Abstract
Baculoviruses have evolved at least two categories of envelope-associated proteins. These include the GP64 (Blissard & Rohrmann, 1989 ) and the LD130 groups (Pearson et al., 2000 ), which are both low-pH-induced envelope fusion proteins that appear to be critical for the spread of the infection within host insects. Whereas members of the LD130 group lack homologues of gp64, the gp64-containing viruses encode a homologue of ld130. No fusion function has been demonstrated for the ld130 homologues encoded by gp64-containing viruses (Pearson et al., 2001 ). NPVs that encode GP64 appear to be found only in the Group I category of baculoviruses, whereas those employing LD130 homologues as their envelope fusion protein are in Group II (Pearson et al., 2000 ).
A feature of all ld130 and gp64 genes found in NPVs is the presence of both early and late promoter elements (Fig. 1). Whereas single RNA polymerase II promoter elements are evident in both AcMNPV and OpMNPV gp64 genes, they both have four late promoter elements upstream of their translational initiation codon (Fig. 1A). In addition, one to two late promoter elements along with a single TATAA/CAGT motif are found upstream of the translation initiation codons in the ld130 homologues. In AcMNPV and OpMNPV gp64 genes, the distal two late promoters appear to account for most of the late expression from these genes (Blissard & Rohrmann, 1989 ; Garrity et al., 1997 ) and elimination of both these elements appears to abolish late gene expression. Early gp64 transcription involves single copies of both TATAA and CAGT mRNA start site elements and elimination of either of these motifs causes a marked reduction in gene expression (Blissard et al., 1992 ).
|
The presence of both early and late promoter elements in the 5' regulatory region in the two different types of ld130 genes (Fig. 1B and C) suggests that they may be expressed in a similar temporal manner to gp64, and this may reflect a novel feature of baculovirus envelope-associated proteins. In order to determine if both promoters are utilized by representatives of the two categories of ld130 genes, we have transcriptionally mapped ld130 and op21, an ld130 homologue in gp64-containing viruses. We found that ld130 uses the early promoter early in infection and then shifts to the late promoter at the later timepoints. In contrast, op21 predominantly utilizes its early promoter throughout its infection cycle. Virus and cell lines.
Lymantria dispar multinucleocapsid nucleopolyhedrovirus (LdMNPV) strain 56-1 (Slavicek, 1991 ) and OpMNPV (Ahrens et al., 1997 ) were used for infections and were propagated in a Lymantria dispar (Ld-652Y) cell line grown in TNM-FH media (Summers & Smith, 1987 ) supplemented with 10% foetal bovine serum (FBS), penicillin G (50 units/ml), streptomycin (50 µg/ml, Whittaker Bioproducts) and fungizone (amphotericin B, 375 ng/ml, Flow Laboratories).
RNA preparation and Northern blot analysis.
Ld652Y cells were infected with LdMNPV or OpMNPV at an m.o.i. of 10. After 1 h of incubation with the virus, the medium was removed and replaced with fresh medium. This point was defined as time zero. Cells were collected at various times thereafter, and total cellular RNA was isolated using TRIzol reagent (Life Technologies) according to the manufacturers instructions.
Riboprobes to ld130 and op21 were synthesized using [α-32P]ATP andT7 RNA polymerase (Fermentas) and T3 RNA polymerase (Promega), respectively, according to the manufacturers instructions. pLd130HA was derived from pLd130FL (Pearson et al., 2000 ) by inserting a 40 nt sequence encoding a nine amino acid HA epitope in-frame into the NcoI site (nt 128239) located downstream of the transmembrane domain. The HA insert, which contains a stop codon at its 3' end, abolished the NcoI site. pLd130HA was linearized with NcoI, and cRNA to ld130 was generated using T7 RNA polymerase. In order to synthesize cRNA to op21, the entire op21 gene was cloned into pKSie1 (Pearson et al., 2001 ). The resulting clone was linearized with HindIII and cRNA was synthesized using T3 RNA polymerase.
Northern blot analysis was carried out as described by Ahrens et al. (1995) with several modifications. Briefly, total RNA from infected cells was electrophoresed on a 1% agarose2·2% formaldehyde gel in 20 mM MOPS buffer and transferred to a Gene Screen Plus membrane. The RNA was cross-linked to the membrane using a UV cross-linker (UV Stratalinker 1800, Stratagene) and the membrane was then baked for 2 h at 80 °C. Prehybridization of the membrane was carried out for at least 2 h at 65 °C in 50% formamide, 5xSSC, 0·1% SDS, 50 mM sodium phosphate, pH 6·8, 0·1% sodium pyrophosphate/5xDenhardts solution, 50 µg/ml salmon sperm DNA (McCaughern-Carucci, 1997 ) and hybridization was carried out overnight at 65 °C in the same buffer. Membranes were washed as described by Ahrens et al. (1995) , followed by a 1 h wash in 0·1xSSC, 0·1% SDS at 65 °C.
5' and 3' rapid amplification of cDNA ends (RACE) and transcriptional mapping.
5' and 3' RACE were carried out using a GeneRacer Kit (Invitrogen) following the manufacturers instructions. PCR on the cDNA was performed using Taq DNA polymerase (Promega) with the GeneRacer 5' and 5' nested primers and internal gene specific primers (GSP). For ld130 the GSPs were BAE4 (5' AACTTGGCGATGTTCACCAG 3') and BAE6 (5' CGATACAGCTCGTCGAGCTC 3') and for op21 they were HdH-F1 (5' GTGCGGCAGCACTCTGACGCGG 3') and HdH-F2 (5' CTGACCAGCTTCACCAGCGG 3'). For 3' RACE the GeneRacer 3' primer was used with GSP B201 (5' CTGCTGCACTACGAGAACTC 3') for ld130 and GSP HdI-10 (5' CACGTGAACACCTCGCTG 3') for op21. The PCR products were cloned into pCR2.1-TOPO vectors (Invitrogen), following the manufacturers instructions. Selected clones were purified (Qiagen) and sequenced as previously described (Kuzio et al., 1999 ).
The size of the major mRNA species identified by Northern blot analysis was similar for both ld130 and op21 at about 2400 nt (Fig. 2). When the addition of a poly(A) tail is taken into account, this is similar to what would be predicted by 5' and 3' mapping of early and late mRNAs of ld130 (2127 and 2194 nt, respectively) and op21 (2125 and 2202 nt, respectively) (see below). Ld130 transcripts were faintly visible by 24 h post-infection (p.i.) and became quite intense at 48 h p.i. (Fig. 2A). Op21 showed low levels of specific transcripts at 1224 h p.i. becoming more intense at 36 h p.i. (Fig. 2B). These analyses also indicated the presence of longer transcripts of about 4·3 (ld130) (Fig. 2A, lanes 9, 10) and 6·4 kb (op21) (Fig. 2B, lanes 710) and additional large species. These larger transcripts were not characterized.
|
Transcription initiation sites
5' and 3' rapid amplification of cDNA ends (RACE) in combination with DNA cloning and sequence analysis were used to locate the mRNA initiation and termination sites for major PCR products of viral RNAs from selected timepoints. For ld130, four clones containing inserts derived from the 24 h 245 nt PCR product (Fig. 3B, lane 1) were sequenced and were all found to start at the A of the CATT early mRNA start site consensus sequence (Fig. 4A). This is a timepoint at which the gene is transcribed at relatively low levels. By 72 h p.i., alarger cDNA (310 bp) is predominant (Fig. 3B, lane 2) and it corresponds to initiation primarily within the late promoter element. This would yield mRNA 67 nt (2194 vs 2127 nt) longer than from the early promoter. Two clones derived from the 310 bp PCR product (Fig. 3B, lane 2) from this timepoint were sequenced and both mapped to the second A of the ATAAG late promoter element (Fig. 4A).
|
|
For op21, two PCR clones from the band at 309 bp (Fig. 3D, lane 1) derived from the 24 h p.i. timepoint were sequenced and found to initiate at the A of the CAGT early mRNA start site consensus sequence (Fig. 4C). At 36 h p.i. (Fig. 3D, lane 2) most of the PCR products were the same size as the early transcript from 24 h p.i. Three 36 h p.i. clones containing this 309 bp band were sequenced and were also found to start at the A of the CAGT (Fig. 4C). In addition, two clones (one 36 and one 48 h p.i.) derived from a minor band at 389 bp (Fig. 3D, lanes 2 and 3) were sequenced and found to initiate at the first A of the GTAAG late promoter element. In contrast to ld130, however, the predominant cDNA at 72 h p.i. was the same size as earlier bands and sequence analysis of a cDNA clone confirmed that the mRNA was still initiating from the early promoter (Fig. 3D, lane 4). Therefore, although a late promoter is present within 100 bp of the ATG initiation codon, the early promoter appears to account for most late transcription.
Identification of a spliced transcript
A 503 bp cDNA band that was less intense than the major op21 cDNA band was observed at 48 and 72 h p.i. (Fig. 3D, lanes 3, 4) One clone each derived from this band at 48 and 72 h p.i. were sequenced and found to be derived from spliced transcripts which initiated at a late promoter element (nt 13795) upstream of OpMNPV orf18. Another spliced transcript was identified in a 36 h p.i. clone which mapped to a late promoter element (nt 14044) within orf18. All these transcripts were spliced just downstream of the orf18 TAG termination codon to a sequence within op21 (Fig. 3C, Fig. 4E). This results in an intron with the following coordinates: 14164 GT...AG 17005. The nucleotides, GT...AG, are invariant at the termini of introns involved in nuclear splicing (Lewin, 1997 ). Since these RNAs are spliced immediately downstream of the termination codon, they probably would not encode a spliced protein but would only code for orf18 or a small orf within orf18. The two longer spliced transcripts would be about 2300 nt long whereas the other would be somewhat shorter. However, they all would fall within the size range for the major band observed on the Northern blot (Fig. 2B, lanes 710). Whether these spliced transcripts are an artifact of baculovirus late transcription produced by the presence of the nuclear splicing machinery or actually serve a function remains to be determined.
Transcription termination sites
The transcript stop points for the mRNAs of both ld130 and op21 mapped close to the termination codon of the orf. Two ld130 cDNA clones from the 72 h p.i. timepoint were sequenced and found to terminate 68 nt downstream of the termination codon (Fig. 4B). This site is about 25 nt downstream of a possible 3' processing signal (AATTAAA) in a very AT-rich region. This is somewhat different from conventional 3' regions of eukaryotic genes and also lacks the run of T residues that have been implicated in termination by the baculovirus late RNA polymerase (Jin & Guarino, 2000 ). For op21, 24 and 72 h p.i. clones were sequenced and found to terminate 111112 nt downstream of the stop codon (Fig. 4D). This site was located 12 nt downstream of a consensus 3' processing signal AATAAA and also just downstream of a GTTG sequence.
Although early and late promoters were used by both ld130 and op21, they show a different pattern of expression. The relative differences in the 5' mRNA start sites that are used are likely reflected by the 5' RACE amplified cDNA populations because for each population of mRNAs the same primers were employed and the early and late templates were identical except that the late mRNAs were somewhat longer at the 5' end. For ld130, our analyses suggested that there is a shift from almost exclusive use of the early promoter at 24 h p.i. to the exclusive use of the late promoter element later in infection. The kinetics of late ld130 expression are similar to late expression from the LdMNPV 25k fp gene (Bischoff & Slavicek, 1996 ) which also showed maximal levels of late mRNA at 48 and 72 h p.i. In contrast, op21 appeared to be expressed predominantly from the early promoter at 24 through 72 h p.i. Expression from the op21 late promoter was observed (Fig. 3), but appears to be at a low level. Another cDNA species present at later times was analysed and found to be a spliced transcript that initiates in the orf18 region and is fused to a sequence within op21. Although a scanning model of late transcription initiation has been proposed, evidence suggests that it is not used with AcMNPV gp64 late promoter elements (Garrity et al., 1997 ). Therefore, the op21 late promoter element may be in a poor context resulting in low levels of expression, rather than being affected by expression from upstream late promoters. An expression pattern similar to op21 has been observed for the OpMNPV ie-1 gene. It appears to be activated at late times of infection similar to op21 and the late transcripts map to an early transcriptional start site (Theilmann & Stewart, 1991 ).
The two envelope fusion protein genes, gp64 and ld130, appear to have similar patterns of gene expression and employ both early and late promoters. Two theories have been advanced to explain the requirement for this pattern of expression for gp64. In one, it has been suggested that the early expression of this protein allows time for its glycosylation, transport and integration into the cell membrane in preparation for the budding of the newly assembled nucleocapsids later in infection (Blissard & Rohrmann, 1989 ). Late expression would sustain this production and allow for replenishing the membrane as the envelope proteins are depleted by nucleocapsid budding. Another theory suggests that early gp64 expression prepares cell membranes for virus budding, thereby permitting some nucleocapsids from the primary infection to travel through gut cells without undergoing replication. Such unreplicated virions might bud directly out through the basal membrane into other tissues, thereby facilitating the early establishment of a systemic infection and avoiding host defence mechanisms such as sloughing of the gut lining (Volkman, 1997 ). In this instance, late expression of gp64 would be coordinated with the late expression of the nucleocapsid proteins. Clearly, in both these cases, the early expression of envelope fusion proteins genes could contribute to the acceleration of the establishment of an infection. Whatever the rationale for the expression strategy of gp64, it may be of considerable importance to the success of the virus, as this pattern of expression appears to have evolved independently for both the gp64 and ld130 groups of genes that encode envelope fusion proteins.
We thank Rob Melton, Wendy Evans and Robert Gould for their technical assistance. This research was supported by a grant from the NSF (9982536) and contributions from Lawrence and Margaret Noall. This is Technical Report no. 11818 from the Oregon State University Agricultural Experiment Station.References
Ahrens, C. H., Russell, R., Funk, C. J., Evans, J. T., Harwood, S. H. & Rohrmann, G. F. (1997). The sequence of the Orgyia pseudotsugata multinucleocapsid nuclear polyhedrosis virus genome. Virology 229, 381-399.[Medline]
Ayres, M. D., Howard, S. C., Kuzio, J., Lopez-Ferber, M. & Possee, R. D. (1994). The complete DNA sequence of Autographa californica nuclear polyhedrosis virus. Virology 202, 586-605.[Medline]
Bischoff, D. S. & Slavicek, J. M. (1996). Characterization of the Lymantria dispar nucleopolyhedrovirus 25K FP gene. Journal of General Virology 77, 1913-1923.
Blissard, G. W. & Rohrmann, G. F. (1989). Location, sequence, transcriptional mapping, and temporal expression of the gp64 envelope glycoprotein gene of the Orgyia pseudotsugata multicapsid nuclear polyhedrosis virus. Virology 170, 537-555.[Medline]
Blissard, G. W., Kogan, P. H., Wei, R. & Rohrmann, G. F. (1992). A synthetic early promoter from a baculovirus: roles of the TATA box and conserved mRNA start site CAGT sequence in basal levels of transcription. Virology 190, 783-793.[Medline]
Chen, X., IJkel, W., Tarchini, R., Sun, X., Sandbrink, H., Wang, H., Peters, S., Zuidema, D., Lankhorst, R., Vlak, J. & Hu, Z. (2001). The sequence of the Helicoverpa armigera single nucleocapsid nucleopolyhedrovirus genome. Journal of General Virology 82, 241-257.
Garrity, D. B., Chang, M.-J. & Blissard, G. W. (1997). Late promoter selection in the baculovirus gp64 envelope fusion protein gene. Virology 231, 167-181.[Medline]
Hashimoto, Y., Hayakawa, T., Ueno, Y., Fugita, T., Sano, Y. & Matsumoto, T. (2000). Sequence analysis of the Plutella xylostella granulovirus genome. Virology 275, 358-372.[Medline]
Hayakawa, T., Ko, R., Okano, K., Seong, S., Goto, C. & Maeda, S. (1999). Sequence analysis of the Xestia c-nigrum granulovirus genome. Virology 262, 277-297.[Medline]
IJkel, W. F. J., van Strien, E. A., Jeldens, J. G. M., Broer, R., Zuidema, D., Goldbach, R. W. & Vlak, J. M. (1999). Sequence and organization of the Spodoptera exigua multicapsid nucleopolyhedrovirus genome. Journal of General Virology 80, 3289-3304.
Jin, J. & Guarino, L. A. (2000). 3'-end formation of baculovirus late RNAs. Journal of Virology 74, 8930-8937.
Kuzio, J., Pearson, M. N., Harwood, S. H., Funk, C. J., Evans, J. T., Slavicek, J. & Rohrmann, G. F. (1999). Sequence and analysis of the genome of a baculovirus pathogenic for Lymantria dispar. Virology 253, 17-34.[Medline]
Lewin, B. (1997). Genes VI. New York: Oxford University Press.
McCaughern-Carucci, J. (1997). The Neverfail Northern blot hybridization. http://www.nwfsc.noaa.gov/protocols/northernblot.html.
Pang, Y., Yu, J., Wang, L., Hu, X., Bao, W., Li, G., Chen, C., Han, H., Hu, S. & Yang, H. (2001). Sequence analysis of the Spodoptera litura multicapsid nucleopolyhedrovirus genome. Virology 287, 391-404.[Medline]
Pearson, M. N., Groten, C. & Rohrmann, G. F. (2000). Identification of the Lymantria dispar nucleopolyhedrovirus envelope fusion protein provides evidence for a phylogenetic division of the Baculoviridae. Journal of Virology 74, 6126-6131.
Pearson, M. N., Russell, R. & Rohrmann, G. F. (2001). Characterization of a baculovirus encoded protein that is associated with infected-cell membranes and budded virions. Virology 290, 22-31.
Rankin, C., Ooi, B. G. & Miller, L. K. (1988). Eight base pairs encompassing the transcriptional start point are the major determinant for baculovirus polyhedrin gene expression. Gene 70, 39-49.[Medline]
Rohrmann, G. F. (1986). Polyhedrin structure. Journal of General Virology 67, 1499-1513.
Slavicek, J. M. (1991). Temporal analysis and spatial mapping of Lymantria dispar nuclear polyhedrosis virus transcripts and in vitro translation products. Virus Research 20, 223-236.[Medline]
Summers, M. D. & Smith, G. E. (1987). A manual of methods for baculovirus vectors and insect cell culture procedures: Texas Agricultural Experiment Station Bulletin, no. 1555.
Theilmann, D. A. & Stewart, S. (1991). Identification and characterization of the IE-1 gene of Orgyia pseudotsugata multicapsid nuclear polyhedrosis virus. Virology 180, 492-508.[Medline]
Volkman, L. E. (1997). Nucleopolyhedrovirus interactions with their insect hosts. Advances in Virus Research 48, 313-348.[Medline]
Received 27 September 2001; accepted 11 December 2001.