Research Article

Stability in vitro of the 69K movement protein of Turnip yellow mosaic virus is regulated by the ubiquitin-mediated proteasome pathway

Journal of General Virology 2002; 83(12):3187

PubMed

With thanks to our partners for supporting this archive.

Abstract

Plant viruses move to adjacent cells with the use of virus-encoded cell-to-cell movement proteins. Using proteins produced by in vitro translation, we present evidence that the 69K movement protein of Turnip yellow mosaic virus (TYMV) is recognized as a substrate for the attachment of polyubiquitin chains and for subsequent rapid and selective proteolysis by the proteasome, the ATP-dependent proteolytic system present in reticulocyte lysate. Truncation of the 69K protein suggests the existence of two degradation signals within its sequence. We propose that selective degradation of virus movement proteins may contribute to the previously reported transient nature of their accumulation during infection.

Top

Following replication within the initially infected cells, plant viruses move to adjacent cells through intercellular connections, the plasmodesmata, with the use of virus-encoded cell-to-cell movement proteins (MPs) (reviewed in Maule, 1991 ; Lazarowitz & Beachy, 1999 ). The MPs of many different plant viruses have been widely studied, and despite the lack of conserved protein motifs among the MPs from different virus families (Mushegian & Koonin, 1993 ), they possess a number of common properties, and can often complement each other (reviewed in Hull, 1989 ). To date, the best studied MP is the 30K protein of Tobacco mosaic virus (TMV) (Deom et al., 1987 ; reviewed in Rhee et al., 2000 ).

Characteristics commonly found in MPs are their ability to bind single-stranded nucleic acids in vitro (Citovsky et al., 1990 ) and to increase the size exclusion limit of plasmodesmata (Wolf et al., 1989 ). In the case of TMV, the MP was demonstrated to colocalize with the cytoskeleton both in vitro and in the context of virus infection (McLean et al., 1995 ; Heinlein et al., 1995 ). More recently, its interaction with plant cell wall pectin methylesterases has also been reported (Chen et al., 2000 ). Based on these observations, the following sequence of events has been suggested: the MP is thought to form complexes with the transported viral RNA, move these complexes throughout the cell using the cytoskeletal network, associate with the cell wall, increase plasmodesmatal permeability and transverse the enlarged plasmodesmatal channels (reviewed in Rhee et al., 2000 ). The exact mechanism of action is, however, still hypothetical.

It has been proposed that MP activity within infected cells may be negatively regulated in order to prevent continuous interference with host plant intercellular communication. Indeed, the MPs of a number of viruses were found to accumulate only transiently during early and mid-stages of virus infection (Lehto et al., 1990a ; reviewed in Maule, 1991 ). In the case of TMV, the timing of 30K expression, rather than its level of accumulation, was found to be critical in determining the efficiency of virus movement (Lehto et al., 1990b ). Because the selective degradation of proteins is a recurrent theme in regulatory mechanisms involving timing control (Hershko, 1996 ; Hochstrasser, 1996 ), it is possible that rapid degradation of the virus MP may contribute to the transient nature of its accumulation during viral infection. In this respect, it has recently been reported that the TMV MP is degraded in vivo through a proteasome-dependent degradation pathway (Reichel & Beachy, 2000 ). Apart from the latter protein, however, no information has been reported to date concerning the processes by which the transient accumulation of MPs operates.

Here, we address this question by studying the MP of Turnip yellow mosaic virus (TYMV), the type member of the tymovirus group. TYMV is a small spherical plant virus that infects members of the Cruciferae. It possesses a monopartite positive-strand RNA genome of 6318 nucleotides, which directs the expression from two extensively overlapping open reading frames (ORFs) of nonstructural proteins of 69 and 206 kDa (Morch et al., 1988 ). A third ORF encodes the 20 kDa coat protein which is expressed from a subgenomic RNA. The 69 kDa (69K) protein is necessary for cell-to-cell movement and systemic spread of the virus within the plant (Bozarth et al., 1992 ). It shares several common characteristics with MPs of other viruses, and the level of 69K protein in infected plants was found to decline as infected leaves expand and mature (Bozarth et al., 1992 ).

We have examined the turnover of the TYMV 69K movement protein in rabbit reticulocyte lysate (RRL) with the goal of obtaining information that will facilitate future studies with infected cells. This in vitro system was selected because it has been employed as a model system for examination of cellular proteins which are rapidly degraded (reviewed in Hershko, 1996 ) and it has been used extensively in studies of the synthesis of plant viral proteins, including those of TYMV (Morch et al., 1989 ; Rozanov et al., 1995 ).

Using proteins produced by in vitro translation, we present evidence that the TYMV 69K protein is recognized as a substrate for the attachment of polyubiquitin chains and for subsequent rapid and selective proteolysis by the proteasome, the ATP-dependent proteolytic system present in reticulocyte lysate.

Top

Construction of plasmids.. All DNA manipulations were performed using standard techniques (Ausubel et al., 1987 ; Sambrook et al., 1989 ). Plasmids TYFL7, C783S and TYFL814, from which genomic length transcripts corresponding to the entire genome of TYMV can be obtained, were described previously (Rozanov et al., 1995 ; Boyer et al., 1993 ). Plasmid E17 was constructed by digesting pTYFL7 with SmaI and EcoRI and inserting the corresponding 263 nucleotide SmaIEcoRI fragment of TYFL814, therefore removing the 75 non-viral nucleotides present at the 3' terminus of the TYMV cDNA copy. To obtain E17-206K-stop, a DNA fragment was amplified by PCR using Pfu DNA polymerase (Promega) and primers 5' GGAAACAGCTATGACCATG 3' and 5' GAATGGACCATGGGTAGGTCTGTATCTAGGAGCGAATTG 3', which hybridize to E17. After digestion with HindIII and NcoI, the 230 nucleotide fragment was cloned in the similarly restricted E17 to create E17-206K-stop, in which a stop codon truncates the 206K ORF at amino acid 33 without modification of the 69K ORF.

Plasmid E17-ΔN was obtained by digestion of E17 with MfeI and PstI, followed by insertion of the adaptor 5' AATTCTAGAATGCCTGCA 3'. Plasmid E17-206K-stop-ΔN was constructed by digesting E17-206K-stop with MfeI and NcoI followed by Klenow filling-in and religation. Constructs were verified by sequencing with an ABI PRISM 377 DNA sequencer (Applied Biosystem) using a BigDye Terminator Sequencing kit and specific primers.

In vitro transcription.. Capped in vitro transcripts were obtained from linearized DNA templates using the Message Machine Transcription system (Ambion) according to the supplier's instructions.

Preparation of in vitro translation products.. In vitro translation reactions of viral RNA or in vitro transcripts were carried out in micrococcal nuclease-treated reticulocyte lysate with conditions based upon those previously described (Morch et al., 1989 ). A typical reaction mixture (10 µl) contained 250 ng of TYMV RNA or 200 ng of in vitro transcript in 50% (v/v) reticulocyte lysate supplemented with 25 µM of each amino acid except methionine and cysteine. Labelled proteins were prepared by including 530 kBq of a mixture of L-[35S]methionine and L-[35S]cysteine (Pro-Mix, Amersham; 37 TBq/mmol) in the reaction mixture. Alternatively, an amino acid mixture without leucine was used together with 2·8 kBq L-[14C]leucine (Amersham, 11 GBq/mmol). Incubations were performed at 30 °C for 1 h and terminated by the addition of Laemmli sample buffer (Laemmli, 1970 ). Translation products were analysed by 10, 12·5 or 15% SDSPAGE. Gels were fixed, dried and exposed to film or analysed by Storm PhosphorImager (Molecular Dynamics).

Assays for protein degradation.. The stability of the proteins synthesized in reticulocyte lysate was evaluated using previously described methods (Oberst et al., 1993 ; Orian et al., 1995 ) with minor modifications. Following incubation for 1 h at 30 °C, the translation reactions were terminated by addition of 1/10 vol. of mix stop (20 mM methionine, 20 mM cysteine, 1 mg/ml cycloheximide, 500 µg/ml RNase A), followed by a further 15 min incubation at 37 °C. The stability of the proteins was then monitored by incubating 2·2 µl of terminated translation mixture in 11 µl reaction mixtures containing 40 mM TrisHCl pH 7·5, 5 mM KCl, 5 mM MgCl2, 2 mM DTT, 0·5 mM ATP, 10 mM creatine phosphate, 200 µg/ml creatine kinase, 40 µg/ml (5 µM) ubiquitin (Ub; Sigma) in 3050% (v/v) untreated reticulocyte lysate or 2 mg/ml reticulocyte fraction II (Affiniti). Control samples were processed similarly, except that untreated reticulocyte lysate was omitted from the reaction mixture. The mixtures were incubated further at 37 °C for the indicated period of time and, after addition of Laemmli sample buffer, the samples were resolved by SDSPAGE and analysed as described above. The loss of labelled proteins during the incubations was quantified with a PhosphorImager and ImageQuant software (Molecular Dynamics). The amount of radioactivity present in the zero-time samples after addition of untreated lysate was taken to represent 100% of the labelled protein present at the beginning of the incubation.

MG132 [(Cbz-LLLal), carbobenzoxyl-leucinyl-leucinyl-leucinal] (Calbiochem) was dissolved in DMSO and proteasomal degradation was determined by adding either 1% DMSO or 1% DMSO plus 100 µM MG132 to the degradation assay.

Measurement of the effects of ATP analogues on degradation.. ATP-dependent processing was performed in the presence of 0·5 or 2 mM ATP, 10 mM phosphocreatine and 0·2 mg/ml creatine kinase. Mixtures were incubated for the indicated period of time on ice or at 37 °C. Enzymatic ATP depletion was accomplished by adding 10 mM deoxyglucose and 20 µg/ml of hexokinase to the degradation assays. The effect of ATP analogue was assayed by substituting 10 mM ATPγS [adenosine 5'-O-(3-thiotriphosphate)] (Roche) for ATP and the ATP-regenerating system. Following incubation, aliquots from the reaction mixtures were resolved by SDSPAGE and analysed as described above.

Detection of Ub conjugates.. Translation was carried out in nuclease-treated rabbit reticulocyte lysate at 30 °C in the presence of L-[14C]leucine and 1 µM Ub aldehyde (Affiniti), either alone or with added 20 µM Ub (Sigma) or 200 µM methylated Ub (Affiniti). Aliquotes of 8 µl were removed at the indicated times and subjected to SDSPAGE as described above.

For immunoprecipitation, the translation mixture (20 µl) was mixed with Laemmli sample buffer and boiled for 10 min. The sample was then diluted to 300 µl with IP1 buffer (20 mM TrisHCl pH 7·5, 150 mM NaCl, 5 mM EDTA, 0·1% sodium deoxycholate, 0·5% NP40) and 4 µl of an antiserum raised against the 69K protein (Séron et al., 1996 ). After overnight incubation at 4 °C, the antigenantibody complexes were precipitated with Pansorbin (Calbiochem) according to the supplier's instructions. After washes in IP2 buffer (20 mM TrisHCl pH 7·5, 150 mM NaCl, 5 mM EDTA, 0·1% SDS) and IP3 buffer (20 mM TrisHCl pH 7·5, 0·1% NP40) the immunoprecipitates were separated by SDSPAGE as described above.

Top

Stability of TYMV-encoded proteins in the RRL system
The stability of the TYMV-encoded proteins was studied in the RRL system. This in vitro system was selected because it has been employed as a model system for examination of cellular proteins which are rapidly degraded (Hershko et al., 1983 ; reviewed in Hershko, 1996 ) and the reticulocyte Ub-mediated degradation process is therefore one of the most thoroughly characterized. In addition, RRL has been used extensively in studies of the synthesis and processing of TYMV-encoded proteins (Morch et al., 1989 ; Bransom et al., 1991 ; Rozanov et al., 1995 ). In particular, it has been shown that the 206K protein undergoes co-translational proteolytic processing that gives rise to two protein products of 140 kDa (140K) and 66 kDa (66K) (Morch et al., 1989 ; Bransom et al., 1991 ).

35S-Labelled TYMV-encoded proteins were synthesized in RRL, followed by SDSPAGE analysis and autoradiography. As expected, proteins corresponding to the 69K MP, to the 206K polyprotein and its self-processed products 140K and 66K, were produced by translation of TYMV RNA (Fig. 1a, lane 1). In addition to the major viral proteins, translation of TYMV RNA typically gives rise to the synthesis of several minor bands that are most likely incomplete in vitro translation products (Morch et al., 1989 ).



(43K):

Fig. 1. Stability of TYMV-encoded proteins in the RRL system. (a) TYMV viral RNA was translated for 1 h in nuclease-treated RRL in the presence of [35S]Met and [35S]Cys. After termination of translation, the reaction mixtures were incubated in the presence of either untreated RRL (3050% of total volume) or added buffer as described in Methods. Aliquots were removed at various times and the samples were then analysed by 10% SDSPAGE and autoradiography. Lane 1, TYMV translation products prior to incubation. Incubations were performed in the presence of RRL at 30% (lanes 24), 40% (lanes 57) or 50% (lanes 810) of total volume or in the presence of buffer (lanes 1113). Aliquots were removed at 0 min (lanes 2, 5, 8 and 11), 45 min (lanes 3, 6, 9 and 12) and 105 min (lanes 4, 7, 10 and 13). The incubation times are indicated at the top of the lanes. Bands corresponding to the viral proteins 206K, 140K, 69K and 66K are indicated. (b) Comparison of the stabilities of the 206K, 140K, 69K and 66K TYMV-encoded proteins in the presence of added untreated RRL (50% of total volume). The reaction mixtures were prepared, analysed by SDSPAGE and quantified as described in Methods.

The stability of the viral proteins was then monitored by incubating the terminated translation mixtures for various times in the presence of either added buffer or untreated RRL. As shown in Fig. 1(a), lanes 1113, incubation in the presence of added buffer resulted in little degradation of the viral proteins. This is consistent with the fact that the nuclease-treated RRL used for in vitro translation contains haemin, which is an inhibitor of protein degradation (Etlinger & Goldberg, 1980 ; Haas & Rose, 1981 ). However, protein degradation can be restored by addition of untreated RRL, which provides an active proteolytic system. In these conditions, and with percentages of added untreated RRL varying from 30 to 50% of the final reaction mixture volume, the TYMV 69K protein rapidly disappeared from the reaction mixture (Fig. 1a, lanes 210).

To determine if the instability of the TYMV 69K protein is a characteristic unique to this protein, the percentages of the viral 206K, 140K, 66K and 69K proteins remaining in the reaction mixtures were measured as a function of time and their rates of degradation were quantitatively compared. As shown in Fig. 1(b), on addition of untreated RRL the 69K protein disappeared with a half-life of about 25 min. The other viral products all appeared to have a half-life of ∼3 to 4 h. Both the rate and extent of disappearance of the 69K protein were similar in the presence of various batches of RRL (data not shown). This demonstrates that the TYMV 69K protein is selected for rapid degradation by the reticulocyte proteolytic machinery.

Degradation of the 69K protein is independent of the TYMV-encoded proteinase domain
The TYMV 206K protein has been shown to contain a papain-like cysteine proteinase domain that is involved in its self-processing (Bransom & Dreher, 1994 ; Rozanov et al., 1995 ). Therefore, the question arises whether this proteinase domain might be involved, either directly or indirectly, in degradation of the 69K protein, or whether the proteolytic system responsible resides exclusively in the reticulocyte lysate. To answer this question, transcripts that correspond to the viral genome and encode wild-type proteinase (E17) or mutated transcripts carrying a point mutation in the proteinase active site (C783S) (Rozanov et al., 1995 ) were translated in vitro. Debilitation of the viral proteinase proteolytic activity of C783S is evident from the lack of processing of 206K protein into the 140K and 66K cleavage products (Fig. 2, lane 7), as previously reported (Rozanov et al., 1995 ). On addition of untreated RRL to completed translation mixtures, the 69K proteins encoded by both transcripts were degraded at similar rates (Fig. 2, lanes 49). This observation was further confirmed by translation of E17-206K-stop transcripts in which synthesis of the 206K protein is abolished by introduction of a nonsense codon at nucleotides 194196 of the viral genome. Degradation of the 69K protein encoded by such transcripts (Fig. 2, lanes 1012) was unaffected by the lack of 206K protein, therefore demonstrating that the TYMV-encoded proteinase activity is not required for the rapid degradation of the 69K protein in this system.



(90K):

Fig. 2. Degradation of the 69K protein is independent of the TYMV-encoded proteinase domain. TYMV viral RNA or in vitro transcripts were translated for 1 h in nuclease-treated RRL in the presence of [35S]Met and [35S]Cys. After termination of translation, the reaction mixtures were incubated in the presence of untreated RRL (50% of total volume) as described in Methods. Aliquots were removed at various times and the samples were then analysed by 10% SDSPAGE and autoradiography. Templates were TYMV RNA (lanes 13) or in vitro transcripts deriving from plasmids E17 (lanes 46), C783S (lanes 79) and E17-206K-stop (lanes 1012). Aliquots were removed at 0 min (lanes 1, 4, 7 and 10), 30 min (lanes 2, 5, 8 and 11) and 60 min (lanes 3, 6, 9 and 12). The incubation times are indicated at the top of the lanes. Bands corresponding to the viral proteins 206K, 140K, 69K and 66K are indicated.

Degradation of the 69K protein is dependent upon 26S proteasome and ATP hydrolysis
The best characterized mechanism for the selection and degradation of short-lived proteins in eukaryotic cells is the Ub-mediated proteolytic system (reviewed in Hershko & Ciechanover, 1998 ). This multicomponent system, which has been most extensively studied in RRL and yeast, targets substrate proteins for degradation by covalent attachment of the polypeptide Ub. The proteolytic degradation process of poly-Ub-marked proteins is then accomplished by the 26S proteasome, a very large ATP-requiring multicatalytic cellular protease complex (reviewed in Voges et al., 1999 ). Experiments were carried out to assess the involvement of the proteasome in the TYMV 69K protein turnover.

Previous studies on Ub conjugation and proteolysis in vitro have predominantly employed RRL fraction II (Ciechanover et al., 1978 ). Fraction II contains the 26S proteasome complex and supports the ATP-dependent conjugation and degradation of target proteins, as long as ATP and Ub are provided. As shown in Fig. 3 (lanes 24), RRL fraction II with added Ub and an energy-generating system readily supported degradation of the TYMV 69K protein. Since the turnover of proteins by the 26S proteasome degradation complex requires energy produced by the hydrolysis of ATP (Hershko et al., 1980 ), degradation of the 69K protein was assayed in the absence or presence of ATP, and incubation was carried out at 37 or 0 °C. As can be seen in Fig. 3, incubation on ice (lanes 57) or ATP depletion (lanes 810) both considerably reduced the rate at which the 69K protein was degraded. It thus appears that the system which degrades the TYMV 69K protein requires ATP hydrolysis. This conclusion is further supported by degradation assays performed in the presence of ATPγS, an ATP analogue that supports conjugation of Ub to substrate proteins but does not sustain the ATP-dependent functioning of the 26S proteasome complex (Johnston & Cohen, 1991 ). As shown in Fig. 3 (lanes 1113) the presence of the analogue inhibited the degradation of 69K protein by RRL fraction II.



(97K):

Fig. 3. Degradation of the 69K protein requires ATP hydrolysis. TYMV viral RNA was translated in nuclease-treated RRL for 1 h in the presence of [35S]Met and [35S]Cys. After termination of translation, the reaction mixtures were incubated in the presence of RRL fraction II as described in Methods. Aliquots were removed at various times and the samples were then analysed by 10% SDSPAGE and autoradiography. Lane 1, TYMV translation products prior to incubation. Incubations were performed in the presence of 0·5 mM ATP (lanes 24), 2 mM ATP (lanes 57), without ATP (lanes 810) or with 10 mM ATPγS (lanes 1113). Incubations were performed at 37 °C (lanes 24 and 813) or 0 °C (lanes 57). Aliquots were removed at 0 min (lanes 2, 5, 8 and 11), 30 min (lanes 3, 6, 9 and 12) and 60 min (lanes 4, 7, 10 and 13). The incubation times are indicated at the top of the lanes. Bands corresponding to the viral proteins 206K, 140K, 69K and 66K are indicated.

Additional evidence for involvement of the proteasome was obtained by use of the peptide analogue MG132, a specific inhibitor of proteasome proteolytic activity (Lee & Goldberg, 1996 ). As can be seen from Fig. 4 the presence of MG132 throughout the incubation period (lanes 46) significantly reduced the extent of degradation of TYMV 69K protein as compared to degradation assays containing solvent only (lanes 13). Altogether, these results indicate that degradation of the TYMV 69K protein is an ATP-dependent process that is accomplished by the 26S proteasome complex.



(70K):

Fig. 4. Degradation of the 69K protein requires proteasome activity. In vitro transcript E17-206K-stop was translated for 1 h in nuclease-treated RRL in the presence of [35S]Met and [35S]Cys. After termination of translation, the reaction mixtures were incubated in the presence of untreated RRL (50% of total volume) with or without added 100 µM MG132 as described in Methods. Aliquots were removed at various times and the samples were then analysed by 10% SDSPAGE and autoradiography. Incubations were performed in the presence of 1% DMSO (lanes 13) or 1% DMSO plus 100 µM MG132 (lanes 46). Aliquots were removed at 0 min (lanes 1 and 4), 30 min (lanes 2 and 5) and 60 min (lanes 3 and 6). The incubation times are indicated at the top of the lanes.

Evidence for conjugation of the 69K protein with Ub
The great majority of proteins that are degraded by the 26S proteasome are targeted for degradation by multiple Ub conjugation (reviewed in Pickart, 1997 ). Ubiquitination involves the covalent conjugation of Ub, a highly conserved 76 amino acid residue protein, to the target protein via an isopeptide bond between the C terminus of Ub and the ε-amino group of one or more lysine residues of the protein. The linkage of the first Ub moiety is usually followed by the sequential conjugation of additional Ub molecules by isopeptide linkages between the ε-amino group of a specific lysine residue of Ub and the C-terminal carboxylic acid group of the next molecule in the chain. Such poly-Ub chains appear to be essential for recognition and subsequent degradation by the proteasome of the target protein.

Experiments were therefore designed to evaluate the possibility that 69KUb conjugates may be generated in RRL. To improve the detection of the 69K-derived products, in vitro translation of E17-206K-stop transcripts was performed in the presence of [14C]leucine, because the 69K protein encodes many more leucines than methionines and cysteines. Since Ub conjugation occurs concurrently with degradation of the modified proteins and with disassembly of the poly-Ub chains by deubiquinating activities present in cell lysates, it may be necessary to inactivate both proteasomal proteases and Ub-cleaving isopeptidases in order to detect ubiquitinated proteins (Mimnaugh et al., 1999 ). For this reason, conjugation was analysed in the presence of ubiquitin aldehyde (Ubal), an inhibitor of Ub-cleaving isopeptidases (Hershko & Rose, 1987 ), using haemin-inhibited RRL as a source of conjugating enzymes. As shown in Fig. 5, translation of E17-206K-stop transcripts revealed the appearance of labelled species with molecular masses greater than that of the TYMV 69K protein. These smears of labelled species are characteristic of the formation of a heterogeneous mixture of poly-Ub69K conjugates as a consequence of progressive addition of single Ub molecules to multiple lysine residues or to poly-Ub chains of various lengths (Mimnaugh et al., 1999 ). Without Ubal (Fig. 5, lanes 5 and 9), the steady-state level of conjugate accumulation led to products that accumulated in the ∼150 kDa region of the gel. The size of Ubprotein conjugate intermediates was increased substantially (>200 kDa) when Ubal was added to the reaction (Fig. 5, lanes 6 and 10). This effect was further amplified in the presence of supplementary free Ub (Fig. 5, lanes 7 and 11), where the smears of multiubiquitinated material extended toward the top of the gel. Further evidence for ubiquitination of the 69K protein was obtained by including methylated ubiquitin (MeUb) in the reaction mixtures. The blocked amine groups allow MeUb to become incorporated into conjugates with other proteins, but the subsequent conjugation of additional Ub molecules is prevented (Hershko & Heller, 1985 ). Under the conditions employed, MeUb may be linked to free amino groups of the native Ub present in the RRL to form mixed conjugates. Indeed, incubation in the presence of MeUb resulted in the generation of discrete higher molecular mass products (Fig. 5, lane 12, indicated by *), whose spacing was consistent with the synthesis of a classical ladder of 69KUb conjugates. Those products were readily immunoprecipitated by an antiserum raised against the 69K protein (Fig. 5, lane 13), therefore providing evidence for Ub conjugation of the 69K protein in RRL.



(91K):

Fig. 5. Evidence for conjugation of the 69K protein with Ub. In vitro transcript E17-206K-stop was translated in nuclease-treated RRL in the presence of [14C]Leu. Incubations were performed in the presence or absence of Ubal, with or without added Ub or MeUb as described in Methods. Aliquots were removed at various times and the samples were analysed by 10% SDSPAGE and autoradiography. Incubations were performed without Ubal (lanes 1, 5 and 9) or with 1 µM Ubal (lanes 24, 68 and 1013) in the presence of added 20 µM Ub (lanes 3, 7 and 11) or 200 µM MeUb (lanes 4, 8, 12 and 13). Translation products made in the presence of Ubal and MeUb were immunoprecipitated with the anti-69K antiserum and Pansorbin (lane 13). Aliquots were removed at 30 min (lanes 14), 90 min (lanes 58) and 180 min (lanes 913). The incubation times are indicated at the top of the lanes. Conj. denotes Ub conjugates, Ori denotes origin of the resolving gel. The asterisks on the right indicate the location of MeUb conjugates.

Mapping the region of the 69K protein that governs degradation
Degradation signals (degrons) usually comprise two essential and separable determinants: an amino acid or conformational primary determinant that functions as a binding site for a substrate recognition factor, and one or more internal lysine residues that are the sites of ubiquitylation (reviewed in Kornitzer & Ciechanover, 2000 ). Experiments were carried out to identify degrons present within the TYMV 69K protein. We initially examined the behaviour of an N-terminal deletion of the 69K protein (69KΔ1) encoded by the plasmid E17-ΔN, as well as several C-terminal deletion mutants of the 69K protein (69KΔ2 to 69KΔ6) that were prepared by translating a series of 3'-terminally truncated RNA transcripts obtained by run-off transcription of appropriately digested E17-206K-stop plasmid (Fig. 6a). As shown in Fig. 6(b) (lanes 121), translation products were obtained and were all efficiently degraded upon addition of untreated RRL.



(32K):

Fig. 6. Localization of sequences governing degradation of the 69K protein. (a) Diagram summarizing the primary structures of the proteins used in (b). Positions of lysine residues are indicated by dots. The expected molecular mass of each translation product is indicated on the right. (b) The plasmids E17-ΔN, E17-206K-stop and E17-206K-stop-ΔN were linearized at various restriction sites and the corresponding in vitro transcripts were translated for 1 h in nuclease-treated RRL in the presence of [35S]Met and [35S]Cys. After termination of translation, the reaction mixtures were incubated in the presence of untreated RRL (50% of total volume) as described in Methods. Aliquots were removed at various times and the samples were then analysed by 12·5% (lanes 19) or 15% (lanes 1024) SDSPAGE and autoradiography. Templates were in vitro transcripts obtained after digestion of the plasmid E17-ΔN with AgeI (lanes 1012), plasmid E17-206K-stop with AgeI (lanes 13), PstI (lanes 46), AccI (lanes 79), BsrGI (lanes 1315), AvaI (lanes 1618) and BsmFI (lanes 1921) and plasmid E17-206K-stop-ΔN digested with AccI (lanes 2224). Aliquots were removed at 0 min (lanes 1, 4, 7, 10, 13, 16, 19 and 22), 30 min (lanes 2, 5, 8, 11, 14, 17, 20 and 23) and 60 min (lanes 3, 6, 9, 12, 15, 18, 21 and 24). The incubation times are indicated at the top of the lanes.

Since the proteins 69KΔ1 and 69KΔ2 do not overlap, this behaviour suggests the existence of two degradation signals within the 69K protein sequence: one that would lie beyond residue 406, and a second one residing at the N terminus of the protein. Within this region, the first 148 residues appear sufficient to promote degradation of the protein, as shown in Fig. 6(b) (lanes 1921).

Recent evidence indicates that the amino-terminal α-amino group can, in some instances, be conjugated to Ub moieties (Breitschopf et al., 1998 ; Aviel et al., 2000 ; Reinstein et al., 2000 ). In such cases, deletion of a few N-terminal residues stabilized the proteins. The possibility that the Ub attachment site consisted of the amino-terminal α-amino group of the 69K protein was therefore investigated by constructing plasmid E17-206K-stop-ΔN, encoding a mutant protein from which the first 41 amino acid residues were deleted. As shown in Fig. 6(b) (lanes 2224), the N-terminally deleted protein 69KΔ7 was still efficiently degraded upon incubation in the presence of excess untreated RRL. This result indicates that the N-terminal residue is not essential for degradation and suggests that lysines 109 and 111 represent possible Ub attachment sites.

Top

Research into cellular protein turnover has shown that proteins are degraded both in vitro and in vivo, with half-lives ranging from a few minutes to several weeks (Hershko & Ciechanover, 1992 ; Vierstra, 1996 ). The results shown here demonstrate that the TYMV 69K protein is selectively degraded in terminated in vitro translation reaction mixtures with a half-life of about 25 min (Fig. 1). The TYMV 69K protein can therefore be categorized as a very unstable protein. This degradation process was found to be independent of other virus-encoded proteins (Fig. 2) but dependent on ATP hydrolysis (Fig. 3), a feature that is a hallmark of degradation by the Ubproteasome pathway (reviewed in Hershko & Ciechanover, 1992 ; Hershko & Ciechanover, 1998 ). Accordingly, degradation of the 69K protein was readily supported by RRL fraction II (Fig. 3), while inhibitors of proteasomal function stabilized the protein (Figs 3 and 4). Reconstitution of a cell-free conjugation system (Fig. 5) further corroborated the notion that the 69K protein is multi-ubiquitinated, a process that typically precedes proteasomal degradation.

These findings show that the rapid degradation of the TYMV 69K protein in vitro can be accomplished by the Ub-mediated proteasome proteolytic system. Taking into account the correlation between in vitro and in vivo degradation that has been reported by different laboratories (Rote et al., 1989 ; Gonda et al., 1989 ; Ciechanover et al., 1991 ), we suggest that the previous report on the transient nature of accumulation of TYMV 69K protein in the course of infection (Bozarth et al., 1992 ) may be caused by its rapid and selective degradation through a Ub-dependent proteasome degradation pathway. Further studies in vivo are required to elucidate whether this is indeed the case. Interestingly, evidence for the involvement of such a degradation pathway in control of stability of another virus MP, that of TMV, has recently been presented (Reichel & Beachy, 2000 ). While it may be coincidental that the TYMV 69K and TMV 30K proteins are both substrates for proteasomal proteolysis, it may also be regarded as an emerging pattern of metabolic instability among virus movement proteins. It should be emphasized that these two proteins do not share sequence similarity and belong to two different classes of virus MPs (Mushegian & Koonin, 1993 ). Since transient accumulation of MP during early and mid-stages of virus infection has been described for a number of virus families (reviewed in Maule, 1991 ), it will be interesting to determine whether control of MP accumulation in infected cells also involves rapid proteasomal degradation or whether additional regulatory mechanisms involving RNA synthesis or translational control are involved.

The selective Ub-mediated proteolytic system is known to be involved in a variety of basic cellular processes, for instance development, apoptosis and cell cycle regulation (reviewed in Hershko & Ciechanover, 1998 ). Several viral pathogens have also been reported to exploit this cellular pathway. In a few cases, viral proteins were found to take advantage of the Ub system by targeting cellular substrates which could interfere with propagation of the virus (Scheffner et al., 1990 ; Schubert et al., 1998 ). In other cases, viral proteins themselves were the targets of the Ub-dependent proteasome pathway (Ciechanover et al., 1991 ; de Groot et al., 1991 ; Oberst et al., 1993 ), but whether these degradation events are obligatory steps in the virus life-cycle is not presently known. The mechanism of using disposable proteins may be essential to ensure irreversibility of temporally controlled processes. The importance of such a timing control in the efficiency of virus movement has been reported in the case of TMV (Lehto et al., 1990b ). It will be interesting in the future to investigate whether the lability and the temporally controlled expression of the 69K protein is a crucial event in the infectious cycle of TYMV as well. Alternatively, removal of MP from infected cells may primarily be a host defence mechanism. A number of virus MPs functionally modify plasmodesmatal permeability and promote the intercellular movement of viral nucleic acids (reviewed in Lazarowitz & Beachy, 1999 ). Such functions may be deleterious for long-term survival of the infected cells and removal of the MP by the proteasome pathway could prevent continuous interference with the intercellular flow of substances. Use of the Ub-mediated proteasome proteolytic system may also correspond to a cellular attempt to interfere with virus multiplication. Interestingly, perturbation of the Ub system was found to alter the plant response to pathogen infection (Becker et al., 1993 ; reviewed in von Kampen et al., 1996 ). Additional data are required to permit a better understanding of the role of Ub and proteasome in the development or control of plant virus diseases.

The selective and rapid degradation of TYMV 69K protein is of interest from another standpoint, because it can serve as a model for the study of cellular processes which function to degrade proteins. An increasing number of proteins are known to be rapidly degraded and complete understanding of the mechanism involved will require identification and characterization of the components of the proteolytic system responsible. Many components of the ubiquitination and 26S proteasome degradation pathways have already been identified in plants (reviewed in Vierstra, 1996 ; Callis & Vierstra, 2000 ) and an examination of the recently completed Arabidopsis genome sequence revealed that an extremely large number of genes are related to ubiquitination and proteolysis (Bachmair et al., 2001 ). However, the list of identified proteins which serve as substrates for this system in plants is rather short and little is known about the exact functions of the different plant Ub-conjugating enzymes and Ubprotein ligases (E3) (reviewed in Vierstra, 1996 ; Estelle, 2001 ; Bachmair et al., 2001 ). The identification of other potential substrates for these E3 enzymes may contribute to our understanding of their biological functions.

Of equal importance is the identification of signals in proteins that target them for ubiquitination and degradation. It is now clear that the essential determinants are often contained within small, sometimes conserved domains (Varshavsky, 1997 ). In eukaryotes, several motifs have been correlated with instability, including the cell cycle-related destruction box (Glotzer et al., 1991 ), sequences enriched in the amino acids proline, glutamic acid, serine and threonine (PEST sequences) (Rechsteiner & Rogers, 1996 ) or the N-end rule, a relationship observed between the identity of the N-terminal residue of a protein and its metabolic stability (Varshavsky, 1996 ). Using deletion studies (Fig. 6), we have shown that the 69K protein is likely to contain two degradation signals. The N-terminal degron does not appear to conform to the N-end rule, because the N-terminal residues of both the wild-type protein and the N-terminally deleted versions 69KΔ1 and 69KΔ7 belong to the highly stabilizing category (Met-Ser, Met-Pro and Met-Val respectively). The 69K protein also lacks PEST sequences, or any other obvious primary structure motif which might represent a recognition signal. Despite its high proline content, proline-rich (PY) motifs recently identified as interaction domains with particular Ub ligases (Ikeda et al., 2000 ; Harty et al., 2000 ) were not identified in the 69K protein sequence. Some degradation signals can also be active conditionally, for instance through phosphorylation (reviewed in Kornitzer & Ciechanover, 2000 ). Interestingly, the TMV MP was shown to be phosphorylated in planta (Watanabe et al., 1992 ) and phosphorylation was proposed to regulate its intracellular localization and stability (Kawakami et al., 1999 ). The TYMV 69K protein has been shown to be phosphorylated when expressed in insect cells (Séron et al., 1996 ), but its phosphorylation status in plants has not been specifically addressed. Further studies are required to identify more precisely the 69K protein features that correlate with its instability and to determine the role, if any, that phosphorylation of the MP plays in the degradation process. The results of the study described here will provide a foundation for the exploration of these questions.

This work was supported in part by grants from the CNRS (Programme Jeunes Equipes) and Ministère de la Recherche (Action Concertée Incitative Jeunes Chercheurs). We would like to thank Dr A.-L. Bulteau for the kind gift of MG132, Dr K. Séron for providing us with the antibodies directed against the 69K protein, Dr M. Rodriguez for helpful discussion, Dr R. Haguenauer-Tsapis for comments on the manuscript and C. J. for support during preparation of the manuscript.

References

Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A. & Struhl, K. (1987). Current Protocols in Molecular Biology. New York: Wiley.

Aviel, S., Winberg, G., Massucci, M. & Ciechanover, A. (2000). Degradation of the EpsteinBarr virus latent membrane protein 1 (LMP1) by the ubiquitinproteasome pathway. Targeting via ubiquitination of the N-terminal residue. Journal of Biological Chemistry 275, 23491-23499.[Abstract/Free Full Text]

Bachmair, A., Novatchkova, M., Potuschak, T. & Eisenhaber, F. (2001). Ubiquitylation in plants: a post-genomic look at a post-translational modification. Trends in Plant Science 6, 463-470.[Medline]

Becker, F., Buschfeld, E., Schell, J. & Bachmair, A. (1993). Altered response to viral infection by tobacco plants perturbed in ubiquitin system. Plant Journal 3, 875-881.

Boyer, J. C., Drugeon, G., Séron, K., Morch-Devignes, M. D., Agnès, F. & Haenni, A. L. (1993). In vitro transcripts of turnip yellow mosaic virus encompassing a long 3' extension or produced from a full-length cDNA clone harbouring a 2 kb-long PCR-amplified segment are infectious. Research in Virology 144, 339-348.[Medline]

Bozarth, C. S., Weiland, J. J. & Dreher, T. W. (1992). Expression of ORF-69 of turnip yellow mosaic virus is necessary for viral spread in plants. Virology 187, 124-130.[Medline]

Bransom, K. L. & Dreher, T. W. (1994). Identification of the essential cysteine and histidine residues of the turnip yellow mosaic virus protease. Virology 198, 148-154.[Medline]

Bransom, K. L., Weiland, J. J. & Dreher, T. W. (1991). Proteolytic maturation of the 206-kDa nonstructural protein encoded by turnip yellow mosaic virus RNA. Virology 184, 351-358.[Medline]

Breitschopf, K., Bengal, E., Ziv, T., Admon, A. & Ciechanover, A. (1998). A novel site for ubiquitination: the N-terminal residue, and not internal lysines of MyoD, is essential for conjugation and degradation of the protein. EMBO Journal 17, 5964-5973.[Medline]

Callis, J. & Vierstra, R. D. (2000). Protein degradation in signaling. Current Opinion in Plant Biology 3, 381-386.[Medline]

Chen, M. H., Sheng, J., Hind, G., Handa, A. K. & Citovsky, V. (2000). Interaction between the tobacco mosaic virus movement protein and host cell pectin methylesterases is required for viral cell-to-cell movement. EMBO Journal 19, 913-920.[Medline]

Ciechanover, A., Hod, Y. & Hershko, A. (1978). A heat-stable polypeptide component of an ATP-dependent proteolytic system from reticulocytes. Biochemical and Biophysical Research Communications 81, 1100-1105.[Medline]

Ciechanover, A., DiGiuseppe, J. A., Bercovich, B., Orian, A., Richter, J. D., Schwartz, A. L. & Brodeur, G. M. (1991). Degradation of nuclear oncoproteins by the ubiquitin system in vitro. Proceedings of the National Academy of Sciences, USA 88, 139-143.[Abstract/Free Full Text]

Citovsky, V., Knorr, D., Schuster, G. & Zambryski, P. (1990). The P30 movement protein of tobacco mosaic virus is a single-strand nucleic acid binding protein. Cell 60, 637-647.[Medline]

de Groot, R. J., Rumenapf, T., Kuhn, R. J., Strauss, E. G. & Strauss, J. H. (1991). Sindbis virus RNA polymerase is degraded by the N-end rule pathway. Proceedings of the National Academy of Sciences, USA 88, 8967-8971.[Abstract/Free Full Text]

Deom, C. M., Oliver, M. J. & Beachy, R. N. (1987). The 30-kilodalton gene product of tobacco mosaic virus potentiates virus movement. Science 237, 389-394.[Abstract/Free Full Text]

Estelle, M. (2001). Proteases and cellular regulation in plants. Current Opinion in Plant Biology 4, 254-260.[Medline]

Etlinger, J. D. & Goldberg, A. L. (1980). Control of protein degradation in reticulocytes and reticulocyte extracts by hemin. Journal of Biological Chemistry 255, 4563-4568.[Free Full Text]

Glotzer, M., Murray, A. W. & Kirschner, M. W. (1991). Cyclin is degraded by the ubiquitin pathway. Nature 349, 132-138.[Medline]

Gonda, D. K., Bachmair, A., Wunning, I., Tobias, J. W., Lane, W. S. & Varshavsky, A. (1989). Universality and structure of the N-end rule. Journal of Biological Chemistry 264, 16700-16712.[Abstract/Free Full Text]

Haas, A. L. & Rose, I. A. (1981). Hemin inhibits ATP-dependent ubiquitin-dependent proteolysis: role of hemin in regulating ubiquitin conjugate degradation. Proceedings of the National Academy of Sciences, USA 78, 6845-6848.[Abstract/Free Full Text]

Harty, R. N., Brown, M. E., Wang, G., Huibregtse, J. & Hayes, F. P. (2000). A PPxY motif within the VP40 protein of Ebola virus interacts physically and functionally with a ubiquitin ligase: implications for filovirus budding. Proceedings of the National Academy of Sciences, USA 97, 13871-13876.[Abstract/Free Full Text]

Heinlein, M., Epel, B., Padgett, H. & Beachy, R. (1995). Interaction of tobamovirus movement proteins with the plant cytoskeleton. Science 270, 1983-1985.[Abstract/Free Full Text]

Hershko, A. (1996). Lessons from the discovery of the ubiquitin system. Trends in Biochemical Sciences 21, 445-449.[Medline]

Hershko, A. & Ciechanover, A. (1992). The ubiquitin system for protein degradation. Annual Review of Biochemistry 61, 761-807.[Medline]

Hershko, A. & Ciechanover, A. (1998). The ubiquitin system. Annual Review of Biochemistry 67, 425-479.[Medline]

Hershko, A. & Heller, H. (1985). Occurrence of a polyubiquitin structure in ubiquitinprotein conjugates. Biochemical and Biophysical Research Communications 128, 1079-1086.[Medline]

Hershko, A. & Rose, I. A. (1987). Ubiquitin-aldehyde: a general inhibitor of ubiquitin-recycling processes. Proceedings of the National Academy of Sciences, USA 84, 1829-1833.[Abstract/Free Full Text]

Hershko, A., Ciechanover, A., Heller, H., Haas, A. L. & Rose, I. A. (1980). Proposed role of ATP in protein breakdown: conjugation of protein with multiple chains of the polypeptide of ATP-dependent proteolysis. Proceedings of the National Academy of Sciences, USA 77, 1783-1786.[Abstract/Free Full Text]

Hershko, A., Heller, H., Elias, S. & Ciechanover, A. (1983). Components of ubiquitinprotein ligase system. Resolution, affinity purification, and role in protein breakdown. Journal of Biological Chemistry 258, 8206-8214.[Abstract/Free Full Text]

Hochstrasser, M. (1996). Ubiquitin-dependent protein degradation. Annual Review of Genetics 30, 405-439.[Medline]

Hull, R. (1989). The movement of viruses in plants. Annual Review of Phytopathology 27, 213-240.

Ikeda, M., Ikeda, A., Longan, L. C. & Longnecker, R. (2000). The EpsteinBarr virus latent membrane protein 2A PY motif recruits WW domain-containing ubiquitin-protein ligases. Virology 268, 178-191.[Medline]

Johnston, N. L. & Cohen, R. E. (1991). Uncoupling ubiquitinprotein conjugation from ubiquitin-dependent proteolysis by use of β,γ-nonhydrolyzable ATP analogues. Biochemistry 30, 7514-7522.[Medline]

Kawakami, S., Padgett, H. S., Hosokawa, D., Okada, Y., Beachy, R. N. & Watanabe, Y. (1999). Phosphorylation and/or presence of serine 37 in the movement protein of tomato mosaic tobamovirus is essential for intracellular localization and stability in vivo. Journal of Virology 73, 6831-6840.[Abstract/Free Full Text]

Kornitzer, D. & Ciechanover, A. (2000). Modes of regulation of ubiquitin-mediated protein degradation. Journal of Cellular Physiology 182, 1-11.[Medline]

Laemmli, U. K. (1970). Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227, 680-685.[Medline]

Lazarowitz, S. G. & Beachy, R. N. (1999). Viral movement proteins as probes for intracellular and intercellular trafficking in plants. Plant Cell 11, 535-548.[Free Full Text]

Lee, D. H. & Goldberg, A. L. (1996). Selective inhibitors of the proteasome-dependent and vacuolar pathways of protein degradation in Saccharomyces cerevisiae. Journal of Biological Chemistry 271, 27280-27284.[Abstract/Free Full Text]

Lehto, K., Bubrick, P. & Dawson, W. O. (1990a). Time course of TMV 30K protein accumulation in intact leaves. Virology 174, 290-293.[Medline]

Lehto, K., Grantham, G. L. & Dawson, W. O. (1990b). Insertion of sequences containing the coat protein subgenomic RNA promoter and leader in front of the tobacco mosaic virus 30K ORF delays its expression and causes defective cell-to-cell movement. Virology 174, 145-157.[Medline]

McLean, B. G., Zupan, J. & Zambryski, P. C. (1995). Tobacco mosaic virus movement protein associates with the cytoskeleton in tobacco cells. Plant Cell 12, 2101-2114.[Abstract/Free Full Text]

Maule, A. J. (1991). Virus movement in infected plants. Plant Sciences 9, 457-473.

Mimnaugh, E. G., Bonvini, P. & Neckers, L. (1999). The measurement of ubiquitin and ubiquitinated proteins. Electrophoresis 20, 418-428.[Medline]

Morch, M. D., Boyer, J. C. & Haenni, A. L. (1988). Overlapping open reading frames revealed by complete nucleotide sequencing of turnip yellow mosaic virus genomic RNA. Nucleic Acids Research 16, 6157-6173.[Abstract/Free Full Text]

Morch, M. D., Drugeon, G., Szafranski, P. & Haenni, A. L. (1989). Proteolytic origin of the 150-kilodalton protein encoded by turnip yellow mosaic virus genomic RNA. Journal of Virology 63, 5153-5158.[Abstract/Free Full Text]

Mushegian, A. R. & Koonin, E. V. (1993). Cell-to-cell movement of plant viruses. Insights from amino acid sequence comparisons of movement proteins and from analogies with cellular transport systems. Archives of Virology 133, 239-257.[Medline]

Oberst, M. D., Gollan, T. J., Gupta, M., Peura, S. R., Zydlewski, J. D., Sudarsanan, P. & Lawson, T. G. (1993). The encephalomyocarditis virus 3C protease is rapidly degraded by an ATP-dependent proteolytic system in reticulocyte lysate. Virology 193, 28-40.[Medline]

Orian, A., Whiteside, S., Israël, A., Stancovski, I., Schwartz, A. L. & Ciechanover, A. (1995). Ubiquitin-mediated processing of NF-κB transcriptional activator precursor p105. Journal of Biological Chemistry 270, 21707-21714.[Abstract/Free Full Text]

Pickart, C. M. (1997). Targeting of substrates to the 26S proteasome. FASEB Journal 11, 1055-1066.[Abstract]

Rechsteiner, M. & Rogers, S. W. (1996). PEST sequences and regulation by proteolysis. Trends in Biochemical Sciences 21, 267-271.[Medline]

Reichel, C. & Beachy, R. N. (2000). Degradation of tobacco mosaic virus movement protein by the 26S proteasome. Journal of Virology 74, 3330-3337.[Abstract/Free Full Text]

Reinstein, E., Scheffner, M., Oren, M., Ciechanover, A. & Schwartz, A. (2000). Degradation of the E7 human papillomavirus oncoprotein by the ubiquitin-proteasome system: targeting via ubiquitination of the N-terminal residue. Oncogene 19, 5944-5950.[Medline]

Rhee, Y., Tzfira, T., Chen, M. H., Waigmann, E. & Citovsky, V. (2000). Cell-to-cell movement of tobacco mosaic virus: enigmas and explanations. Molecular Plant Pathology 1, 33-39.

Rote, K., Rogers, S., Pratt, G. & Rechsteiner, M. (1989). Degradation of structurally characterized proteins injected into HeLa cells. Comparison with their stability in rabbit reticulocyte lysate. Journal of Biological Chemistry 264, 9772-9779.[Abstract/Free Full Text]

Rozanov, M. N., Drugeon, G. & Haenni, A.-L. (1995). Papain-like proteinase of turnip yellow mosaic virus: a prototype of a new viral proteinase group. Archives of Virology 140, 4545-4552.

Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning: a Laboratory Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.

Scheffner, M., Werness, B. A., Huibregtse, J. M., Levine, A. J. & Howley, P. M. (1990). The E6 oncoprotein encoded by human papillomavirus types 16 and 18 promotes the degradation of p53. Cell 63, 1129-1136.[Medline]

Schubert, U., Anton, L. C., Bacik, I., Cox, J. H., Bour, S., Bennink, J. R., Orlowski, M., Strebel, K. & Yewdell, J. W. (1998). CD4 glycoprotein degradation induced by human immunodeficiency virus type 1 Vpu protein requires the function of proteasomes and the ubiquitin-conjugating pathway. Journal of Virology 72, 2280-2288.[Abstract/Free Full Text]

Séron, K., Bernasconi, L., Allet, B. & Haenni, A. (1996). Expression of the 69K movement protein of turnip yellow mosaic virus in insect cells. Virology 219, 274-278.[Medline]

Varshavsky, A. (1996). The N-end rule: functions, mysteries, uses. Proceedings of the National Academy of Sciences, USA 93, 12142-12149.[Abstract/Free Full Text]

Varshavsky, A. (1997). The ubiquitin system. Trends in Biochemical Sciences 22, 383-387.[Medline]

Vierstra, R. D. (1996). Proteolysis in plants: mechanisms and functions. Plant Molecular Biology 32, 275-302.[Medline]

Voges, D., Zwickl, P. & Baumeister, W. (1999). The 26S proteasome: a molecular machine designed for controlled proteolysis. Annual Review of Biochemistry 68, 1015-1068.[Medline]

von Kampen, J., Wettern, M. & Schulz, M. (1996). The ubiquitin system in plants. Physiologia Plantarum 97, 618-624.

Watanabe, Y., Ogawa, T. & Okada, Y. (1992). In vivo phosphorylation of the 30-kDa protein of tobacco mosaic virus. FEBS Letters 313, 181-184.[Medline]

Wolf, S., Deom, C. M., Beachy, R. N. & Lucas, W. J. (1989). Movement protein of tobacco mosaic virus modifies plasmodesmatal size exclusion limit. Science 246, 377-379.[Abstract/Free Full Text]

Received 22 July 2002; accepted 19 August 2002.