Table 1. Summary of RTPCR, IHC and histological results of 20 different TSV geographic isolates


Total RNA was isolated from TSV-infected tail tissue (TRI Reagent, MRC) and cDNA was synthesized using an oligo(dT) primer in a 20 µl reaction volume (Omniscript Reverse Transcriptase, Qiagen). The CP1 and CP2 genes were amplified using TSV-specific primers (CP1F, 5' CAACAGAATTCAATCAGCCATAC 3', and CP1R, 5' ACGGTGTCTGCAACCCTTGAGAC 3', and CP2F, 5' CAGATATTCCAGTGAGTCCTGTC 3', and CP2R, 5' CACTGAGAATACACCGTCAGCTTC 3') (Robles-Sikisaka et al., 2001 ). The RTPCR mixture contained 3 µl cDNA, 1x PCR buffer, 1·5 mM MgCl2, 5 µM dNTPs, 0·4 µM of both forward and reverse primers and 2 U High Fidelity Platinum Taq Polymerase (Life Techologies) in a 50 µl reaction volume. PCR conditions were 94 °C for 2 min, followed by 35 cycles at 94 °C for 30 s, 55 °C for 30 s and 65 °C for 60 s. Amplified cDNAs were run in a 1% agarose gel, gel purified (QIAquick Gel Extraction kit, Qiagen) and sequenced using CP1F and CP2F primers in an ABI Prism 7700 automated DNA sequencer.

Multiple alignments of nucleotide and amino acid sequences were performed using CLUSTAL W (Thompson et al., 1994 ). Pairwise comparisons of nucleotide differences (transitions and transversions, pairwise distances) were calculated using MEGA, version 2.0 (Kumar et al., 2001 ). Bootstrapped neighbour-joining analyses of CP1 and CP2 nucleotide sequences were performed using MEGA with 1000 replicates.

TSV-infected samples from the USA, Taiwan, Mexico and Nicaragua were examined by haematoxylin and eosin (H&E) histopathology (Bell & Lightner, 1988 ) and 34 µm consecutive sections were analysed by IHC analysis using a TSV-specific mAb (DiagXotics) (Table 1). Following H&E staining, TSV lesion severity was graded on a scale from 1 (mild, focal) to 4 (severe multifocal to diffuse) (Hasson et al., 1995 , 1999a ). The IHC signals were qualitatively graded from 0 (no signal) to 4 (diffuse strong signal) (Hasson et al., 1999b ). TSV positive and negative control slides were included in each IHC assay.

CP1 (546 bp) and CP2 (584 bp) cDNAs were amplified from different geographical isolates of TSV. A total of 30 samples of CP1 and 33 samples of CP2 were successfully amplified and sequenced (Table 1). For some samples, only the CP1 but not the CP2 gene was successfully amplified, or vice versa (Table 1). This could be due to mutation in the primer-binding site(s) of the target amplicons.

Pairwise comparisons of nucleotide sequences showed 02·4% differences in the CP1 gene and 03·5% differences in the CP2 gene, indicating high sequence similarity among the isolates examined. High nucleotide similarity (90100%) has also been reported for insect picornaviruses (Johnson & Christian, 1999 ; King et al., 1984 ).

The CP1 amino acid sequence contained 7 conservative and 14 non-conservative changes. Among the non-conservative changes, substitution of Q (glutamine, polar uncharged) to K (lysine, positively charged) at position 104 was shared by 8 of the 30 sequences (Fig. 1A). All eight sequences originated from Mexico (Sonora and Sinaloa). The substitution of C (cysteine, polar uncharged) to F/W (phenylalanine/tryptophan, non-polar hydrophobic) at position 150 was shared by four Mexican isolates (Fig. 1A). The Taiwan isolate had two unique conservative substitutions, leucine to phenylalanine (L→F) and isoleucine to valine (I→V) at positions 83 and 97, respectively (Fig. 1A).


Table 1.


The CP2 amino acid sequences had 30 conservative and 11 non-conservative changes. Among the conservative replacements, substitution of glycine to serine (G→S) at position 6 was shared by 16 of 33 sequences and at position 11, methionine to leucine (M→L) was shared by 8 of 33 sequences (Fig. 1B). Among the non-conservative replacements, substitution of serine to alanine (polar uncharged to non-polar hydrophobic) was shared by 5 of 33 sequences. The Taiwan isolate had two unique non-conservative changes, asparagine (N, polar uncharged) to histidine (H, positively charged) and glutamic acid (G, positively charged) to alanine (A, non-polar hydrophobic) at positions 124 and 129 (Fig. 1B).

The non-conservative replacements in TSV CP1 and CP2 sequences may represent epitopes involved in antibody binding and, thus, contribute to serological differences among the isolates. Single point mutations altered the antigenicity in coxsackievirus B4 (Halim & Ramsingh, 2000 ), encephalomyocarditis virus (Nelsen-Salz et al., 1996 ) and foot-and-mouth disease virus (FMDV) (Mateu et al., 1988 ; 1990 ; Diez et al., 1989 ). Since shrimp, like other crustaceans, lack antibody-based immunity, point mutations in the CP1 and CP2 genes may provide TSV with a selective advantage for host adaptability or increased virulence. Minor changes in the capsid amino acid sequence were found to be advantageous for host adaptability in human influenza A virus (Fitch et al., 1991 ) and FMDV (Haydon et al., 2001 ; Martin et al., 1998 ). TSV epizootics in Sinaloa, Mexico reached a peak during 1996, followed by a steady decline and, by 1998, shrimp production in Sinaloa appeared to have stabilized. This decrease in TSV outbreaks was attributed to the farming of TSV-tolerant P. stylirostris instead of TSV-susceptible P. vannamei (Zarain-Herzberg & Ascencio-Valle, 2001 ). The replacement of P. vannamei with P. stylirostris in shrimp farms might have contributed to the development of a new strain(s) of TSV in Mexico as the virus adapted to a new host species.

Phylogenetic analysis of CP1 sequences grouped TSV isolates into two clusters, one consisting of USA (Hawaii and Texas), Taiwan and some Mexican isolates, whereas the other included only Mexican isolates (Fig. 1C). The Taiwanese isolate formed a subcluster with the isolates from Texas, Hawaii and Sonora (Son10A), indicating a possible common origin of these isolates. Isolates from Sonora and Sinaloa that shared the amino acid substitution Q→K at position 104 formed a subcluster with a high bootstrap value (94%) (Figs 1A, C).

Phylogenetic analyses of CP2 sequences also formed two clusters: one contained only Mexican isolates, whereas the other contained isolates from the USA, Taiwan and Mexico (Fig. 1D). Isolates from the USA, Taiwan and Sonora (Son10A) formed a subcluster supported with a 64% bootstrap value. Phylogenetic analyses of the CP1 and CP2 genes did not show any Sonora or Sinaloa region-specific isolates. Overall, the phylogenetic trees obtained for both genes showed a similar topology. Neighbour-joining analysis revealed that the Taiwanese isolate was closely related to the Mexican (Son 10A), Texan and Hawaiian isolates. TSV has recently been introduced into Taiwan through the import of contaminated post-larvae from Ecuador (Tu et al., 1999 ). It is likely that Mexican TSV isolates are similar to the Ecuadorian isolate and that such an isolate was introduced into Taiwan.

Neighbour-joining analysis showed that samples of isolates 5, 7, 10 and 18 fell into two different clusters (Fig. 1C, D and Table 1). Since multiple samples of an isolate were collected from the same farm pond (Table 1), the results indicate the existence of two TSV strains in that population, which may be due to the introduction of more than one strain in the same location.

Light microscopy of the 19 H&E-stained sections showed 10 acute, 3 transition and 6 chronic phase TSV infections with lesion severity ranging from moderate to severe (grades 24) (Table 1). IHC analysis of the same 19 samples revealed moderate to strong (grades 24) positive signals for Taiwan, Texan and Hawaiian isolates and negative signals for the Mexican and Nicaraguan isolates (Fig. 2). Neither host species (P. vannamei and P. stylirostris) nor infection phase appeared to adversely affect the IHC reaction (Table 1). Negative IHC results obtained for the Mexican and Nicaraguan TSV-infected specimens suggest that these isolates did not contain the epitope recognized by the mAb. This implies that, since the first report in 1992, TSV has mutated and more than one strain is present in the environment. The finding of a TSV variant that appears to be widespread in Mexico indicates the need for the development of a panel of mAbs or polyclonal antibodies that will react with this new strain.



(77K):

Fig. 2. Photomicrographs of consecutive acute or chronic phase TSV-infected tissue sections following analysis by H&E histology (left column) and IHC using a TSV-specific mAb (right column). (A, B) Lymphoid organ (LO) of a P. vannamei juvenile chronically infected with the Tx TSV 1995 isolate. Numerous LO spheroids are located to the left of and below a normal LO tubule (NT) and contain strong multifocal IHC-positive signals (blueblack precipitate). Davidsons fixative, 20x. (C, D) LO of a P. stylirostris juvenile submitted by a farm in Taiwan (2000) and displaying a chronic TSV infection. Small normal LO tubules are surrounded by large, irregularly shaped LO spheroids which display multifocal IHC-positive signals similar to those seen in (B). Davidsons fixative, 20x. (E, F) Midsaggital section through the anterior stomach of a P. vannamei juvenile infected with the Hi TSV 1994 isolate. The upper half of the photo displays a typical acute phase TSV infection of the cuticular epithelium (note pyknotic nuclei) and the lower half illustrates normal uninfected epithelium. TSV presence in the necrotic region is denoted by the strong IHC signal. RF fixative, 60x. (G, H) Midsaggital section through the paragnath of a P. stylirostris juvenile submitted by a farm in Mexico (Sonora), 2000. The pathodiagnostic acute phase TSV lesion is characterized by nuclear pyknosis, cytoplasmic eosinophilia and detachment of the infected cuticular epithelial cells from the surrounding matrix, in contrast to normal uninfected epithelium located to the far left. IHC analysis produced a negative result, denoted by the absence of blueblack precipitate. Davidsons fixative, 60x. Histological sections were stained with H&E. Sections analysed by IHC were counter-stained with Bismarck brown.

Our data support the hypothesis that a new TSV strain has emerged in the Americas and is pathogenic to P. stylirostris, a penaeid species considered previously to be TSV tolerant (Lightner, 1996 ; Brock et al., 1995 , 1997 ). The negative IHC results of the TSV-infected Nicaraguan P. stylirostris sample suggest that this or a similar TSV strain might have developed in that country in 1997. The apparent ability of TSV to adapt to a new penaeid host is significant because some Asian penaeid species (P. monodon, P. japonicus and P. chinensis), currently considered to be TSV tolerant, may be at risk following the introduction of TSV into Taiwan.
The work presented here includes part of the thesis work in fulfillment of MS degree by the first author (R.R.-S.). R.R.-S. acknowledges the fellowship from CONACyT, Mexico. The research was partially funded by a grant from CSUPERB, California to D.K.G. and A.K.D. Super Shrimp, Inc. also provided partial funding. We thank Dr Luis Matheu Wyld, Guatemala, who is credited with initially developing the IHC method for TSV detection utilizing a commercially available TSV-specific mAb. The authors also thank Dr John Reddington, DiagXotics, and Dr Donald Lightner, University of Arizona, for contributing IHC reagents and TSV samples (Texas, Hawaii, Nicaragua).

Footnotes

a Present address: Aqua Bounty Pacific, 8355 Aero drive, Lab 17, San Diego CA 92123, USA.

References

Anon (1996). Taura syndrome virus strikes South Carolina. American Fisheries Society. Fish Section Newsletter 15, 2.

Bell, T. A. & Lightner, D. V. (1988). A Handbook of Normal Penaeid Shrimp Histology, p. 114. World Aquaculture Society, Baton Rouge, LA, USA.

Bonami, J. R., Hasson, K. W., Mari, J., Poulos, B. T. & Lightner, D. V. (1997). Taura syndrome of marine penaeid shrimp: characterization of the viral agent. Journal of General Virology 78, 313-319.[Abstract]

Brock, J. A. (1997). Special topic review: Taura syndrome, a disease important to shrimp farms in the Americas. World Journal of Microbiology and Biotechnology 13, 415-418.

Brock, J. A., Gose, R. B., Lightner, D. V. & Hasson, K. W. (1995). An overview on Taura syndrome, an important disease of farmed Penaeus vannamei. In Swimming Through Troubled Water, Proceedings of the Special Session on Shrimp Farming, Aquaculture 1995, pp. 8494. Edited by C. L. Browdy & J. S. Hopkins. World Aquaculture Society, Baton Rouge, LA, USA.

Brock, J. A., Gose, R. B., Lightner, D. V. & Hasson, K. W. (1997). Recent developments and an overview of Taura syndrome of farmed shrimp in the Americas. In Diseases in Asian Aquaculture III, pp. 275283. Edited by T. W. Flegel & I. H. MacRae, Asian Fisheries Society, Manila.

Diez, J., Mateu, M. G. & Domingo, E. (1989). Selection of antigenic variants of foot-and-mouth disease virus in the absence of antibodies, as revealed by an in situ assay. Journal of General Virology 70, 3281-3289.[Abstract/Free Full Text]

Fitch, W. M., Leiter, J. M., Li, X. O. & Palese, P. (1991). Positive Darwinian evolution in human influenza A viruses. Proceedings of the National Academy of Sciences, USA 88, 4270-4274.[Abstract/Free Full Text]

Halim, S. & Ramsingh, A. I. (2000). A point mutation in VP1 of coxsackievirus B4 alters antigenicity. Virology 269, 86-94.[Medline]

Hasson, K. W., Lightner, D. V., Poulos, B. T., Redman, R. M., White, B. L., Brock, J. A. & Bonami, J. R. (1995). Taura syndrome in Penaeus vannamei: demonstration of a viral etiology. Diseases of Aquatic Organisms 23, 115-126.

Hasson, K. W., Hasson, J., Aubert, H., Redman, R. M. & Lightner, D. V. (1997). A new RNA-friendly fixative for the preservation of penaeid shrimp samples for virological detection using cDNA genomic probes. Journal of Virological Methods 66, 227-236.[Medline]

Hasson, K. W., Lightner, D. V., Mari, J., Bonami, J. R., Poulos, B. T., Mohoney, L. L., Redman, R. M., White, B. L. & Brock, J. A. (1999a). Taura syndrome virus (TSV) lesion development and the disease cycle in the Pacific white shrimp Penaeus vannamei. Diseases of Aquatic Organisms 36, 81-93.

Hasson, K. W., Lightner, D. V., Mari, J., Bonami, J. R., Poulos, B. T., Mohoney, L. L., Redman, R. M., White, B. L. & Brock, J. A. (1999b). The geographic distribution of Taura syndrome virus (TSV) in the Americas: determination by histopathology and in situ hybridization using TSV-specific cDNA probes. Aquaculture 171, 13-26.

Haydon, D. T., Bastos, A. D., Knowles, N. J. & Samuel, A. R. (2001). Evidence for positive selection in foot-and-mouth disease virus capsid genes from field isolates. Genetics 157, 7-15.[Abstract/Free Full Text]

Johnson, K. N. & Christian, P. D. (1999). Molecular characterization of Drosophila C virus isolates. Journal of Invertebrate Pathology 73, 248-254.[Medline]

King, L. A., Massalski, P. R., Cooper, J. I. & Moore, N. F. (1984). Comparison of the genome RNA sequence homology between cricket paralyses virus and strains of Drosophila C virus by complementary DNA hybridization analysis. Journal of General Virology 65, 1193-1196.

Kumar, S., Tamura, K. & Nei, M. (2001). Molecular evolutionary genetics analysis (MEGA), version 2.0. Institute of Molecular Evolutionary Genetics, Arizona State University, Arizona, USA.

Lightner, D. V. (1996). A Handbook of Shrimp Pathology and Diagnostic Procedures for Diseases of Cultured Penaeid Shrimp, p. 304. World Aquaculture Society, Baton Rouge, LA, USA.

Mari, J., Poulos, B. T., Lightner, D. V. & Bonami, J.-R. (2002). Shrimp Taura syndrome virus, genomic characterization and similarity with member of the genus Cricket paralysis-like viruses. Journal of General Virology 83, 915-926.[Abstract/Free Full Text]

Martin, M. J., Nuñez, J. I., Sobrino, F. & Dopazo, J. (1998). A procedure for detecting selection in highly variable viral genomes: evidence of positive selection in antigenic regions of capsid protein VP1 of foot-and-mouth disease virus. Journal of Virological Methods 74, 215-221.[Medline]

Mateu, M. G., Silva, D. A., Rocha, E., De Braum, D. L., Alonso, A., Enjuanes, L., Domingo, E. & Barahona, H. (1988). Extensive antigenic heterogeneity of foot-and-mouth disease virus serotype C. Virology 167, 113-124.[Medline]

Mateu, M. G., Martinez, M. A., Capucci, L., Andreu, D., Giralt, E., Sobrino, F., Brocchi, E. & Domingo, E. (1990). A single amino acid substitution affects multiple epitopes in the major antigenic site of foot-and-mouth disease virus of serotype C. Journal General Virology 71, 629-637.[Abstract/Free Full Text]

Nelsen-Salz, B., Zimmermann, A., Wickert, S., Arnold, G., Botta, A., Eggers, H. J. & Kruppenbacher, J. P. (1996). Analysis of sequence and pathogenic properties of two variants of encephalomyocarditis virus differing in a single amino acid in VP1. Virus Research 41, 109-122.[Medline]

Overstreet, R. M., Lightner, D. V., Hasson, K. W., McvIlwain, S. & Lotz, J. M. (1997). Susceptibility to Taura syndrome virus of some penaeid shrimp species native to the Gulf of Mexico and the Southeastern United States. Journal of Invertebrate Pathology 69, 165-176.[Medline]

Robles-Sikisaka, R., Garcia, D. K., Klimpel, K. R. & Dhar, A. K. (2001). Nucleotide sequence of 3'-end of the genome of Taura syndrome virus of shrimp suggests that it is related to insect picornaviruses. Archives of Virology 146, 941-952.[Medline]

Thompson, J. D., Higgins, D. J. & Gibson, T. J. (1994). CLUSTALW: Improving sensitivity of the progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Research 22, 4673-4680.[Abstract/Free Full Text]

Tu, C., Huang, H.-T., Chuang, S.-H., Hsu, J.-P., Kuo, S.-T., Li, N.-J., Hsu, T.-L., Li, M.-C. & Lin, S.-Y. (1999). Taura syndrome in Pacific white shrimp Penaeus vannamei cultured in Taiwan. Diseases of Aquatic Organisms 38, 159-161.

Zarain-Herzberg, M. & Ascencio-Valle, F. (2001). Taura syndrome in Mexico: follow-up study in shrimp farms of Sinaloa. Aquaculture 193, 1-9.

Received 26 March 2002; accepted 20 August 2002.