Abstract
Increasing lines of evidence indicate that non-human primates and tupaias (tree shrews, Tupaia belangeri chinensis) are infected with TTVs (Leary et al., 1999 ; Okamoto et al., 2000a ; Verschoor et al., 1999 ). The entire nucleotide sequences of species-specific TTVs that infect non-human primates, such as the chimpanzee (Pan troglodytes), Japanese macaque (Macaca fuscata), cotton-top tamarin (Saguinus oedipus) and douroucouli (Aotes trivirgatus) as well as tupaias, have been determined (Okamoto et al., 2000b , 2001 ; Inami et al., 2000 ). Furthermore, TTV DNA has been detected in serum samples obtained from domesticated farm animals, such as chickens, pigs, cows and sheep (Leary et al., 1999 ). However, the TTVs in these farm animals have not been characterized fully as yet. Therefore, in the present study, we isolated TTVs from domestic pigs and the two most popular pets, cats and dogs, and determined their complete TTV DNA sequences to define their genomic characteristics and evolutionary relatedness by comparing them with species-specific TTVs and TLMVs from humans and non-human primates as well as tupaia TTV and animal circoviruses.
Animals.Serum samples were obtained from 11 150-day-old, domesticated farm pigs (Sus domesticus), eight dogs (Canis familiaris) and seven cats (Felis catus) during their medical checkups. Samples were kept at -20 °C until testing. These cats and dogs had been kept for up to 10 years as pets in independent houses.
Extraction of nucleic acids and amplification by PCR.
Nucleic acids were extracted from 100 µl of serum using a High Pure Viral Nucleic Acid kit (Roche) and dissolved in 50 µl of nuclease-free distilled water. An amount equivalent to 20 µl of serum was subjected to the following PCR methods. In addition to the three PCR methods described previously with primers based on the untranslated region (UTR) (NG472 and NG352 for the first round and NG473 and NG351 for the second round) (Peng et al., 2002 ), N22 primers (NG059 and NG063 for the first round and NG061 and NG063 for the second round) (Okamoto et al., 1998 ) or set B primers (forward 1 and reverse 1 for the first round and forward 2 and reverse 2 for the second round) (Leary et al., 1999 ), conventional PCR was carried out using the primer pair NG343 and NG344, which had been performed for the detection of tupaia TTV DNA (Okamoto et al., 2001 ). The amplification product was electrophoresed on a 2·5% NuSieve 3:1 agarose gel (FMC BioProducts) to detect a band of 110140 bp.
In the presence of TaKaRa LA Taq with GC buffer I (TaKaRa Shuzo), the full-length TTV genome was amplified by PCR with inverted primers NG372 (sense, 5' ACTGGGCGGGTGCCGGAGGATCCC 3') and NG373 (antisense, 5' CGCTAGACAGTTCTGTCTACCGCTG 3') or NG384 (sense, 5 TAACCGCCTGGGCGGGTGCCGGAG 3') and NG385 (antisense, 5' GACACTCAGCTCTGTTCGTGTCTACC 3') for pigs; NG309 (sense, 5' CGAGACTCCTGCGGAGCAGCGAGAG 3') and NG310 (antisense, 5' GCACCCGCCCCGGGCCTCGCACGC 3') or NG560 (sense, 5' CGAGCCTGGTGCGGAGCACGGACA 3') and NG561 (antisense, 5' GCTCCCGCCCCGGGCTTCGGCCGC 3') for dogs; and NG493 (sense, 5' GGTGAGTAGTCATGGAACTAGGAGC 3') and NG494 (antisense, 5' TCCGTTCGCACGTCCTGTCACCAG 3') or NG365 (sense, 5' CTGGGCGGGTGCCGGAGCTGAGCACG 3') and NG366 (antisense, 5' ACCGACGCAAGCGGTTTGAGACCTTG 3') for cats. DNA extracted from the sera of each animal was used as templates for inverted PCR: 35 cycles of 94 °C for 45 s, with an additional 3 min in the first cycle, 6365 °C for 45 s, and 72 °C for 3 min, with an additional 7 min in the last cycle. The amplification product was electrophoresed on a 1% (w/v) SeaKem GTG agarose gel (FMC BioProducts) to detect the band of the full-length TTV genome.
To determine if the DNA of the TTV genome was single- or double-stranded, PCR methods were used with several pairs of primer sets specific for swine, canine or feline TTVs using as templates extracted nucleic acids that had been treated with S1 nuclease or mung bean nuclease (TaKaRa Shuzo), as described previously (Okamoto et al., 1998 , 2000d ).
Determination and analysis of TTV sequences.
The products amplified by PCR were ligated into the pT7BlueT vector (Novagen) and both strands were sequenced with the BigDye Terminator Cycle Sequencing Ready Reaction kit on an ABI PRISM 3100 Genetic Analyser (Applied Biosystems). Sequence analysis was performed using GENETYX-MAC, version 10.1.6 (Software Development), and ODEN, version 1.1.1, from DDBJ (Ina, 1994 ). Sequence alignments were generated by the DDBJ version of CLUSTAL W (Thompson et al., 1994 ). Phylogenetic trees were constructed by the neighbour-joining method (Saitou & Nei, 1987 ). The reliability of the phylogenetic results was assessed using 1000 bootstrap replicates (Felsenstein, 1985 ). The final tree was obtained using the TREEVIEW program, version 1.6.6 (Page, 1996 ).
When PCR was performed using the UTR primers, N22 or set B primers, no amplification signals were observed in the serum samples from any of the 26 animals tested. However, upon performing PCR with primers NG343 and NG344, which had been derived from the well-conserved area in the UTR of a human TTV genome (TA278), nine (82%) of 11 pigs, three (38%) of eight dogs and three (43%) of seven cats were found to be positive for TTV DNA.
Full-length nucleotide sequences of swine, canine and feline TTVs
The amplified products by PCR with primers NG343 and NG344, which measured 6999 bp (primer sequences at both ends excluded), were sequenced for all 15 animals testing positive and analysed phylogenetically (accession nos AB076004AB076018). The tree revealed phylogenetic differences of TTV depending on the species. Two genetic groups of TTV with intergroup differences of 2148, 2325 and 5657% were identified among each of the pigs, dogs and cats, respectively. Based on common 6999 bp sequences, two pairs of inverse primers for amplification of TTV in each species (NG372NG373 and NG384NG385 for swine TTV; NG309NG310 and NG560NG561 for canine TTV; and NG493NG494 and NG365NG366 for feline TTV) were designed to amplify the entire TTV genomes.
Using the DNA extracted from the sera of 13 viraemic animals as template, the entire genomic sequence of TTV was amplified by PCR with the above-mentioned inverted primers. The TTV genome was found to be approximately 2·9 kb in size in all eight samples from the two groups of pigs, 2·8 kb in two samples from dogs and only 2·1 kb in the three samples from the two groups of cats. Then, the PCR-amplified product from each of the swine, canine and feline serum samples with the strongest PCR signal was molecularly cloned and the TTV clones named Sd-TTV31, Cf-TTV10 and Fc-TTV4 were sequenced over the entire genome. All three isolates had a circular genomic structure. The Sd-TTV31 and Cf-TTV10 isolates had a similar genomic length of 2878 and 2797 nt, respectively, in contrast with the Fc-TTV4 isolate which had a genomic length of only 2064 nt. The three isolates were deduced to be single-stranded from the results of the PCR upon digestion with S1 nuclease or mung bean nuclease, similar to the genomic DNAs of known TTVs and TLMVs.
The Sd-TTV31, Cf-TTV10 and Fc-TTV4 isolates differed from each other by 5456%. In addition, comparison of these three genomes against reported TTV and TLMV genomes from humans and non-human primates as well as the tupaia TTV genome, whose entire or partial nucleotide sequence is known (Biagini et al., 2000 , 2001 ; Erker et al., 1999 ; Hallett et al., 2000 ; Hijikata et al., 1999 ; Inami et al., 2000 ; Muljono et al., 2001 ; Mushahwar et al., 1999 ; Okamoto et al., 1999a , 2000b , 2001 ; Takahashi et al., 2000a , b ; Tanaka et al., 2001 ; Peng et al., 2002 ), revealed that the three genomes are less than 45% similar to the TTV and TLMV genomes reported previously.
Proposed genomic organization of the Sd-TTV31, Cf-TTV10 and Fc-TTV4 isolates
Three distinct species of TTV mRNAs (2·93·0, 1·2 and 1·0 kb) with three different splicings are observed in human TTVs of 3·8 kb (Kamahora et al., 2000 ; Okamoto et al., 2000c ). However, the consensus motifs (Breathnach et al., 1978 ; Mount, 1982 ) for the short splicing that are shared by all three mRNAs of human TTVs and located at their 5' termini were not recognized in the Sd-TTV31 sequence, although they were found in the Cf-TTV10 (nt 546632) and Fc-TTV4 (nt 168224) sequences. In addition, the consensus motifs for the third splicing, which are present in the shortest mRNA of human TTVs, were not identified in any of the Sd-TTV31, Cf-TTV10 and Fc-TTV4 sequences. Fig. 1 compares the proposed genomic organization of the Sd-TTV31, Cf-TTV10 and Fc-TTV4 isolates. They possessed in common three ORFs (ORF13) in exactly the same orientation but lacked ORF4.
|
UTR sequence of Sd-TTV31, Cf-TTV10 and Fc-TTV4 isolates
The UTR in Sd-TTV31 and Fc-TTV4 was defined as the sequence between the end of ORF3 and the beginning of ORF2 and spanned 823 and 492 nt, respectively, occupying 2429% of the entire genome (Fig. 1). The UTR in Cf-TTV10 was defined as the sequence between the end of ORF1 and the beginning of ORF2 and spanned 881 nt occupying 31% of the entire genome.
The nucleotide sequences downstream of the TATA box that is located in the middle of the UTR of Sd-TTV31, Cf-TTV10 and Fc-TTV4 were compared with those in 13 TTVs and TLMVs of humans and non-human primates and a tupaia TTV as well as CAV (accession no. M55918) (Fig. 2). This particular region is the most conserved among the entire genomes of all TTV and TLMV isolates. Remarkably, all 17 TTV and TLMV isolates, including Sd-TTV31, Cf-TTV10 and Fc-TTV4, shared two highly conserved sequences of 15 nt each (CGAATGGCTGAGTTT and AGGGGCAATTCGGGC), which were located in the 3'-terminal parts of the NG343 (sense) and NG344 (antisense) primers used in the initial PCR amplification of Sd-TTV31, Cf-TTV10 and Fc-TTV4 in the present study. In addition to these two 15 nt sequences, a 12 nt sequence of GGGCGGGTGCCG, including the Sp1 site (underlined), was well preserved. Of note, the CAV sequence differed significantly from all TTV and TLMV isolates even in this most homologous region.
|
In the middle of the UTR of the Sd-TTV31 and Cf-TTV10 genomes, there is a GC-rich stretch of 159 and 162 nt, respectively (Fig. 1), which is longer than the GC-rich stretch (35133 nt) in all known TTVs and TLMVs. The Sd-TTV31 genome contained five successive repeat sequences of 3336 nt, forming GC-rich stemloop structures starting at nt 2719, 2753, 2785, 2821 and 2856. Similarly, the Cf-TTV10 genome contained six GC-rich sequences of 2930 nt, forming hairpins starting at nt 2634, 2665, 2694, 2750, 88 and 118, respectively. In contrast, the Fc-TTV4 genome had no GC-rich stretch in the UTR, although it had two stemloop structures starting at nt 1929 and 2015, respectively.
Coding region sequence of Sd-TTV31, Cf-TTV10 and Fc-TTV4 isolates
The ORF1s of Sd-TTV31, Cf-TTV10 and Fc-TTV4 isolates encoded 436635 aa and were rich in Arg at their N-termini. Only one of the four conserved motifs (motif 3) present in putative replication-associated proteins (Rep proteins), which are involved in rolling-circle replication (Mushahwar et al., 1999 ), was discernible in these three isolates: YPVR at aa 520523 in Sd-TTV31, YLSK at aa 424427 in Cf-TTV10 and YKLK at aa 309312 in Fc-TTV4. Although significant sequence similarity was not observed in the amino acid sequence of ORF2 among Sd-TTV31, Cf-TTV10 and Fc-TTV4 isolates nor between these and TTVs or TLMVs, the conserved motif (WX7HX3CX1CX5H) in the N terminus of the ORF2 protein of reported TTVs and TLMVs (Hijikata et al., 1999 ; Takahashi et al., 2000b ) was also shared by Sd-TTV31, Cf-TTV10 and Fc-TTV4.
ORF3 of Sd-TTV31, Cf-TTV10 and Fc-TTV4 encoded a putative joint protein of 224, 243 and 231 aa, respectively, which included the same amino acid sequence of 72, 100 and 104 aa, respectively, encoded by ORF2. In Sd-TTV31, Cf-TTV10 and Fc-TTV4, the C-terminal portion of ORF3 was rich in Ser (15, 12 and 18 residues, respectively).
Phylogenetic analysis of TTVs and TLMVs
Due to difficulties in constructing a phylogenetic tree using the full-genome sequences of TTVs and TLMVs, which markedly differ in sequence and size, trees were constructed using the entire amino acid sequences of ORF1 (436770 residues) and ORF2 (59131 residues) in the TTV and TLMV isolates (Fig. 3). In both trees, Sd-TTV31, Cf-TTV10 and Fc-TTV4 were closest to each other but genetic distances between them were much greater than those among human TTVs of five genetic groups. When compared with known TTVs and TLMVs, these three animal TTVs were closer to the tupaia TTV of Tbc-TTV14 and the TTVs from primates of lower order (tamarin and douroucouli) than to the TTVs from humans and higher-order non-human primates (Japanese macaques and a chimpanzee) and the TLMVs from humans and a chimpanzee.
|
TTVs and TLMVs that infect humans and non-human primates are presumed to have a unique transcriptional profile (Okamoto et al., 2001 ) that is not observed among known members of the Circoviridae family (Niagro et al., 1998 ; Noteborn & Koch, 1995 ; Todd et al., 2000 ). However, the Sd-TTV31, Cf-TTV10 and Fc-TTV4 genomes obtained in the present study lacked either one or two of the three splicings (Kamahora et al., 2000 ; Okamoto et al., 2000c ): they possessed in common only one splicing, which is involved in the creation of ORF3. The complete preservation of coding capacity for ORF1 and ORF2 proteins as well as one joint protein (ORF3), as illustrated in Fig. 1, indicates that the proposed fundamental genomic organization and transcriptional profile are characteristic to all TTVs and TLMVs isolated from humans and non-human primates as well as TTVs from lower-order mammals, such as tupaia, swine, canines and felines. Strict conservation of the putative ORF3 in swine, canine and feline TTVs suggest that the ORF3 protein is indispensable for all TTVs and TLMVs. In fact, ORF3 has a Ser-rich tract in its C terminus and it has been demonstrated in vitro that ORF3 generates two forms of proteins with a different phosphorylation state, suggesting that ORF3 protein has function(s) similar to phosphorylated viral proteins, such as the hepatitis C virus NS5A protein (Asabe et al., 2001 ). The function and virological significance of ORF4, which has been found only in TTVs and TLMVs isolated from humans and non-human primates, remain unknown.
The Sd-TTV31, Cf-TTV10 and Fc-TTV4 isolates were clearly separate from CAV, which is most closely related to TTVs among known animal viruses. Phylogenetic analysis revealed that the Sd-TTV31, Cf-TTV10 and Fc-TTV4 isolates were closer to the TTVs from tupaias and primates of lower order (tamarin and douroucouli) than to known TTVs and TLMVs from humans and non-human primates of higher order, suggesting that the phylogenetic relatedness of TTV may reflect the evolutionary relationship of the infected hosts. The genomic length of TTV tends to be smaller the lower the order of the infected animal. However, of interest, the only exception is that humans and chimpanzees are infected with two distinct viruses with regard to the genomic size, TTVs of 3·73·9 kb and TLMVs of 2·83·0 kb. At present, there are no precise criteria that distinguish TLMVs from TTVs. To avoid confusion, taxonomic nomenclature for existing TTVs and TLMVs as well as those that will emerge in extended studies should be determined by the International Committee on Taxonomy of Viruses. Although the TTVs in pigs, dogs and cats have a genomic length that is clearly smaller than, or comparable with, that of TLMVs of 2·83·0 kb, based on the phylogenetic differences and the fact that they were identified by PCR with primers derived from the human prototype TTV (TA278), in the interim, we would like to call the viruses identified from pigs, dogs and cats in the present study as swine TTV', canine TTV' and feline TTV', respectively.
In conclusion, the data obtained in the present study indicate that, in spite of a very high degree of sequence divergence, the genomic organization and presumed transcriptional profiles are well preserved among the TTVs and TLMVs infecting humans and non-human primates, tupaia TTV, and swine, canine and feline TTVs, and suggest that hosts as divergent as humans and pet animals are naturally infected by related and species-specific viruses, although cats were unique in that they were infected with TTVs that were more simplified and had the smallest genome of only 2·1 kb, lacking ORF4 as well as the GC-rich stretch in the UTR. In addition, the primers (NG343 and NG344) used for the initial detection of swine, canine and feline TTVs in the present study would be instrumental in extended research on TTVs in unexamined animal species in an attempt to further define their virological characteristics and evolutionary relationships.
This work was supported in part by grants from the Ministry of Education, Culture, Sports, Science and Technology of Japan and the Ministry of Health, Labour and Welfare of Japan. The authors are grateful to M. Mayumi for advice and encouragement during this study.Footnotes
The nucleotide sequence data reported herein have been assigned DDBJ/EMBL/GenBank accession nos AB076001AB076003 for the entire sequences of the Sd-TTV31, Cf-TTV10 and Fc-TTV4 isolates and AB076004AB076018 for the partial sequences of 15 isolates.References
Bassami, M. R., Berryman, D., Wilcox, G. E. & Raidal, S. R. (1998). Psittacine beak and feather disease virus nucleotide sequence analysis and its relationship to porcine circoviruses, plant circovirus, and chicken anaemia virus. Virology 249, 453-459.[Medline]
Biagini, P., Attoui, H., Gallian, P., Touinssi, M., Cantaloube, J. F., de Micco, P. & de Lamballerie, X. (2000). Complete sequence of two highly divergent European isolates of TT virus. Biochemical and Biophysical Research Communications 271, 837-841.[Medline]
Biagini, P., Gallian, P., Attoui, H., Touinssi, M., Cantaloube, J. F., de Micco, P. & de Lamballerie, X. (2001). Genetic analysis of full-length genomes and subgenomic sequences of TT virus-like mini virus human isolates. Journal of General Virology 82, 379-383.
Breathnach, R., Benoist, C., OHare, K., Gannon, F. & Chambon, P. (1978). Ovalbumin gene: evidence for a leader sequence in mRNA and DNA sequences at the exon-intron boundaries. Proceedings of the National Academy of Sciences, USA 75, 4853-4857.
Erker, J. C., Leary, T. P., Desai, S. M., Chalmers, M. L. & Mushahwar, I. K. (1999). Analyses of TT virus full-length genomic sequences. Journal of General Virology 80, 1743-1750.[Abstract]
Felsenstein, J. (1985). Confidence limits on phylogenies: an approach using the bootstrap. Evolution 39, 783-791.
Hallett, R. L., Clewley, J. P., Bobet, F., McKiernan, P. J. & Teo, C. G. (2000). Characterization of a highly divergent TT virus genome. Journal of General Virology 81, 2273-2279.
Hijikata, M., Takahashi, K. & Mishiro, S. (1999). Complete circular DNA genome of a TT virus variant (isolate name SANBAN) and 44 partial ORF2 sequences implicating a great degree of diversity beyond genotypes. Virology 260, 17-22.[Medline]
Ina, Y. (1994). ODEN: a program package for molecular evolutionary analysis and database search of DNA and amino acid sequences. Computer Applications in the Biosciences 10, 11-12.
Inami, T., Obara, T., Moriyama, M., Arakawa, Y. & Abe, K. (2000). Full-length nucleotide sequence of a simian TT virus isolate obtained from a chimpanzee: evidence for a new TT virus-like species. Virology 277, 330-335.[Medline]
Itoh, Y., Takahashi, M., Fukuda, M., Shibayama, T., Ishikawa, T., Tsuda, F., Tanaka, T., Nishizawa, T. & Okamoto, H. (2000). Visualization of TT virus particles recovered from the sera and feces of infected humans. Biochemical and Biophysical Research Communications 279, 718-724.[Medline]
Kamahora, T., Hino, S. & Miyata, H. (2000). Three spliced mRNAs of TT virus transcribed from a plasmid containing the entire genome in COS1 cells. Journal of Virology 74, 9980-9986.
Khudyakov, Y. E., Cong, M. E., Nichols, B., Reed, D., Dou, X. G., Viazov, S. O., Chang, J., Fried, M. W., Williams, I., Bower, W., Lambert, S., Purdy, M., Roggendorf, M. & Fields, H. A. (2000). Sequence heterogeneity of TT virus and closely related viruses. Journal of Virology 74, 2990-3000.
Leary, T. P., Erker, J. C., Chalmers, M. L., Desai, S. M. & Mushahwar, I. K. (1999). Improved detection systems for TT virus reveal high prevalence in humans, non-human primates and farm animals. Journal of General Virology 80, 2115-2120.
Miyata, H., Tsunoda, H., Kazi, A., Yamada, A., Khan, M. A., Murakami, J., Kamahora, T., Shiraki, K. & Hino, S. (1999). Identification of a novel GC-rich 113-nucleotide region to complete the circular, single-stranded DNA genome of TT virus, the first human circovirus. Journal of Virology 73, 3582-3586.
Mount, S. M. (1982). A catalogue of splice junction sequences. Nucleic Acids Research 10, 459-472.
Muljono, D. H., Nishizawa, T., Tsuda, F., Takahashi, M. & Okamoto, H. (2001). Molecular epidemiology of TT virus (TTV) and characterization of two novel TTV genotypes in Indonesia. Archives of Virology 146, 1249-1266.[Medline]
Mushahwar, I. K. (2001). Recently discovered blood-borne viruses: are they hepatitis viruses or merely endosymbionts? Journal Medical Virology 62, 399-404.
Mushahwar, I. K., Erker, J. C., Muerhoff, A. S., Leary, T. P., Simons, J. N., Birkenmeyer, L. G., Chalmers, M. L., Pilot-Matias, T. J. & Desai, S. M. (1999). Molecular and biophysical characterization of TT virus: evidence for a new virus family infecting humans. Proceedings of the National Academy of Sciences, USA 96, 3177-3182.
Niagro, F. D., Forsthoefel, A. N., Lawther, R. P., Kamalanathan, L., Ritchie, B. W., Latimer, K. S. & Lukert, P. D. (1998). Beak and feather disease virus and porcine circovirus genomes: intermediates between the geminiviruses and plant circoviruses. Archives of Virology 143, 1723-1744.[Medline]
Nishizawa, T., Okamoto, H., Konishi, K., Yoshizawa, H., Miyakawa, Y. & Mayumi, M. (1997). A novel DNA virus (TTV) associated with elevated transaminase levels in posttransfusion hepatitis of unknown etiology. Biochemical and Biophysical Research Communications 241, 92-97.[Medline]
Noteborn, M. H. M. & Koch, G. (1995). Chicken anaemia virus infection: molecular basis of pathogenicity. Avian Pathology 24, 11-31.
Noteborn, M. H., de Boer, G. F., van Roozelaar, D. J., Karreman, C., Kranenburg, O., Vos, J. G., Jeurissen, S. H., Hoeben, R. C., Zantema, A., Koch, G., van Ormondt, H. & van der Eb, A. J. (1991). Characterization of cloned chicken anemia virus DNA that contains all elements for the infectious replication cycle. Journal of Virology 65, 3131-3139.
Okamoto, H., Nishizawa, T., Kato, N., Ukita, M., Ikeda, H., Iizuka, H., Miyakawa, Y. & Mayumi, M. (1998). Molecular cloning and characterization of a novel DNA virus (TTV) associated with posttransfusion hepatitis of unknown etiology. Hepatology Research 10, 1-16.
Okamoto, H., Nishizawa, T., Ukita, M., Takahashi, M., Fukuda, M., Iizuka, H., Miyakawa, Y. & Mayumi, M. (1999a). The entire nucleotide sequence of a TT virus isolate from the United States (TUS01): comparison with reported isolates and phylogenetic analysis. Virology 259, 437-448.[Medline]
Okamoto, H., Takahashi, M., Nishizawa, T., Ukita, M., Fukuda, M., Tsuda, F., Miyakawa, Y. & Mayumi, M. (1999b). Marked genomic heterogeneity and frequent mixed infection of TT virus demonstrated by PCR with primers from coding and noncoding regions. Virology 259, 428-436.[Medline]
Okamoto, H., Fukuda, M., Tawara, A., Nishizawa, T., Itoh, Y., Hayasaka, I., Tsuda, F., Tanaka, T., Miyakawa, Y. & Mayumi, M. (2000a). Species-specific TT viruses and cross-species infection in nonhuman primates. Journal of Virology 74, 1132-1139.
Okamoto, H., Nishizawa, T., Tawara, A., Peng, Y., Takahashi, M., Kishimoto, J., Tanaka, T., Miyakawa, Y. & Mayumi, M. (2000b). Species-specific TT viruses in humans and nonhuman primates and their phylogenetic relatedness. Virology 277, 368-378.[Medline]
Okamoto, H., Nishizawa, T., Tawara, A., Takahashi, M., Kishimoto, J., Sai, T. & Sugai, Y. (2000c). TT virus mRNAs detected in the bone marrow cells from an infected individual. Biochemical and Biophysical Research Communications 279, 700-707.[Medline]
Okamoto, H., Ukita, M., Nishizawa, T., Kishimoto, J., Hoshi, Y., Mizuo, H., Tanaka, T., Miyakawa, Y. & Mayumi, M. (2000d). Circular double-stranded forms of TT virus DNA in the liver. Journal of Virology 74, 5161-5167.
Okamoto, H., Nishizawa, T., Takahashi, M., Tawara, A., Peng, Y., Kishimoto, J. & Wang, Y. (2001). Genomic and evolutionary characterization of TT virus (TTV) in tupaias and comparison with species-specific TTVs in humans and non-human primates. Journal of General Virology 82, 2041-2050.
Page, R. D. M. (1996). TreeView: an application to display phylogenetic trees on personal computers. Computer Applications in the Biosciences 12, 357-358.
Peng, Y. H., Nishizawa, T., Takahashi, M., Ishikawa, T., Yoshikawa, A. & Okamoto, H. (2002). Analysis of the entire genomes of thirteen TT virus variants classifiable into the fourth and fifth genetic groups, isolated from viremic infants. Archives of Virology 147, 21-41.[Medline]
Saitou, N. & Nei, M. (1987). The neighbor-joining method: a new method for reconstructing phylogenetic trees. Molecular Biology and Evolution 4, 406-425.[Abstract]
Takahashi, K., Hijikata, M., Samokhvalov, E. I. & Mishiro, S. (2000a). Full or near full length nucleotide sequences of TT virus variants (types SANBAN and YONBAN) and the TT virus-like mini virus. Intervirology 43, 119-123.[Medline]
Takahashi, K., Iwasa, Y., Hijikata, M. & Mishiro, S. (2000b). Identification of a new human DNA virus (TTV-like mini virus, TLMV) intermediately related to TT virus and chicken anemia virus. Archives of Virology 145, 979-993.[Medline]
Tanaka, Y., Primi, D., Wang, R. Y. H., Umemura, T., Yeo, A. E. T., Mizokami, M., Alter, H. J. & Shih, J. W. K. (2001). Genomic and molecular evolutionary analysis of a newly identified infectious agent (SEN virus) and its relationship to the TT virus family. Journal of Infectious Diseases 183, 359-367.[Medline]
Thompson, J. D., Higgins, D. G. & Gibson, T. J. (1994). CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Research 22, 4673-4680.
Todd, D., McNulty, M. S., Mankertz, A., Lukert, P. D., Randles, J. W. & Dale, J. L. (2000). Family Circoviridae. In Virus Taxonomy. Seventh Report of the International Committee on Taxonomy of Viruses , pp. 299-303. Edited by M. H. V. van Regenmortel, C. M. Fauquet, D. H. L. Bishop, E. B. Carstens, M. K. Estes, S. M. Lemon, J. Maniloff, M. A. Mayo, D. J. McGeoch, C. R. Pringle & R. B. Wickner. San Diego:Academic Press.
Verschoor, E. J., Langenhuijzen, S. & Heeney, J. L. (1999). TT viruses (TTV) of non-human primates and their relationship to the human TTV genotypes. Journal of General Virology 80, 2491-2499.
Received 4 January 2002; accepted 6 February 2002.