Abstract
Feline infectious peritonitis virus (FIPV) strain 79-1146 as well as other feline coronaviruses belong to group I coronaviruses and are related closely to both canine coronavirus and porcine transmissible gastroenteritis virus (TGEV) (Vennema et al., 1992 ). In fact, all of these viruses are antigenically so similar that they may be regarded as host range mutants rather than as separate species (Horzinek et al., 1982 ). FIPV infects both domestic and wild cats and generally causes mild enteric diseases. However, in about 510% of FIPV infections, the disease progresses and results in a debilitating lethal disease characterized by an exudative fibrinous serositis in the abdominal and thoracic cavities (reviewed by Olsen, 1993 ; de Groot & Horzinek, 1995 ). Previous sequence analyses have focussed mainly on the 3'-terminal region of the FIPV genome, which encodes the structural proteins of the virus (Vennema et al., 1992 , 1998 ; Herrewegh et al., 1995 , 1998 ). Although there is nearly no sequence information on the 5'-proximal region of the FIPV genome, it is reasonable to assume that this sequence will be very similar to the TGEV replicase gene sequence reported previously (Eleouet et al., 1995 ).
The protein functions encoded by the human coronavirus 229E (HCoV) replicase gene have been shown recently to suffice for both genome replication and transcription (Thiel et al., 2001b ) and it is likely that the same applies to other coronaviruses, including FIPV. The replicase gene occupies the 5'-proximal two-thirds of the genome and comprises two open reading frames (ORFs), ORFs 1a and 1b, which are connected by a ribosomal frameshift site (Brierley et al., 1987 ). Thus, two overlapping polyproteins are translated from the genome RNA: an ORF1a-encoded protein, ∼450-kDa (pp1a), and a C-terminally extended frameshift protein. The latter protein, called pp1ab, is encoded by ORFs 1a and 1b and has a calculated molecular mass of ∼750 kDa. The replicative polyproteins are processed extensively by viral proteases to produce the functional subunits of the virus replication/transcription machinery. The N-proximal region of pp1a/pp1ab is cleaved by zinc finger-containing papain-like proteases (so called accessory proteases) at two or three sites (Baker et al., 1989 ; Gorbalenya et al., 1991 ; Bonilla et al., 1997 ; Herold et al., 1998 , 1999 ; Kanjanahaluethai & Baker, 2000 ; Lim et al., 2000 ; Ziebuhr et al., 2001 ). In contrast, the C-proximal region is processed by a 3C-like cysteine protease (3CLpro), which is encoded in the 3'-proximal region of ORF1a and derives its name from a remote similarity to the picornavirus 3C proteases (Gorbalenya et al., 1989b ). 3CLpro cleaves the viral polyprotein at 11 conserved interdomain junctions (Ziebuhr et al., 2000 ), including those that release the core replicative domains, such as the putative RNA-dependent RNA polymerase (RdRp) and the helicase (Gorbalenya et al., 1989b ; Liu et al., 1994 ; Grötzinger et al., 1996 ; Heusipp et al., 1997b ; Denison et al., 1999 ; Seybert et al., 2000a ). Because of its key role in replicase gene expression, 3CLpro has been termed coronavirus main protease (Ziebuhr et al., 2000 ). Previous studies using recombinant main proteases of avian infectious bronchitis virus (IBV), mouse hepatitis virus (MHV) and HCoV, representing all three major groups of coronaviruses, provided initial insight into the functional and structural properties of this enzyme (reviewed by Ziebuhr et al., 2000 ). First, the coronavirus main protease was shown to possess a well-defined substrate specificity; all cleavage sites contain bulky hydrophobic residues at the P2 position, Gln at the P1 position and small aliphatic residues at the P1' position (Liu et al., 1994 , 1997 , 1998 ; Lu et al., 1995 , 1998 ; Ziebuhr et al., 1995 ; Grötzinger et al., 1996 ; Heusipp et al., 1997a , b ; Ziebuhr & Siddell, 1999 ; Denison et al., 1999 ). Second, both sequence comparisons and mutation analyses suggested that coronavirus main proteases may employ a catalytic dyad of conserved His and Cys residues. Thus, in contrast to most other viral proteases with (predicted or proven) chymotrypsin-like folds, no clear evidence has been obtained for the involvement of a third (acidic) residue in catalysis (Liu & Brown, 1995 ; Lu & Denison 1997 ; Ziebuhr et al., 1997 ). Third, coronavirus main proteases possess an additional, C-terminal domain with unknown function(s) (Gorbalenya et al., 1989b ). Although truncations of this domain reduced significantly or abolished completely the proteolytic activities of the IBV, MHV and HCoV main proteases in both in vivo and in vitro experiments (Lu & Denison, 1997 ; Ziebuhr et al., 1997 ; Ng & Liu, 2000 ), a direct involvement of the C-terminal domain in catalysis or substrate binding appears unlikely. Thus, it was shown recently for IBV 3CLpro that the removal of as much as 67 amino acids from the C terminus was partially tolerated (Ng & Liu, 2000 ).
To gain additional insight into the biochemistry of coronavirus 3CLpro-mediated proteolysis, we have cloned and sequenced FIPV 3CLpro and compared the deduced amino acid sequence with those of other coronavirus main proteases and the more distantly related potyviral 3C-like proteases. Functional predictions derived from the sequence comparison were tested subsequently. To this end, a series of recombinant proteins carrying single amino acid replacements was expressed in bacteria and the proteolytic activities of the purified proteins were analysed using a peptide-based assay. Using this approach, we have been able to confirm and extend the results of previous studies on the active site of coronavirus main proteases. The data suggest that coronavirus main proteases have evolved a catalytic system that only resembles very distantly that of the canonical chymotrypsin-like enzymes. Furthermore, we have identified specific amino acid replacements that enhanced significantly the activity of 3CLpro, indicating that the proteolytic activities of coronavirus main proteases may be tuned to meet specific functional constraints.
Virus and cells.FIPV strain 79-1146 was propagated in monolayers of Felis catus whole foetus (FCWF) cells (Jacobse-Geels & Horzinek, 1983 ) maintained in Dulbeccos modified Eagle medium containing 10% foetal bovine serum, nonessential amino acids (11140-035; Life Technologies), glutamine and antibiotics.
Determination of the FIPV 3CLpro-coding sequence.
Polyadenylated RNA was prepared from FIPV-infected FCWF cells and reverse transcribed using oligonucleotide AH10 [5' (A/C)ACAGC(A/T)CGTGCTTCTTT(A/G)TACAT 3']. The sequences of both AH10, which was also used as the downstream primer in the subsequent PCR, and the upstream PCR primer AH11 [5' AATCTTTT(C/T)GAAGGTGA(C/T)AAATTTG 3'] were derived from replicase gene regions that are highly conserved among group I coronaviruses. The nucleotide sequences of three independently obtained 2·5 kb PCR products were determined and the putative FIPV 3CLpro domain was identified by comparison of the deduced amino acid sequence with coronavirus replicase polyprotein sequences analysed previously (Boursnell et al., 1987 ; Lee et al., 1991 ; Herold et al., 1993 ; Eleouet et al., 1995 ). The nucleotide sequence of FIPV 3CLpro, together with the flanking sequences, was deposited in GenBank under accession number AF326575.
Construction of plasmid pMALc2-FIPV 3CLpro.
The coding sequence of the putative FIPV 3CLpro domain was amplified by PCR from the cDNA template described above using oligonucleotides AH12 (5' TCCGGATTGAGAAAAATGGCA 3') and AH17 (5' CGCGGATCCTTACTGAAGATTAACACCATACATTTG 3'). The 918 bp PCR product was digested with BamHI and ligated with XmnI/BamHI-digested pMAL-c2 DNA (New England Biolabs). The resulting plasmid, pMALc2-FIPV 3CLpro, encodes a 75 kDa fusion protein consisting of the Escherichia coli maltose-binding protein (MBP) and the putative FIPV 3CLpro domain.
Bacterial expression and purification of FIPV 3CLpro.
Expression of recombinant FIPV 3CLpro in E. coli TB1(pMALc2-FIPV 3CLpro) and purification of the recombinant fusion protein were carried out essentially as described previously for HCoV 3CLpro (Herold et al., 1996 ; Ziebuhr et al., 1997 ). The MBPFIPV 3CLpro fusion protein was purified by amylose-affinity chromatography and cleaved with factor Xa to release the FIPV 3CLpro domain. The protein mixture was then loaded onto a phenylSepharose HP column (Pharmacia Biotech) that had been preequilibrated with a solution containing 15 mM BisTrisHCl (pH 7·0), 600 mM NaCl, 1 mM DTT and 0·1 mM EDTA. Recombinant FIPV 3CLpro was eluted with 15 mM BisTrisHCl (pH 7·0), 1 mM DTT and 0·1 mM EDTA. The protein was concentrated (Centricon-3, Millipore) and dialysed with buffer I containing 20 mM TrisHCl (pH 8·8), 55 mM NaCl, 1 mM DTT and 0·1 mM EDTA. Then, the protein solution was loaded onto an anion-exchange column (UNO Q-1, Bio-Rad Laboratories) that had been preequilibrated with buffer I. The flow-through fractions containing 3CLpro were pooled, concentrated and loaded onto a Superdex 75 column (Pharmacia Biotech) run under isocratic conditions with 11 mM TrisHCl (pH 7·5), 100 mM NaCl, 1 mM DTT and 0·1 mM EDTA. The purified protein was concentrated to 15 mg/ml and stored at -80 °C.
Peptide synthesis.
The synthetic 15-mer peptides F1, SP7 and SP8 were prepared by solid-phase chemistry (Merrifield, 1965 ) and purified by high-performance liquid chromatography (HPLC) on a reverse-phase C18 silica column (Jerini Bio-Tools). Identity and homogeneity of the peptides were confirmed by mass spectrometry and analytical reverse-phase chromatography. Peptide F1 represents the FIPV replicase polyprotein sequence H2NVSVNSTLQSGLRKMACOOH (boldface indicates the cleaved dipeptide bond). Peptides P7 and P8 have the sequences H2NVDYGSDTVTYKSTACCOOH and H2NNKDASFIGKNLKSNCCOOH, respectively.
Peptide cleavage.
The enzymatic activity of mutant and wild-type FIPV 3CLpro (1 µg total protein) was determined by incubation with 0·5 mM substrate peptide F1 at 25 °C in 20 mM TrisHCl (pH 7·5), 200 mM NaCl, 1 mM DTT and 1 mM EDTA. Reaction aliquots were mixed with equal volumes of 2% trifluoroacetic acid and stored at -20 °C prior to analysis by reverse-phase HPLC on a Delta Pak C18 column (3·9x150 mm; Waters). Cleavage products were resolved using a 590% linear gradient of acetonitrile in 0·1% trifluoroacetic acid, as described previously (Ziebuhr et al., 1997 ). Quantification of peak areas was used to determine the extent of substrate conversion.
Site-directed mutagenesis of FIPV 3CLpro.
Site-directed mutagenesis was done by a recombination PCR method, as described by Yao et al. (1992) . The nucleotide sequences of the primers used for site-directed mutagenesis are given in Table 1. The pMALc2-FIPV 3CLpro-derived plasmids encoding mutant forms of FIPV 3CLpro were then transformed into E. coli TB1 cells and the recombinant proteins were synthesized, affinity purified and cleaved with factor Xa, as described above. The purity and structural integrity of the mutant proteins were analysed by SDSPAGE. The control protein for this experiment, wild-type FIPV 3CLpro, was purified in an identical manner.
Table 1. Oligonucleotides used for the amplification or mutagenesis of FIPV and HCoV sequences
Computer-aided comparative sequence analyses.
Coronavirus amino acid sequences were derived from the Genpeptides database. 3CLpro sequence alignments were produced using CLUSTAL X, version 1.81 (Thompson et al., 1997 ) and the Blossum series of scoring interresidue tables (Henikoff & Henikoff, 1994 ). The virus interfamily alignments were generated in the profile mode separately for the N- and C-terminal halves and then fused in an overall alignment. The alignments obtained were sent as input for the PhD program (Rost et al., 1995 ; Rost, 1996 ) to predict secondary structures and used also to build profiles using PROFILEWEIGHT (Thompson et al., 1994 ). These profiles were compared in pairs using PROPLOT (Thompson et al., 1994 ). Two profiles were compared by sliding windows of variable sizes along each possible register. Matches between two profiles that were within the top 0·1% and between the top 0·1 and 0·05% were marked by two different types of dots. Cluster phylogenetic trees were reconstructed using the neighbour-joining (NJ) algorithm (Saitou & Nei, 1987 ) with the Kimura correction (Kimura, 1983 ) and evaluated with 1000 bootstrap trials, as implemented in CLUSTAL X, version 1.81. Parsimonious trees were generated through exhaustive search and evaluated with bootstrap analysis using a UNIX version of PAUP* (Swofford, 2000 ) that is included in the GCG-Wisconsin Package of programs (Genetics Computer Group). Trees were prepared and modified using TREEVIEW (Page, 1996 ). Comparative sequence analysis of FIPV 3CLpro and related coronavirus proteases
Using RTPCR, we have amplified the complete coding region of FIPV 3CLpro. The sequences of the primers used in these experiments were derived from 3CLpro flanking regions that are highly conserved among group I coronaviruses. The nucleotide sequences of three independent RTPCR products were determined and the deduced amino acid sequence was compared to the replicase polyprotein sequences of other coronaviruses (Figs 1 and 2). On the basis of the overall sequence similarity with other coronavirus main proteases and the flanking sites of the MHV, IBV, and HCoV main proteases characterized previously, it is safe to predict that mature FIPV 3CLpro is released from the replicase polyproteins at flanking GlnSer cleavage sites and encompasses 302 amino acids (Fig. 2). With 94% amino acid sequence identity, the 3CLpro domain of FIPV is related most closely to the TGEV main protease, which, as yet, remains to be characterized. Overall, the phylogeny of the 3CLpro domains (Fig. 1) closely parallels that obtained for the structural proteins (Siddell, 1995 ), the core of the RdRp (Stephensen et al., 1999 ) and the ORF1b-encoded region of pp1ab (Chouljenko et al., 2001 ), indicating a concerted evolution of all coronavirus components.
|
|
The 3CLpro residues for which functional assignments have been made previously for other coronaviruses were found to be conserved also in the FIPV enzyme (Fig. 2), supporting these earlier predictions; these predictions were inferred originally from a comparison with a limited group of 3C(-like) proteases (Gorbalenya et al., 1989b ). We have decided to extend these studies and therefore compared the coronavirus main proteases with other viral chymotrypsin-like proteases in a systematic way. To this end, profiles were generated using alignments of serine and cysteine chymotrypsin-like proteases of different virus families. These profiles were then compared with the coronavirus 3CLpro profile in a dot-plot fashion. Among all proteases analysed, the potyvirus 3C-like proteases proved to be most similar to the coronavirus enzymes (data not shown), as they revealed a similarity in the regions that flank the catalytic His and Asp residues (Fig. 2A; Ziebuhr et al., 2000 ). This sequence affinity between corona- and potyvirus 3C-like proteases is compatible with other similarities between these viruses (Gorbalenya et al., 1989b ) and with the similarity between the main proteases of potyviruses and the unclassified nidovirus gill-associated virus (Cowley et al., 2000 ). When this plot (Fig. 2A) was converted to an alignment (Fig. 2B), it became evident that the catalytic Asp residue of the potyvirus proteases may be replaced by a conserved Gly residue in the coronavirus enzymes (Gly83 in FIPV 3CLpro) (Fig. 2B). This unusual substitution was also corroborated by an alignment of the predicted β-strands that encompass the whole catalytic domain, including a region around the catalytic Cys residue (Fig. 2B). In the latter region, no conservation was evident in the presented (Fig. 2A) and other dot-plots (data not shown) due to unique mutations in the coronavirus proteases. To characterize the coronavirus 3C-like proteases further, some of these and other positions were probed by site-directed mutagenesis in our subsequent experiments.
Expression, purification and proteolytic activity of FIPV 3CLpro
We have reported previously the production and purification of biologically active main proteases of both MHV and HCoV using E. coli expression systems (Ziebuhr et al., 1995 , 1997 ; Seybert et al., 1997 ). In the present study, we have adapted this strategy to produce recombinant FIPV 3CLpro for biochemical analyses. FIPV 3CLpro was expressed as a fusion protein with the maltose-binding protein of E. coli and first purified using amylose-affinity chromatography (Fig. 3, lanes 1 and 2). The fusion protein was cleaved with factor Xa to release mature (302 aa) FIPV 3CLpro (Fig. 3, lane 3), which was then purified to near homogeneity by hydrophobic interaction, anion-exchange and size-exclusion chromatography (Fig. 3, lanes 4, 5, and 6).
|
The proteolytic activity of the recombinant FIPV 3CLpro was analysed in peptide-based cleavage assays. In these experiments, 1 µg FIPV 3CLpro was incubated with a range of 15-mer peptides. Peptide F1 represented the predicted N-terminal autoprocessing site of FIPV 3CLpro and peptides P7 and P8 contained unrelated sequences. Analysis of the reaction products by reverse-phase chromatography revealed that FIPV 3CLpro hydrolysed the peptide F1 effectively, whereas the control peptides P7 and P8 remained uncleaved under the same reaction conditions, indicating the specificity of the cleavage reaction (Fig. 4). The assay thus seemed to be suitable to test the activities of FIPV 3CLpro mutants in subsequent experiments.
|
Mutation analysis of the catalytic system of coronavirus main proteases
In a first set of experiments, we substituted two residues, His41 and Cys144, which, based on sequence alignments (Gorbalenya et al., 1989b ; Lee et al., 1991 ; Herold et al., 1993 ; Eleouet et al., 1995 ) (Fig. 2B) and previous mutagenesis studies with other coronavirus main proteases, are predicted to be the principal catalytic residues of FIPV 3CLpro. The structural integrity of the partially purified mutant proteins was confirmed by SDSPAGE (Fig. 5A) and the proteolytic activities of the mutant proteins were measured in the peptide assay described above. As Table 2 shows, the proteolytic activities of the FIPV 3CLpro H41Y, H41R, C144S and C144A mutants were below the detection limit of the peptide assay. These data strongly support a catalytic function for His41 and Cys144 and are fully consistent with mutagenesis data published previously on the IBV, HCoV, MHV-A59 and MHV-JHM main proteases (Liu & Brown, 1995 ; Lu et al., 1995 ; Lu & Denison, 1997 ; Seybert et al., 1997 ; Ziebuhr et al., 1997 ). It should be noted that, in contrast to many other 3C and 3C-like proteases in which Cys→Ser substitutions retained partial or even full activities (Dessens & Lomonossoff, 1991 ; Hellen et al., 1991 ; Lawson & Semler, 1991 ; Grubman et al., 1995 ), the equivalent Cys→Ser replacement in FIPV 3CLpro reduced proteolytic activity to undetectable levels. Similar data have also been reported for recombinant MHV and HCoV main proteases (Seybert et al., 1997 ; Ziebuhr et al., 1997 ).
|
Table 2. Enzymatic activities of mutant, recombinant FIPV and HCoV 3C-like proteases
The inactive phenotype of the Cys→Ser mutant may be linked to the unique active site organization of coronavirus main proteases. Obviously, these enzymes have accepted replacements in a number of key positions that are not observed in other chymotrypsin-like serine/cysteine proteases (Fig. 2) (Gorbalenya et al., 1989b ; Ziebuhr et al., 2000 ). These replacements may be incompatible with the conversion of coronavirus main proteases from a Cys- to a Ser-based protease. Specifically, our prediction that coronavirus main proteases do not possess a third catalytic residue at the canonical position may be a critical factor. This residue promotes the polarization of the catalytic serinehistidine pair in serine proteases (the charge-relay system) and ensures the correct orientation of the thiolateimidazolium ion pair in cysteine proteases. To validate the prediction of our alignment with regard to the third catalytic residue, we have characterized a set of mutations at two positions in the FIPV and HCoV main proteases.
First, we probed both the HCoV pp1a/pp1ab Asn3029 residue (which corresponds to Asn64 of the HCoV 3CLpro sequence) and the homologous FIPV 3CLpro Asn64 residue. These residues occupy the only position between the catalytic His and Cys residues whose conservation profile (Asn, Asp and Glu) could be reconciled with the role of the third catalytic residue (Gorbalenya & Koonin, 1993 ). Although this position has a limited variability in coronavirus main proteases, a number of nonconservative substitutions were tolerated in the main proteases of MHV, HCoV and IBV, without significant loss of proteolytic activity in different in vitro assays (Liu & Brown, 1995 ; Lu & Denison, 1997 ; Ziebuhr et al., 1997 ). Only in one case, in which the HCoV Asn3029 residue was replaced by Pro, was a substantial decrease of activity measured (Ziebuhr et al., 1997 ). In the present study, we extended the list of mutations and tested Ala, Asp, Glu and Gln replacements (Fig. 2B and 5B) at this position of HCoV 3CLpro. As shown in Table 2, all these mutations resulted in proteins with significantly increased proteolytic activities (up to threefold). Notably, residues lacking acidic side chains also increased significantly the proteolytic activity of 3CLpro, with Gln being the most active replacement. Likewise, the Ala and Asp mutations at the equivalent Asn64 position of FIPV (Fig. 2B) had activities that not only retained but even surpassed the activities of the wild-type enzyme.
These data, in combination with results from previous studies (Liu & Brown, 1995 ; Lu & Denison, 1997 ; Ziebuhr et al., 1997 ), strongly contradict a catalytic function of the FIPV Asn64 residue and the equivalent residues of other coronavirus main proteases. Upon substitution of another candidate residue, Gly83, with Ala and Asp, only slight effects on the proteolytic activity of FIPV 3CLpro were observed. Even nonconservative replacements like Arg, Trp, Thr, Glu, Val and Pro resulted in active enzymes, albeit with significantly reduced activities (Table 2). These results indicate that other assays and approaches must be employed to rationalize the conservation of the Gly residue at this position and the unique evolution of the catalytic acidic residue in coronavirus main proteases.
The lack of the canonical acidic catalytic residue in coronavirus main proteases can be viewed as another manifestation of the plasticity of the catalytic system of (viral) chymotrypsin-like cysteine proteases. Thus, for example, as is also the case for the 3C-(like) proteases of picorna-like viruses, a limited variability of the third catalytic residue has been documented (Kean et al., 1991 ; Yu & Lloyd, 1991 ; Boniotti et al., 1994 ; Grubman et al., 1995 ). Furthermore, structural data have indicated that the hepatitis A virus (HAV) 3Cpro Asp84 residue, although it occupies a position in the main chain that is topologically equivalent to that of the catalytic Asp of chymotrypsin, is not, evidently, hydrogen-bonded to the catalytic His44 residue (Allaire et al., 1994 ; Bergmann et al., 1997 ). The unique Asp84 side-chain orientation contradicts the predicted catalytic role of this residue (Gorbalenya et al., 1989a ) and leaves the conservation of this residue unexplained.
Our data also provide experimental support for previous studies in which (based on sequence comparisons) a large evolutionary distance between coronaviruses and other positive-stranded RNA viruses was observed (Boursnell et al., 1987 ; Gorbalenya et al., 1989b ). In addition to 3CLpro, coronavirus RdRps, helicases and papain-like proteases also have unique structural and/or biochemical properties that separate them clearly from the homologous proteins of other positive-stranded RNA viruses, again indicating the special phylogenetic position of coronaviruses among all other positive-stranded RNA viruses (Gorbalenya et al., 1989b ; Koonin & Dolja, 1993 ; Herold et al., 1999 ; Seybert et al., 2000a , b ; Ziebuhr et al., 2001 ).
Mutation analysis of putative substrate-binding residues
An important part of the 3CLpro active site is formed by the characteristic sequence signature GlyXHis, which plays a central role in substrate binding (Bazan & Fletterick, 1988 ; Gorbalenya et al., 1989a ; Bergmann et al., 1997 ; Mosimann et al., 1997 ). It has been predicted that coronavirus main proteases employ a deviant form of this signature, TyrXHis (Gorbalenya et al., 1989b ) (Fig. 2B). To date, this theoretical functional assignment has not been tested experimentally for any coronavirus 3CLpro. The need for experimental data becomes even more evident when the unusual nature of the Gly→Tyr replacement and the very low overall similarity between coronavirus main proteases and other chymotrypsin-like enzymes (see above) are taken into account. We thus decided to target the FIPV 3CLpro Tyr160 residue by site-specific mutagenesis.
First, TyrXHis was converted into the canonical GlyXHis constellation by the Tyr→Gly substitution. The mutant exhibited a strongly reduced activity towards the peptide substrate, indicating that the aromatic side chain of Tyr is involved (either directly or indirectly) in proteolytic activity. To test this hypothesis, we analysed the effect of a structurally conservative mutation by substituting Phe→Tyr (mutant Y160F). Interestingly, as Table 2 shows, proteolytic activity was, again, strongly reduced to a level similar to that of the Y160G mutant, suggesting a specific function of the polar hydroxyl group. We then constructed mutant Y160T in order to answer the question of whether the postulated function of the hydroxyl group is retained when attached to an aliphatic side chain. Obviously, the complete loss of activity in this mutant (Table 2) indicates both structural and functional constraints for the FIPV 3CLpro amino acid residue at position 160 (and probably also the equivalent positions in other coronavirus main proteases). The specificity of this function is supported further by the fact that the neighbouring (and also conserved) Met161 residue can be substituted (M161A) without significant effect on proteolytic activity. Our data thus lead us to propose that both the aromatic and hydroxyl properties of Tyr have been selected at this position. These properties, which cannot be delivered by the Gly residue conserved in other 3C-(like) proteases or another residue, may be involved in catalysis and/or substrate binding in a unique way.
One plausible role for the Tyr160 residue would be to take over the function of the third catalytic residue, which is predicted to be replaced by Gly83 (see above). On the basis of structural data, a similar model has been developed recently for another Tyr residue of a related 3C protease, the Tyr143 residue of HAV 3Cpro (Bergmann et al., 1997 ). To test our hypothesis, we have characterized the double mutant Y160GG83D, in which two unique positions of the coronavirus main proteases were converted into the canonical form, and a negative control to this mutant, Y160GG83A. Both mutants proved to be inactive (Table 2), indicating that either our hypothesis is not correct or other mutations are required to make this conversion functional.
We then addressed the function of two additional residues proposed previously to be involved in substrate recognition. First, we exchanged Leu and Ala for the conserved FIPV 3CLpro His162 residue. In both cases, the proteolytic activities dropped below the detection limit of the assay used in this study. The obvious indispensability of His162 for proteolytic activity supports the conclusions drawn from sequence comparisons (Gorbalenya et al., 1989b ; Lee et al., 1991 ; Herold et al., 1993 ; Eleouet et al., 1995 ) and is also consistent with mutagenesis data obtained previously for the equivalent His residue in HCoV 3CLpro (Ziebuhr et al., 1997 ). It is thus reasonable to believe that the His162 residue is the functional equivalent to the His191 residue shown to be present in the S1-specificity pocket of HAV 3Cpro (Bergmann et al., 1997 ). Second, we mutagenized the FIPV 3CLpro Ser138 residue. This residue has been predicted to be functionally equivalent to the Thr141 residue of human rhinovirus type 14 3Cpro (Gorbalenya & Snijder, 1996 ) and the Thr142 residue of poliovirus 3Cpro, both of which have been proposed to be involved in the formation of the S1 subsite of the substrate-binding pocket by hydrogen-bonding to the carboxamide side chain of the P1 Gln residue (together with the conserved His residue mentioned above) (Matthews et al., 1994 ; Mosimann et al., 1997 ). Both mutants, FIPV 3CLpro S138A and S138T, had reduced proteolytic activities. Importantly, the Ser→Thr mutant retaining a hydroxyl group was significantly more active than the Ser→Ala mutant retaining the side-chain size (Table 2). Similar results were obtained in a previous mutagenesis study in which the equivalent Thr1179 residue of equine arteritis virus 3C-like nsp4 protease was shown to tolerate substitutions without loss of proteolytic activity in most cases (Snijder et al., 1996 ). Some of these mutants, however, proved to be unable to cleave some but not other cleavage sites, which strongly suggested an involvement of the Thr1179 residue in substrate recognition (rather than catalysis). But, clearly, more experiments are needed to determine conclusively the functions of His162 and Ser138. Specifically, genetic data, including a wide range of substrates, and structural data need to be obtained.
Concluding remarks
In this study, we have presented further theoretical and experimental evidence that coronavirus main proteases have evolved unique structural and functional characteristics in the framework of a chymotrypsin-like fold. Using an in vitro assay, we have characterized more than two dozen FIPV and HCoV 3CLpro point mutations at eight very conserved positions thought to be part of the active centre. The observed effects on the proteolytic activities of the respective enzymes were rationalized within a model derived from a broad comparison of 3C-(like) proteases of coronaviruses and other viruses, especially potyviruses. The model, which is consistent with the obtained data, suggests that coronavirus main proteases use a catalytic CysHis dyad that is not assisted by an acidic residue in the canonical sequence position. In addition to the Ser (Thr) and His residues present commonly in the substrate pocket of 3C-(like) proteases, coronavirus enzymes also employ the unique properties of a Tyr residue that replaces an otherwise conserved Gly residue. Finally, specific substitutions have been identified that confer significantly increased proteolytic activities on coronavirus main proteases. It will be interesting to test the in vivo effects of such 3CLpro mutants using the reverse-genetic systems established recently (Almazán et al., 2000 ; Yount et al., 2000 ; Thiel et al., 2001a ). Future studies, including structure analyses, are required to elucidate the peculiarities of the coronavirus 3CLpro active site in greater detail.
References
Almazán, F., González, J. M., Pénzes, Z., Izeta, A., Calvo, E., Plana-Durán, J. & Enjuanes, L. (2000). Engineering the largest RNA virus genome as an infectious bacterial artificial chromosome. Proceedings of the National Academy of Sciences, USA 97, 5516-5521.
Baker, S. C., Shieh, C. K., Soe, L. H., Chang, M. F., Vannier, D. M. & Lai, M. M. (1989). Identification of a domain required for autoproteolytic cleavage of murine coronavirus gene A polyprotein. Journal of Virology 63, 3693-3699.[Medline]
Bazan, J. F. & Fletterick, R. J. (1988). Viral cysteine proteases are homologous to the trypsin-like family of serine proteases: structural and functional implications. Proceedings of the National Academy of Sciences, USA 85, 7872-7876.[Abstract]
Bergmann, E. M., Mosimann, S. C., Chernaia, M. M., Malcolm, B. A. & James, M. N. (1997). The refined crystal structure of the 3C gene product from hepatitis A virus: specific proteinase activity and RNA recognition. Journal of Virology 71, 2436-2448.[Abstract]
Bonilla, P. J., Hughes, S. A. & Weiss, S. R. (1997). Characterization of a second cleavage site and demonstration of activity in trans by the papain-like proteinase of the murine coronavirus mouse hepatitis virus strain A59. Journal of Virology 71, 900-909.[Abstract]
Boniotti, B., Wirblich, C., Sibilia, M., Meyers, G., Thiel, H. J. & Rossi, C. (1994). Identification and characterization of a 3C-like protease from rabbit hemorrhagic disease virus, a calicivirus. Journal of Virology 68, 6487-6495.[Abstract]
Boursnell, M. E. G., Brown, T. D. K., Foulds, I. J., Green, P. F., Tomley, F. M. & Binns, M. M. (1987). Completion of the sequence of the genome of the coronavirus avian infectious bronchitis virus. Journal of General Virology 68, 57-77.[Abstract]
Brierley, I., Boursnell, M. E., Binns, M. M., Bilimoria, B., Blok, V. C., Brown, T. D. & Inglis, S. C. (1987). An efficient ribosomal frame-shifting signal in the polymerase-encoding region of the coronavirus IBV. EMBO Journal 6, 3779-3785.[Abstract]
Cavanagh, D. (1997). Nidovirales: a new order comprising Coronaviridae and Arteriviridae. Archives of Virology 142, 629-633.[Medline]
Chouljenko, V. N., Lin, X. Q., Storz, J., Kousoulas, K. G. & Gorbalenya, A. E. (2001). Comparison of genomic and predicted amino acid sequences of respiratory and enteric bovine coronaviruses isolated from the same animal with fatal shipping pneumonia. Journal of General Virology 82, 2927-2933.
Cowley, J. A., Dimmock, C. M., Spann, K. M. & Walker, P. J. (2000). Gill-associated virus of Penaeus monodon prawns: an invertebrate virus with ORF1a and ORF1b genes related to arteri- and coronaviruses. Journal of General Virology 81, 1473-1484.
de Groot, R. J. & Horzinek, M. C. (1995). Feline infectious peritonitis. In The Coronaviridae , pp. 293-315. Edited by S. G. Siddell. New York:Plenum Press.
den Boon, J. A., Snijder, E. J., Chirnside, E. D., de Vries, A. A., Horzinek, M. C. & Spaan, W. J. (1991). Equine arteritis virus is not a togavirus but belongs to the coronaviruslike superfamily. Journal of Virology 65, 2910-2920.[Medline]
Denison, M. R., Spaan, W. J., van der Meer, Y., Gibson, C. A., Sims, A. C., Prentice, E. & Lu, X. T. (1999). The putative helicase of the coronavirus mouse hepatitis virus is processed from the replicase gene polyprotein and localizes in complexes that are active in viral RNA synthesis. Journal of Virology 73, 6862-6871.
Dessens, J. T. & Lomonossoff, G. P. (1991). Mutational analysis of the putative catalytic triad of the cowpea mosaic virus 24K protease. Virology 184, 738-746.[Medline]
Eleouet, J. F., Rasschaert, D., Lambert, P., Levy, L., Vende, P. & Laude, H. (1995). Complete sequence (20 kilobases). of the polyprotein-encoding gene 1 of transmissible gastroenteritis virus. Virology 206, 817-822.[Medline]
Gorbalenya, A. E. & Koonin, E. V. (1993). Comparative analysis of the amino acid sequences of the key enzymes of the replication and expression of positive-strand RNA viruses. Validity of the approach and functional and evolutionary implications. Soviet Scientific Reviews Section D Physicochemical Biology Reviews 11, 1-84.
Gorbalenya, A. E. & Snijder, E. J. (1996). Viral cysteine proteinases. Perspectives in Drug Discovery and Design 6, 64-86.
Gorbalenya, A. E., Donchenko, A. P., Blinov, V. M. & Koonin, E. V. (1989a). Cysteine proteases of positive strand RNA viruses and chymotrypsin-like serine proteases. A distinct protein superfamily with a common structural fold. FEBS Letters 243, 103-114.[Medline]
Gorbalenya, A. E., Koonin, E. V., Donchenko, A. P. & Blinov, V. M. (1989b). Coronavirus genome: prediction of putative functional domains in the non-structural polyprotein by comparative amino acid sequence analysis. Nucleic Acids Research 17, 4847-4861.[Abstract]
Gorbalenya, A. E., Koonin, E. V. & Lai, M. M. (1991). Putative papain-related thiol proteases of positive-strand RNA viruses. Identification of rubi- and apthovirus proteases and delineation of a novel conserved domain associated with proteases of rubi-, alpha- and coronaviruses. FEBS Letters 288, 201-205.[Medline]
Grötzinger, C., Heusipp, G., Ziebuhr, J., Harms, U., Süss, J. & Siddell, S. G. (1996). Characterization of a 105-kDa polypeptide encoded in gene 1 of the human coronavirus HCV 229E. Virology 222, 227-235.[Medline]
Grubman, M. J., Zellner, M., Bablanian, G., Mason, P. W. & Piccone, M. E. (1995). Identification of the active-site residues of the 3C proteinase of foot-and-mouth disease virus. Virology 213, 581-589.[Medline]
Hellen, C. U., Facke, M., Kräusslich, H. G., Lee, C. K. & Wimmer, E. (1991). Characterization of poliovirus 2A proteinase by mutational analysis: residues required for autocatalytic activity are essential for induction of cleavage of eukaryotic initiation factor 4F polypeptide p220. Journal of Virology 65, 4226-4231.[Medline]
Henikoff, S. & Henikoff, J. G. (1994). Position-based sequence weights. Journal of Molecular Biology 243, 574-578.[Medline]
Herold, J., Raabe, T., Schelle-Prinz, B. & Siddell, S. G. (1993). Nucleotide sequence of the human coronavirus 229E RNA polymerase locus. Virology 195, 680-691.[Medline]
Herold, J., Siddell, S. & Ziebuhr, J. (1996). Characterization of coronavirus RNA polymerase gene products. Methods in Enzymology 275, 68-89.[Medline]
Herold, J., Gorbalenya, A. E., Thiel, V., Schelle, B. & Siddell, S. G. (1998). Proteolytic processing at the amino terminus of human coronavirus 229E gene 1-encoded polyproteins: identification of a papain-like proteinase and its substrate. Journal of Virology 72, 910-918.
Herold, J., Siddell, S. G. & Gorbalenya, A. E. (1999). A human RNA viral cysteine proteinase that depends upon a unique Zn2+-binding finger connecting the two domains of a papain-like fold. Journal of Biological Chemistry 274, 14918-14925.
Herrewegh, A. A., Vennema, H., Horzinek, M. C., Rottier, P. J. & de Groot, R. J. (1995). The molecular genetics of feline coronaviruses: comparative sequence analysis of the ORF7a/7b transcription unit of different biotypes. Virology 212, 622-631.[Medline]
Herrewegh, A. A., Smeenk, I., Horzinek, M. C., Rottier, P. J. & de Groot, R. J. (1998). Feline coronavirus type II strains 79-1683 and 79-1146 originate from a double recombination between feline coronavirus type I and canine coronavirus. Journal of Virology 72, 4508-4514.
Heusipp, G., Grötzinger, C., Herold, J., Siddell, S. G. & Ziebuhr, J. (1997a). Identification and subcellular localization of a 41 kDa, polyprotein 1ab processing product in human coronavirus 229E-infected cells. Journal of General Virology 78, 2789-2794.[Abstract]
Heusipp, G., Harms, U., Siddell, S. G. & Ziebuhr, J. (1997b). Identification of an ATPase activity associated with a 71-kilodalton polypeptide encoded in gene 1 of the human coronavirus 229E. Journal of Virology 71, 5631-5634.[Abstract]
Horzinek, M. C., Lutz, H. & Pedersen, N. C. (1982). Antigenic relationships among homologous structural polypeptides of porcine, feline, and canine coronaviruses. Infection and Immunity 37, 1148-1155.[Medline]
Jacobse-Geels, H. E. L. & Horzinek, M. C. (1983). Expression of feline infectious peritonitis coronavirus antigens on the surface of feline macrophage-like cells. Journal of General Virology 64, 1859-1866.[Abstract]
Kanjanahaluethai, A. & Baker, S. C. (2000). Identification of mouse hepatitis virus papain-like proteinase 2 activity. Journal of Virology 74, 7911-7921.
Kean, K. M., Teterina, N. L., Marc, D. & Girard, M. (1991). Analysis of putative active site residues of the poliovirus 3C protease. Virology 181, 609-619.[Medline]
Kimura, M. (1983). The Neutral Theory of Molecular Evolution, p. 367. Cambridge, NY: Cambridge University Press.
Koonin, E. V. & Dolja, V. V. (1993). Evolution and taxonomy of positive-strand RNA viruses: implications of comparative analysis of amino acid sequences. Critical Reviews in Biochemistry and Molecular Biology 28, 375-430.[Abstract]
Lawson, M. A. & Semler, B. L. (1991). Poliovirus thiol proteinase 3C can utilize a serine nucleophile within the putative catalytic triad. Proceedings of the National Academy of Sciences, USA 88, 9919-9923.[Abstract]
Lee, H. J., Shieh, C. K., Gorbalenya, A. E., Koonin, E. V., La Monica, N., Tuler, J., Bagdzhadzhyan, A. & Lai, M. M. (1991). The complete sequence (22 kilobases) of murine coronavirus gene 1 encoding the putative proteases and RNA polymerase. Virology 180, 567-582.[Medline]
Lim, K. P., Ng, L. F. & Liu, D. X. (2000). Identification of a novel cleavage activity of the first papain-like proteinase domain encoded by open reading frame 1a of the coronavirus avian infectious bronchitis virus and characterization of the cleavage products. Journal of Virology 74, 1674-1685.
Liu, D. X. & Brown, T. D. (1995). Characterisation and mutational analysis of an ORF 1a-encoding proteinase domain responsible for proteolytic processing of the infectious bronchitis virus 1a/1b polyprotein. Virology 209, 420-427.[Medline]
Liu, D. X., Brierley, I., Tibbles, K. W. & Brown, T. D. (1994). A 100-kilodalton polypeptide encoded by open reading frame (ORF) 1b of the coronavirus infectious bronchitis virus is processed by ORF 1a products. Journal of Virology 68, 5772-5780.[Abstract]
Liu, D. X., Shen, S., Xu, H. Y. & Wang, S. F. (1998). Proteolytic mapping of the coronavirus infectious bronchitis virus 1b polyprotein: evidence for the presence of four cleavage sites of the 3C-like proteinase and identification of two novel cleavage products. Virology 246, 288-297.[Medline]
Lu, Y. & Denison, M. R. (1997). Determinants of mouse hepatitis virus 3C-like proteinase activity. Virology 230, 335-342.[Medline]
Lu, Y., Lu, X. & Denison, M. R. (1995). Identification and characterization of a serine-like proteinase of the murine coronavirus MHV-A59. Journal of Virology 69, 3554-3559.[Abstract]
Lu, X. T., Sims, A. C. & Denison, M. R. (1998). Mouse hepatitis virus 3C-like protease cleaves a 22-kilodalton protein from the open reading frame 1a polyprotein in virus-infected cells and in vitro. Journal of Virology 72, 2265-2271.
Matthews, D. A., Smith, W. W., Ferre, R. A., Condon, B., Budahazi, G., Sisson, W., Villafranca, J. E., Janson, C. A., McElroy, H. E., Gribskov, C. L. and others (1994). Structure of human rhinovirus 3C protease reveals a trypsin-like polypeptide fold, RNA-binding site, and means for cleaving precursor polyprotein. Cell 77, 761771.[Medline]
Merrifield, R. B. (1965). Automated synthesis of peptides. Science 150, 178-185.[Medline]
Mosimann, S. C., Cherney, M. M., Sia, S., Plotch, S. & James, M. N. (1997). Refined X-ray crystallographic structure of the poliovirus 3C gene product. Journal of Molecular Biology 273, 1032-1047.[Medline]
Ng, L. F. & Liu, D. X. (2000). Further characterization of the coronavirus infectious bronchitis virus 3C-like proteinase and determination of a new cleavage site. Virology 272, 27-39.[Medline]
Olsen, C. W. (1993). A review of feline infectious peritonitis virus: molecular biology, immunopathogenesis, clinical aspects, and vaccination. Veterinary Microbiology 36, 1-37.[Medline]
Page, R. D. (1996). TREEVIEW: an application to display phylogenetic trees on personal computers. Computer Applications in the Biosciences 12, 357-358.[Medline]
Rost, B. (1996). PhD: predicting one-dimensional protein structure by profile-based neural networks. Methods in Enzymology 266, 525-539.[Medline]
Rost, B., Casadio, R., Fariselli, P. & Sander, C. (1995). Transmembrane helices predicted at 95% accuracy. Protein Science 4, 521-533.
Saitou, N. & Nei, M. (1987). The neighbor-joining method: a new method for reconstructing phylogenetic trees. Molecular Biology and Evolution 4, 406-425.[Abstract]
Sawicki, S. G. & Sawicki, D. L. (1998). A new model for coronavirus transcription. Advances in Experimental Medicine and Biology 440, 215-219.[Medline]
Sawicki, D. L, Wang, T. & Sawicki, S. G. (2001). The RNA structures engaged in replication and transcription of the A59 strain of mouse hepatitis virus. Journal of General Virology 82, 385-396.
Seybert, A., Ziebuhr, J. & Siddell, S. G. (1997). Expression and characterization of a recombinant murine coronavirus 3C-like proteinase. Journal of General Virology 78, 71-75.[Abstract]
Seybert, A., Hegyi, A., Siddell, S. G. & Ziebuhr, J. (2000a). The human coronavirus 229E superfamily 1 helicase has RNA and DNA duplex-unwinding activities with 5'-to-3' polarity. RNA 6, 1056-1068.
Seybert, A., van Dinten, L. C., Snijder, E. J. & Ziebuhr, J. (2000b). Biochemical characterization of the equine arteritis virus helicase suggests a close functional relationship between arterivirus and coronavirus helicases. Journal of Virology 74, 9586-9593.
Siddell, S. G. (1995). The Coronaviridae: an introduction. In The Coronaviridae , pp. 1-10. Edited by S. G. Siddell. New York:Plenum Press.
Snijder, E. J., Wassenaar, A. L., van Dinten, L. C., Spaan, W. J. & Gorbalenya, A. E. (1996). The arterivirus nsp4 protease is the prototype of a novel group of chymotrypsin-like enzymes, the 3C-like serine proteases. Journal of Biological Chemistry 271, 4864-4871.
Spaan, W., Delius, H., Skinner, M., Armstrong, J., Rottier, P., Smeekens, S., van der Zeijst, B. A. & Siddell, S. G. (1983). Coronavirus mRNA synthesis involves fusion of non-contiguous sequences. EMBO Journal 2, 1839-1844.[Medline]
Stephensen, C. B., Casebolt, D. B. & Gangopadhyay, N. N. (1999). Phylogenetic analysis of a highly conserved region of the polymerase gene from 11 coronaviruses and development of a consensus polymerase chain reaction assay. Virus Research 60, 181-189.[Medline]
Swofford, D. L. (2000). PAUP*: Phylogenetic Analysis using Parsimony, version 4. Sunderland: Sinauer Associates.
Thiel, V., Herold, J., Schelle, B. & Siddell, S. G. (2001a). Infectious RNA transcribed in vitro from a cDNA copy of the human coronavirus genome cloned in vaccinia virus. Journal of General Virology 82, 1273-1281.
Thiel, V., Herold, J., Schelle, B. & Siddell, S. G. (2001b). Viral replicase gene products suffice for coronavirus discontinuous transcription. Journal of Virology 75, 6676-6681.
Thompson, J. D., Higgins, D. G. & Gibson, T. J. (1994). Improved sensitivity of profile searches through the use of sequence weights and gap excision. Computer Applications in the Biosciences 10, 19-29.[Abstract]
Thompson, J. D., Gibson, T. J., Plewniak, F., Jeanmougin, F. & Higgins, D. G. (1997). The CLUSTAL X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Research 25, 4876-4882.
van Marle, G., Dobbe, J. C., Gultyaev, A. P., Luytjes, W., Spaan, W. J. & Snijder, E. J. (1999). Arterivirus discontinuous mRNA transcription is guided by base pairing between sense and antisense transcription-regulating sequences. Proceedings of the National Academy of Sciences, USA 96, 12056-12061.
Vennema, H., Rossen, J. W., Wesseling, J., Horzinek, M. C. & Rottier, P. J. (1992). Genomic organization and expression of the 3' end of the canine and feline enteric coronaviruses. Virology 191, 134-140.[Medline]
Vennema, H., Poland, A., Foley, J. & Pedersen, N. C. (1998). Feline infectious peritonitis viruses arise by mutation from endemic feline enteric coronaviruses. Virology 243, 150-157.[Medline]
Yao, Z., Jones, D. H. & Grose, C. (1992). Site-directed mutagenesis of herpesvirus glycoprotein phosphorylation sites by recombination polymerase chain reaction. PCR Methods & Applications 1, 205-207.[Medline]
Yount, B., Curtis, K. M. & Baric, R. S. (2000). Strategy for systematic assembly of large RNA and DNA genomes: transmissible gastroenteritis virus model. Journal of Virology 74, 10600-10611.
Yu, S. F. & Lloyd, R. E. (1991). Identification of essential amino acid residues in the functional activity of poliovirus 2A protease. Virology 182, 615-625.[Medline]
Ziebuhr, J. & Siddell, S. G. (1999). Processing of the human coronavirus 229E replicase polyproteins by the virus-encoded 3C-like proteinase: identification of proteolytic products and cleavage sites common to pp1a and pp1ab. Journal of Virology 73, 177-185.
Ziebuhr, J., Herold, J. & Siddell, S. G. (1995). Characterization of a human coronavirus (strain 229E) 3C-like proteinase activity. Journal of Virology 69, 4331-4338.[Abstract]
Ziebuhr, J., Heusipp, G. & Siddell, S. G. (1997). Biosynthesis, purification, and characterization of the human coronavirus 229E 3C-like proteinase. Journal of Virology 71, 3992-3997.[Abstract]
Ziebuhr, J., Snijder, E. J. & Gorbalenya, A. E. (2000). Virus-encoded proteinases and proteolytic processing in the Nidovirales. Journal of General Virology 81, 853-879.
Ziebuhr, J., Thiel, V. & Gorbalenya, A. E. (2001). The autocatalytic release of a putative RNA virus transcription factor from its polyprotein precursor involves two paralogous papain-like proteases that cleave the same peptide bond. Journal of Biological Chemistry 276, 33220-33232.
Received 18 September 2001; accepted 9 November 2001.