Abstract
B19 carries three major viral proteins: VP1 and VP2, virus capsid proteins, and NS1, a non-structural protein (Ozawa et al., 1987 ). NS1 is known to be implicated in virus replication (Ozawa et al., 1986 ), activation of virus and cellular gene transcription (Doerig et al., 1990 ; Moffatt et al., 1996 ; Sol et al., 1993 ) and target-cell cytotoxicity (Moffatt et al., 1998 ; Momoeda et al., 1994 ; Ozawa et al., 1988 ). We showed previously that NS1-induced cytotoxicity was mediated by caspase 3 and inhibited by the overexpression of Bcl-2, suggesting that NS1 is an apoptotic protein of B19 (Moffatt et al., 1998 ). In addition, the commitment of B19-infected cells to undergo apoptosis is combined with their accumulation in the G2/M phase of the cell cycle (Sol et al., 1999 ). Based on these observations, we speculated that the severe anaemia of the B19-infected foetus might result from the expression of cytotoxic NS1 in erythroid precursor cells. However, there has been no direct evidence that expression of NS1 induces NIHF in vivo. Hence, to establish a mouse model of human NIHF, we generated NS1-transgenic mice in which NS1 expression was strictly confined to erythroid-lineage cells.
Plasmid construction.An expression plasmid for NS1, pIE3.9int-NS1, was constructed as follows: an NS1 gene fragment (2·1 kb) was derived from pOPRSV-NS1 (Moffatt et al., 1996 ), digested with NotI and inserted into the NotI site of pIE3.9int-polyA (Onodera et al., 1997 ). Another expression plasmid for NS1, pIE3.9int-loxP-neo-loxP-NS1, was constructed as follows: the 2·1-kb NS1 gene was inserted into the NotI site of ploxP-neo and a 3·9-kb DNA fragment derived from the resultant plasmid, ploxP-neo-loxP-NS1, was inserted into the NotI site of pIE3.9int-polyA. A Cre-expression plasmid, pIE3.9int-cre, was constructed as follows: the bacteriophage P1 cre gene (1·1 kb) derived from pBS185 (Gibco-BRL) was inserted into the NotI site of pIE3.9int-polyA. All plasmid DNA constructs were confirmed by sequencing (Fig. 1A).
|
Generation of transgenic mouse lines.
After removing the vector DNA fragments, the individual constructs of IE3.9int-loxP-neo-loxP-NS1 and IE3.9int-cre were purified and microinjected into fertilized eggs of BDF1 mice, which were then implanted into foster mothers. The resulting progeny were screened for integration of the transgenes by Southern blot analysis and PCR using mouse tail DNA and maintained by mating with BDF1 mice. We thus established a GATA1-Cre transgenic mouse line (line 453) with the IE3.9int-cre gene and three independent GATA1-Neo-NS1 transgenic mouse lines (lines 464, 468 and 175) with the IE3.9int-loxP-neo-loxP-NS1 gene. Heterozygosity was determined by examining more than ten pups from breeding with non-transgenic BDF1 mice for their genotypes by PCR analysis (see below). CAG-CAT-Z transgenic mice (Sakai & Miyazaki, 1997 ) were maintained by mating with BDF1 mice. The CAG-CAT-Z construct consists of the CAG promoter (CAGGS, cytomegalovirus immediate-early enhancerchicken β-actin hybrid promoter), loxP-CAT-loxP and the lacZ gene and was used to confirm that the Cre/loxP site-specific recombination system was functional in the F1 progeny that resulted from a cross between CAG-CAT-Z transgenic mice and GATA1-Cre transgenic mice.
Cell culture.
K562 is an erythroleukaemia cell line, UT-7/Epo is a megakaryocytic cell line adapted for growth dependent on erythropoietin (Shimomura et al., 1992 ), COS7 is a simian virus 40-transformed fibroblast cell line and MT-1 is a human adult T-cell leukaemia cell line. The cell lines were maintained in RPMI 1640 medium containing 10% FCS and 2 U erythropoietin (Kirin Brewery Pharm. Res. Lab.) was added to the medium for the UT-7/Epo cells.
Immunoprecipitation and immunoblotting.
Immunoprecipitation and immunoblotting were performed as described previously (Moffatt et al., 1996 , 1998 ). In brief, cells were lysed in RIPA buffer (pH 7·5) containing 10 mM TrisHCl (pH 7·5), 1% NP-40, 0·1% sodium deoxycholate, 0·1% SDS, 150 mM NaCl, 1 mM EDTA and 10 µg/ml aprotinin. The lysates were then immunoprecipitated with a mAb specific for NS1 coupled to protein ASepharose beads and anti-mouse IgG (Zymed). The immunoprecipitates were separated on a 10% polyacrylamide gel and transferred to PVDF filters (Millipore). After being incubated in PBS containing 3% BSA, the blots were probed with a mAb against NS1 protein and immune complexes were visualized by enhanced chemiluminescence according to the manufacturers instructions (Amersham).
Southern blot analysis.
Tissue DNA was isolated from tails of mice using the QIAamp Tissue kit (Qiagen). An aliquot (10 µg) of the DNA was digested with XbaI, separated on a 1·0% agarose gel and transferred onto Gene Screen Plus (NEN Research Products) and then hybridized overnight at 42 °C in 6xSSC/0·5% SDS using 32P-labelled probes corresponding to the NS1 coding region (398 bp) or the Cre coding region (328 bp). The membrane was washed in 2xSSC/0·1% SDS and exposed to X-ray film. The signal was quantified with an image analyser (BAS2000, Fuji) and the copy number was estimated by using the control plasmid to generate the transgene.
PCR analysis to genotype the transgenic mice.
Mouse tails and embryos were lysed with 0·5% NP-40, 1 µg/µl proteinase K and Taq TM PCR buffer (Takara Shuzo) for 2 h and incubated at 95 °C. Approximately 1 µg of DNA extracted from the lysates was subjected to 35 cycles of amplification on a thermal cycler. The primers used for amplification of sequences within the NS1 gene were N1 (5' CACAGACACCAGTATCAGCAGCAGT 3') and N2 (5' CACACATAATCAACCCCAACTAACG 3'), which produced 261-bp DNA fragments. The primers used for amplification of sequences within the cre gene were C1 (5' AAAAACTATCCAGCAACATT 3') and C2 (5' TAACATTCTCCCACCGTCAG 3'), which produced 328-bp DNA fragments. The primers used for amplification of sequences within the lacZ gene were L1 (5' GCGTTACCCAACTTAATCG 3') and L2 (5' TGTGAGCGAGTAACAACC 3'), which produced 320-bp DNA fragments (Sakai & Miyazaki, 1997 ). PCR products were analysed by electrophoresis in 2% agarose gels.
Detection of β-galactosidase in whole embryos.
For whole-mount X-Gal staining, embryos were removed at embryonic day 10·5 (E10·5). They were fixed at 4 °C for 2 h in 1% formaldehyde, 0·2% glutaraldehyde and 0·02% NP-40 in PBS. After washing with PBS, they were incubated at 37 °C for 5 h in 5 mM K3Fe(CN)6, 5 mM K4Fe(CN)6, 2 mM MgCl2 and 1 mg/ml X-Gal in PBS.
Blood analysis.
Embryonic blood was obtained from umbilical cord vessels using microhematocrit tubes (Microcaps, Drummond Scientific). Haematocrit measurements of embryonic blood were taken after centrifugation for 3 min. Giemsa staining of blood smears was performed as described previously (Socolovsky et al., 1999 ).
RNA isolation and RTPCR analysis.
To confirm expression of the NS1 gene mRNA, we performed RTPCR. Total RNA was isolated from liver and spleen with Trizol reagent (Technologies TM) according to the manufacturers instructions. The RNA concentration was determined from the absorbance. The isolated RNA was reverse-transcribed to cDNA using random hexamers as primers and Superscript II reverse transcriptase (Life Technologies) according to the manufacturers instructions and the cDNA was then used as a template for PCR. PCR was performed under the same conditions as the genotype analysis.
Real-time RTPCR.
Real-time RTPCR was performed as described previously (Barbany et al., 2000 ; Bièche et al., 1999 ). cDNA was synthesized from 3 µg total RNA extracted from each embryonic liver and then subjected to PCR amplification. The PCR was performed in a 50 µl volume. The PCR mixture contained 2 µl of each appropriate RT reaction cDNA sample, 5 µl 10xSYBR Green PCR buffer, 5 µl 25 mM MgCl2, 4 µl dNTP mix, 0·5 µl AmpErase UNG, 15 pmol forward and reverse primer and 0·25 µl AmpliTaq Gold DNA polymerase (Perkin-Elmer Applied Biosystems). All PCRs and detection of real-time fluorescent energy were performed using an ABI Prism 7700 Sequence Detection system (Perkin-Elmer Applied Biosystems). The thermal cycling conditions consisted of an initial denaturation step at 95 °C for 10 min and 50 cycles at 95 °C for 15 s and 60 °C for 1 min. Each PCR result was calculated from a standard curve, constructed by using various concentrations of NS1 cDNA (10-fold serially diluted cDNA ranging between 10-10 and 10-14 g). A strong linear relationship between the threshold cycle (Ct) and the log of the starting cDNA copy number was continually demonstrated (r2>0·98; data not shown). The β-actin signal was used to normalize the amount of input cDNA. Experiments were performed with duplicates for each data point.
Whole-mount in situ hybridization.
Embryos were fixed in 4% paraformaldehyde on ice for several hours and processed for whole-mount in situ hybridization. After dehydration and rehydration, the embryos were incubated with digoxigenin-labelled probe and stained with the alkaline phosphate substrate, NBT/BCIP, under the conditions recommended by the manufacturer (Boehringer Mannheim). Antisense and sense RNAs of NS1 were labelled with digoxigeninUTP and used as probes.
The NS1 protein of human parvovirus B19 is known to be cytotoxic, due to its apoptosis-inducing activity in various types of cell (Moffatt et al., 1998 ; Morey et al., 1993 ; Sol et al., 1999 ). Thus, establishing transgenic mice that expressed the NS1 protein continuously presented special challenges. We first constructed a plasmid, pIE3.9int-NS1, that consisted of the NS1 gene driven by the IE3.9int promoter of the GATA-1 gene (Fig. 1A; Onodera et al., 1997 ). Transfection of pIE3.9int-NS1 induced the expression of the NS1 protein in the erythroid cell lines K562 and UT-7, but not in lines derived from other types of cell, such as COS7 and MT-1 (Fig. 1B), suggesting that the IE3.9int promoter worked specifically in erythroid cells. By using pIE3.9int-NS1, we attempted to generate NS1-expressing transgenic mice, but were unsuccessful (data not shown). Hence, to obtain founder mice, we used the Cre/loxP site-specific recombination system (Lakso et al., 1992 ; Orban et al., 1992 ). We designed two plasmids for this purpose, pIE3.9int-loxP-neo-loxP-NS1, in which the neo gene flanked by loxP sites was inserted between the promoter and the NS1 gene, and pIE3.9int-cre, which encoded the Cre recombinase (Fig. 1A). The use of these plasmids permitted the conditional expression of NS1. When plasmids pIE3.9int-loxP-neo-loxP-NS1 and pIE3.9int-cre were transfected simultaneously into K562 cells, the cells expressed the NS1 protein, whereas transfection of plasmid pIE3.9int-loxP-neo-loxP-NS1 alone did not induce NS1 expression (Fig. 1C). These results indicate that the NS1 gene recombined directly with the IE3.9int promoter after Cre-mediated excision of the neo gene from pIE3.9int-loxP-neo-loxP-NS1 and that the recombined DNA construct drove the successful expression of the NS1 gene.
Establishment of transgenic mouse lines
We first established a GATA1-Cre transgenic mouse line (line 453) expressing IE3.9int-cre. In order to confirm that the Cre recombinase in GATA1-Cre mice was functional, we used transgenic mice bearing a reporter gene construct, CAG-CAT-Z, which directs the expression of the E. coli lacZ gene upon the Cre-mediated excision of the CAT gene located between the CAG promoter and the lacZ gene (Sakai & Miyazaki, 1997 ). GATA1-Cre mice were crossed with heterozygous CAG-CAT-Z mice. The yolk sacs of the F1 progeny mice were examined at E10 for LacZ expression by X-Gal staining, because the yolk sac is an active haematopoietic centre at E10. In the F1 progeny, positive X-Gal staining was observed in the yolk sacs derived from embryos that carried both the CAG-CAT-Z transgene and the IE3.9int-cre transgene, indicating that the Cre recombinase of the GATA1-Cre mice was functional in vivo (data not shown).
We next established three independent GATA1-Neo-NS1-transgenic mouse lines (lines 464, 468 and 175) containing IE3.9int-loxP-neo-loxP-NS1 transgenes. In all three lines, the transgene was unable to drive expression of the NS1 gene because the neo gene was inserted between the IE3.9int promoter and the NS1 gene (Fig. 1A). The F1 progeny of the GATA1-Neo-NS1 lines 464, 468 and 175 respectively had 5, 30 and 70 copies of the NS1 gene, as determined by Southern blot analysis (data not shown). We also confirmed that the founder mice carried the transgenes in a heterozygous manner and that the transgenes were transmitted to their progeny according to Mendelian expectations.
In order to obtain transgenic mice expressing NS1 in erythroid-lineage cells, we crossed heterozygous GATA1-Neo-NS1 mice with heterozygous GATA1-Cre mice; a quarter of their progeny were expected to express the NS1 gene due to direct recombination between the IE3.9int promoter and the NS1 gene. The F1 progeny were genotyped and shown to include loxP-NS+/cre+ mice carrying both the IE3.9int-cre and IE3.9int-loxP-neo-loxP-NS1 transgenes, loxP-NS+/cre- mice carrying only IE3.9int-loxP-neo-loxP-NS1, loxP-NS-/cre+ mice carrying only IE3.9int-cre and loxP-NS-/cre- wild-type mice.
NS1 expression in the haematopoietic organs of F1 progeny obtained from crossing GATA1-Neo-NS1 mice with GATA1-Cre mice
We first analysed 195 F1 progeny obtained from crossing line 468 of the heterozygous GATA1-Neo-NS1 mice with heterozygous GATA1-Cre mice at weaning. The number of loxP-NS+/cre+ mice was approximately half that of the loxP-NS+/cre-, loxP-NS-/cre+ or wild-type mice at weaning (Table 1). These weanlings were examined by RTPCR for expression of the NS1 gene in the spleen, which is a haematopoietic organ. NS1 gene expression was detected in loxP-NS+/cre+ mice but not in the other genotypes (Fig. 2A). Hence, we genotyped the F1 progeny further at various days of gestation. The number of loxP-NS+/cre+ embryos was not significantly less before E13·5 compared with the other F1 littermates, but decreased appreciably after E13·5 (Table 1). We also examined the embryos by RTPCR at E12·5 for expression of the NS1 gene in the liver, which is an embryonic haematopoietic organ. Of more than ten embryos in the same uterus, NS1 gene expression was detected in only three loxP-NS+/cre+ embryos (Fig. 2B) and not in the other genotypes. Furthermore, we examined the quantitative expression of the NS1 gene in these three loxP-NS+/cre+ embryos by real-time RTPCR. The cDNA copy number of the lane 3 embryo was approximately twofold higher compared with the lane 2 and lane 4 embryos (Fig. 2B). These data may suggest that the embryos lived to different stages because NS1 was expressed at different levels.
Table 1. Genotypes of F1 progeny of three GATA1-Neo-NS1-transgenic mice, each crossed with a GATA1-Cre-transgenic mouse
|
GATA1-driven expression of NS1 in vivo induces hydropic changes and death in embryos
Interestingly, we found embryos with hydropic phenotypes at E15·5, in which the skin was remarkably oedematous and pale, but the embryos were without apparent malformation (Fig. 3A). Their genotypes were confirmed to be loxP-NS+/cre+. Haematocrits of the umbilical cord blood were 20·8±1·4% (mean±SEM) in the loxP-NS+/cre+ embryos and 40·8±1·7% in wild-type mice at E15·5. The haematocrits of the loxP-NS+/cre- and loxP-NS-/cre+ embryos were similar to those of wild-type embryos (data not shown). Furthermore, umbilical cord blood of the loxP-NS+/cre+ embryos at E15·5 contained a much smaller proportion of erythrocytes without nuclei than that of wild-type mice (Fig. 3B), revealing a disturbance of haematopoiesis (Mucenski et al., 1991 ; Socolovsky et al., 1999 ) in the loxP-NS+/cre+ embryos. Histological examination of the foetal livers, where active haematopoiesis occurs, also demonstrated that there were significantly fewer erythropoietic islands in the liver parenchyma of loxP-NS+/cre+ embryos than in those of wild-type mice (Fig. 3C). We also performed a histological examination of the foetal hearts. The structure of the heart in loxP-NS+/cre+ embryos was normal and myocardial damage, such as apoptosis or necrosis, was not observed (data not shown). These results suggest that IE3.9int promoter-driven expression of NS1 resulted in a disruption of foetal erythropoiesis, which caused foetal death with severe anaemia.
|
In order to examine further the fatal effects of NS1 in mice, we crossed line 175 of heterozygous GATA1-Neo-NS1 mice with the heterozygous GATA1-Cre mice and observed the F1 progeny. At weaning, five of 104 F1 mice were loxP-NS+/cre+, which was fewer than when line 468 mice were used for the cross (Table 1), suggesting that NS1 expression induced more severe embryonic damage in line 175 than in line 468. We also generated F1 progeny from crossing line 464 of heterozygous GATA1-Neo-NS1 mice with GATA1-Cre mice. However, at weaning, none of the 97 progeny mice had the loxP-NS+/cre+ genotype, suggesting that NS1 expression in these embryos resulted in prenatal lethality (Table 1). We then genotyped F1 embryos from line 464 at various days of gestation. Wild-type, loxP-NS+/cre- and loxP-NS-/cre+ embryos were recovered between E7·5 and E9·5, but no loxP-NS+/cre+ embryos were seen (Table 1). Hence, we examined expression of the NS1 mRNA at E6·5 by whole-mount in situ hybridization. NS1 expression was confirmed in loxP-NS+/cre+ embryos, but not in wild-type embryos (data not shown). These results suggest that NS1 gene expression at an early embryonic stage induced early embryonic lethality. The non-structural protein, NS1, of B19 is thought to play a critical role in the pathogenesis of diseases associated with B19 infection. Contributions to virus replication (Ozawa et al., 1986 ), activation of virus and cellular gene transcription (Doerig et al., 1990 ; Moffatt et al., 1996 ; Sol et al., 1993 ) and target cell apoptosis (Moffatt et al., 1998 ; Momoeda et al., 1994 ; Ozawa et al., 1988 ) have been suggested. Since B19 can not infect mice, we established mice that expressed NS1 to analyse the mechanisms of B19 infectious disease. We suspected that it might be difficult to establish transgenic mouse lines that expressed NS1 stably, because of its apoptosis-inducing activity. Hence, we engineered mice expressing the NS1 transgene, with expression restricted to erythropoietic cells by using the IE3.9int promoter (GATA1 promoter), which is known to be activated specifically in erythroid-lineage cells (Fujiwara et al., 1996 ; Onodera et al., 1997 ; Pevny et al., 1991 ), and the Cre/loxP recombination system (Lakso et al., 1992 ; Orban et al., 1992 ). Using this approach, three GATA1-Neo-NS1-transgenic mouse lines (lines 464, 468 and 175) were generated and appeared to be suitable animal models of human intrauterine B19 infection.
In the F1 progeny from crosses between line 468 GATA1-Neo-NS1 mice and GATA1-Cre mice, approximately half the loxP-NS+/cre+ genotype mice, which expressed NS1, were born alive and the other half died in utero, presenting with hydropic features and severe anaemia, probably due to the disruption of erythropoiesis. These phenotypes of the NS1-transgenic mice are similar to those of human NIHF, which occurs when there is an intrauterine B19 infection during pregnancy, and indicate that the NS1-transgenic mice can be used as an animal model of this disease. In contrast, GATA-1-deficient mice, despite showing completely defective erythropoiesis in the primitive haematopoietic centre (Fujiwara et al., 1996 ; Pevny et al., 1991 ; Shivdasani & Orkin, 1996 ), do not show hydropic characteristics. The NS1 protein is known to have a variety of functions in addition to inducing apoptosis, as outlined above. Recently, we demonstrated B19-induced G2 cell-cycle arrest with suppression of nuclear import of cyclin B1, which was thought to be mediated by NS1 expression (Morita et al., 2001 ). Thus, it is possible that these various functions associated with the NS1 protein influence the occurrence of hydropic changes in the foetus.
The severity of embryonic damage in the loxP-NS+/cre+ F1 progeny varied with the transgenic line: loxP-NS+/cre+ F1 progeny resulting from crosses with line 175 mice were recovered at weaning, but in a significantly lower proportion than those resulting from line 468, and none were recovered after E7·5 from line 464, indicating that the NS1 gene induced the most severe embryonic damage in line 464. We believe that the severity of embryonic damage is primarily dependent on the level of NS1 expression in the F1 progeny, but also on the leakiness of NS1 expression during embryogenesis. Since line 464 showed the lowest NS1 copy number of the three transgenic lines, the level of NS1 gene expression did not correlate with its copy number and it is possible that the level of expression was dependent on either its integration site or modifications such as acetylation and methylation. Thus, our NS1-transgenic mice include early foetal loss prior to liver haematopoiesis. In humans, similar early foetal loss associated with B19 infection has also been reported (Miller et al., 1998 ). Furthermore, we showed that F1 progeny derived from the same line lived to different stages and that the levels of NS1 expression were different among the littermates. We think that the differences in NS1 expression among members of the same F1 generation may be due to differences in individual mice. Further research will be necessary to clarify the mechanisms involved.
We previously detected B19-infected erythroid-lineage cells in tissues derived from foetal patients with NIHF (Yaegashi et al., 1999 ). These cells exhibited apoptotic features similar to UT7/Epo cells infected with B19 in vitro (Yaegashi et al., 1999 ), suggesting that anaemia observed in patients with NIHF results from B19-induced cytotoxicity of erythroid-lineage cells. Since NS1 is known to possess cytotoxic activity through apoptosis, the anaemia is thought to be caused by NS1 expression in erythroid-lineage cells. Our NS1-transgenic mice provide direct evidence that NS1 expression in vivo in erythroid-lineage cells induces anaemia.
Previously, it has been shown that B19 infects human erythroid-lineage cells in vivo as well as in vitro preferentially through its receptor, P antigen (Brown et al., 1993 , 1994 ). However, the P antigen is reportedly expressed on foetal cardiac myocytes (Rouger et al., 1987 ). Interestingly, B19 was found to infect myocardial cells of patients with NIHF, resulting in myocarditis (Lambot et al., 1999 ; Porter et al., 1988 ). Hence, not only anaemia but also myocarditis is thought to be implicated in the mechanism of B19-induced human NIHF (Morey et al., 1992 ; Naides & Weiner, 1989 ). Although the GATA1 promoter is known to be activated specifically in erythroid-lineage cells, we investigated whether our transgenic mice showed NS1-induced damage to the myocardium by leakiness of transgene expression. We observed that our NS1-transgenic mice showed no damage to the myocardium, which is compatible with our previous study that B19 infection was not detected in cardiac myocytes derived from patients with NIHF (Yaegashi et al., 1999 ). These observations suggest that NS1 expression in erythroid-lineage cells is sufficient to cause an adverse murine foetal outcome like human NIHF, which may be mediated primarily by anaemia.
In the present study, we have shown hydropic change and embryonic death induced by NS1 expression in erythroid-lineage cells in mice, suggesting that the main cause of adverse outcome by intrauterine B19 infection in human is NS1-mediated cytotoxicity of erythroid-lineage cells. Thus, our NS1-transgenic mice are expected to be a useful model for analysing the stages of the disease in utero.
Recently, some cases of B19-associated non-hydropic foetal loss in the late-second and third trimesters have been reported (Tolfvenstam et al., 2001 ). Similarly, we have often encountered intrauterine foetal death with pale appearance and no hydropic change when B19 infection was detected in the foetus. These observations suggest that B19 infection may induce foetal adverse outcome without hydropic changes. Hence, further study is required to clarify whether other B19 components in addition to NS1 are involved in the foetal adverse outcome in B19 infection.
We thank Drs Masayuki Yamamoto and Jun-ichi Miyazaki for providing the plasmid pIE3.9int-polyA and the CAG-CAT-Z-transgenic mice, respectively, and Dr L. C. Ndhlovu for critical reading of the manuscript. This work was supported in part by a grant for Core Research for Evolutional Science and Technology (CREST) of the Japan Science and Technology Corporation and a Grant-in-Aid for Scientific Research of the Japan Society for the Promotion of Science.References
Barbany, G., Hagberg, A., Olsson-Strömberg, U., Simonsson, B., Syvänen, A. C. & Landegren, U. (2000). Manifold-assisted reverse transcriptionPCR with real-time detection for measurement of the BCR-ABL fusion transcript in chronic myeloid leukemia patients. Clinical Chemistry 46, 913-920.
Bièche, I., Onody, P., Laurendeau, I., Olivi, M., Vidaud, D., Lidereau, R. & Vidaud, M. (1999). Real-time reverse transcriptionPCR assay for future management of ERBB2-based clinical applications. Clinical Chemistry 45, 1148-1156.
Brown, K. E. & Young, N. S. (1997). Parvovirus B19 in human disease. Annual Review of Medicine 48, 59-67.[Medline]
Brown, T., Anand, A., Ritchie, L. D., Clewley, J. P. & Reid, T. M. (1984). Intrauterine parvovirus infection associated with hydrops fetalis. Lancet ii, 10331034.
Brown, K. E., Anderson, S. M. & Young, N. S. (1993). Erythrocyte P antigen: cellular receptor for B19 parvovirus. Science 262, 114-117.
Brown, K. E., Hibbs, J. R., Gallinella, G., Anderson, S. M., Lehman, E. D., McCarthy, P. & Young, N. S. (1994). Resistance to parvovirus B19 infection due to lack of virus receptor (erythrocyte P antigen). New England Journal of Medicine 330, 1192-1196.
Cossart, Y. E., Field, A. M., Cant, B. & Widdows, D. (1975). Parvovirus-like particles in human sera. Lancet i, 7273.
Doerig, C., Hirt, B., Antonietti, J. P. & Beard, P. (1990). Nonstructural protein of parvoviruses B19 and minute virus of mice controls transcription. Journal of Virology 64, 387-396.
Fujiwara, Y., Browne, C. P., Cunniff, K., Goff, S. C. & Orkin, S. H. (1996). Arrested development of embryonic red cell precursors in mouse embryos lacking transcription factor GATA-1. Proceedings of the National Academy of Sciences, USA 93, 12355-12358.
Kelleher, J. F., Luban, N. L., Mortimer, P. P. & Kamimura, T. (1983). Human serum parvovirus: a specific cause of aplastic crisis in children with hereditary spherocytosis. Journal of Pediatrics 102, 720-722.[Medline]
Lakso, M., Sauer, B., Mosinger, B.Jr, Lee, E. J., Manning, R. W., Yu, S.-H., Mulder, K. L. & Westphal, H. (1992). Targeted oncogene activation by site-specific recombination in transgenic mice. Proceedings of the National Academy of Sciences, USA 89, 6232-6236.
Lambot, M.-A., Noël, J.-C., Peny, M.-O., Rodesch, F. & Haot, J. (1999). Fetal parvovirus B19 infection associated with myocardial necrosis. Prenatal Diagnosis 19, 389.[Medline]
Levy, R., Weissman, A., Blomberg, G. & Hagay, Z. J. (1997). Infection by parvovirus B19 during pregnancy: a review. Obstetrical and Gynecological Survey 52, 254-259.
Miller, E., Fairley, C. K., Cohen, B. J. & Seng, C. (1998). Immediate and long term outcome of human parvovirus B19 infection in pregnancy. British Journal of Obstetrics and Gynaecology 105, 174-178.[Medline]
Moffatt, S., Tanaka, N., Tada, K., Nose, M., Nakamura, M., Muraoka, O., Hirano, T. & Sugamura, K. (1996). A cytotoxic nonstructural protein, NS1, of human parvovirus B19 induces activation of interleukin-6 gene expression. Journal of Virology 70, 8485-8491.[Abstract]
Moffatt, S., Yaegashi, N., Tada, K., Tanaka, N. & Sugamura, K. (1998). Human parvovirus B19 nonstructural (NS1) protein induces apoptosis in erythroid lineage cells. Journal of Virology 72, 3018-3028.
Momoeda, M., Wong, S., Kawase, M., Young, N. S. & Kajigaya, S. (1994). A putative nucleoside triphosphate-binding domain in the nonstructural protein of B19 parvovirus is required for cytotoxicity. Journal of Virology 68, 8443-8446.
Morey, A. L., Keeling, J. W., Porter, H. J. & Fleming, K. A. (1992). Clinical and histopathological features of parvovirus B19 infection in human fetus. British Journal of Obstetrics and Gynaecology 99, 566-574.[Medline]
Morey, A. L., Ferguson, D. J. & Fleming, K. A. (1993). Ultrastructural features of fetal erythroid precursors infected with parvovirus B19 in vitro: evidence of cell death by apoptosis. Journal of Pathology 169, 213-220.
Morita, E., Tada, K., Chisaka, H., Asao, H., Sato, H., Yaegashi, N. & Sugamura, K. (2001). Human parvovirus B19 induces cell cycle arrest at G2 phase with accumulation of mitotic cyclins. Journal of Virology 75, 7555-7563.
Mucenski, M. L., McLain, K., Kier, A. B., Swerdlow, S. H., Schreiner, C. M., Miller, T. A., Pietryga, D. W., Scott, W. J.Jr & Potter, S. S. (1991). A functional c-myb gene is required for normal murine fetal hepatic hematopoiesis. Cell 65, 677-689.[Medline]
Naides, S. J. & Weiner, C. P. (1989). Antenatal diagnosis and palliative treatment of non-immune hydrops fetalis secondary to fetal parvovirus B19 infection. Prenatal Diagnosis 9, 105-114.[Medline]
Onodera, K., Takahashi, S., Nishimura, S., Ohta, J., Motohashi, H., Yomogida, K., Hayashi, N., Engel, J. D. & Yamamoto, M. (1997). GATA-1 transcription is controlled by distinct regulatory mechanisms during primitive and definitive erythropoiesis. Proceedings of the National Academy of Sciences, USA 94, 4487-4492.
Orban, P. C., Chui, D. & Marth, J. D. (1992). Tissue- and site-specific DNA recombination in transgenic mice. Proceedings of the National Academy of Sciences, USA 89, 6861-6865.
Ozawa, K., Kurtzman, G. & Young, N. S. (1986). Replication of the B19 parvovirus in human bone marrow cell cultures. Science 233, 883-886.
Ozawa, K., Ayub, J., Hao, Y.-S., Kurtzman, G., Shimada, T. & Young, N. S. (1987). Novel transcription map for the B19 (human) pathogenic parvovirus. Journal of Virology 61, 2395-2406.
Ozawa, K., Ayub, J., Kajigaya, S., Shimada, T. & Young, N. S. (1988). The gene encoding the nonstructural protein of B19 (human) parvovirus may be lethal in transfected cells. Journal of Virology 62, 2884-2889.
Pevny, L., Simon, M. C., Robertson, E., Klein, W. H., Tsai, S. F., DAgati, V., Orkin, S. H. & Constantini, F. (1991). Erythroid differentiation in chimaeric mice blocked by a targeted mutation in the gene for transcription factor GATA-1. Nature 349, 257-260.[Medline]
Porter, H. J., Quantrill, A. M. & Fleming, K. A. (1988). B19 parvovirus infection of myocardial cells. Lancet i, 535536.
Rouger, P., Gane, P. & Salmon, C. (1987). Tissue distribution of H, Lewis and P antigens as shown by a panel of 18 monoclonal antibodies. Revue Française de Transfusion et dImmunohematologie 30, 699-708.
Sakai, K. & Miyazaki, J. (1997). A transgenic mouse line that retains Cre recombinase activity in mature oocytes irrespective of the cre transgene transmission. Biochemical and Biophysical Research Communications 237, 318-324.[Medline]
Shimomura, S., Komatsu, N., Frickhofen, N., Anderson, S., Kajigaya, S. & Young, N. S. (1992). First continuous propagation of B19 parvovirus in a cell line. Blood 79, 18-24.
Shivdasani, R. A. & Orkin, S. H. (1996). The transcriptional control of hematopoiesis. Blood 87, 4025-4039.
Socolovsky, M., Fallon, A. E. J., Wang, S., Brugnara, C. & Lodish, H. F. (1999). Fetal anemia and apoptosis of red cell progenitors in Stat5a-/-5b-/- mice: a direct role for Stat5 in Bcl-XL induction. Cell 98, 181-191.[Medline]
Sol, N., Morinet, F., Alizon, M. & Hazan, U. (1993). Trans-activation of the long terminal repeat of human immunodeficiency virus type 1 by the parvovirus B19 NS1 gene product. Journal of General Virology 74, 2011-2014.
Sol, N., Le Junter, J., Vassias, I., Freyssinier, J. M., Thomas, A., Prigent, A. F., Rudkin, B. B., Fichelson, S. & Morinet, F. (1999). Possible interactions between the NS-1 protein and tumor necrosis factor alpha pathways in erythroid cell apoptosis induced by human parvovirus B19. Journal of Virology 73, 8762-8770.
Tolfvenstam, T., Papadogiannakis, N., Norbeck, O., Petersson, K. & Broliden, K. (2001). Frequency of human parvovirus B19 infection in intrauterine fetal death. Lancet 357, 1494-1497.[Medline]
Yaegashi, N., Shiraishi, H., Takeshita, T., Nakamura, M., Yajima, A. & Sugamura, K. (1989). Propagation of human parvovirus B19 in primary culture of erythroid lineage cells derived from fetal liver. Journal of Virology 63, 2422-2426.
Yaegashi, N., Okamura, K., Yajima, A., Murai, C. & Sugamura, K. (1994). The frequency of human parvovirus B19 infection in nonimmune hydrops fetalis. Journal of Perinatal Medicine 22, 159-163.[Medline]
Yaegashi, N., Niinuma, T., Chisaka, H., Watanabe, T., Uehara, S., Okamura, K., Moffatt, S., Sugamura, K. & Yajima, A. (1998). The incidence of, and factors leading to, parvovirus B19-related hydrops fetalis following maternal infection; report of 10 cases and meta-analysis. Journal of Infection 37, 28-35.[Medline]
Yaegashi, N., Niinuma, T., Chisaka, H., Uehara, S., Moffatt, S., Tada, K., Iwabuchi, M., Matsunaga, Y., Nakayama, M., Yutani, C., Osamura, Y., Hirayama, E., Okamura, K., Sugamura, K. & Yajima, A. (1999). Parvovirus B19 infection induces apoptosis of erythroid cells in vitro and in vivo. Journal of Infection 39, 68-76.[Medline]
Young, N. (1988). Hematologic and hematopoietic consequences of B19 parvovirus infection. Seminars in Hematology 25, 159-172.[Medline]
Received 26 July 2001; accepted 25 October 2001.