Research Article

Identification of radically different variants of porcine reproductive and respiratory syndrome virus in Eastern Europe: towards a common ancestor for European and American viruses

Journal of General Virology 2002; 83(8):1861

PubMed

With thanks to our partners for supporting this archive.

Abstract

We determined 22 partial porcine reproductive and respiratory syndrome virus (PRRSV) ORF5 sequences, representing pathogenic field strains mainly from Poland and Lithuania, and two currently available European-type live PRRSV vaccines. Also, the complete ORF7 of two Lithuanian and two Polish strains was sequenced. We found that Polish, and in particular Lithuanian, PRRSV sequences were exceptionally different from the European prototype, the Lelystad virus, and in addition showed a very high national diversity. The most diverse present-day European-type PRRSV sequences were from Poland (2000) and Lithuania (2000), and exhibited only 72·2% nucleotide identity in the investigated ORF5 sequence. While all sequences determined in the present study were clearly of European type, inclusion of the new Lithuanian sequences in the genealogy resulted in a common ancestor for the European type virus significantly closer to the American-type PRRSV than previously seen. In addition, the length of the ORF7 of the Lithuanian strains was 378 nucleotides, and thus intermediate between the sizes of the prototypical EU-type (387 nucleotides) and US-type (372 nucleotides) ORF7 lengths. These findings for the Lithuanian PRRSV sequences provide support for the hypothesis that the EU and US genotypes of PRRSV evolved from a common ancestor. Also, this is the first report of ORF7 protein size polymorphism in field isolates of EU-type PRRSV.
Porcine reproductive and respiratory syndrome (PRRS) is now recognized as an important disease of swine throughout the world, and is characterized by reproductive failure in gilts and sows, and by a respiratory tract illness that can be especially severe in neonatal and nursery-age pigs. The disease was first reported in the United States and Canada in 1987 (Keffaber, 1989 ), in Japan in 1989 (Shimizu et al., 1994 ) and in Germany in 1990 (Lindhaus & Lindhaus, 1991 ).

PRRS is caused by a virus (PRRSV) that has been classified with lactate dehydrogenase elevating virus (LDV) of mice, equine arteritis virus (EAV) and simian haemorrhagic fever virus (SHFV) in the family Arteriviridae in the order Nidovirales (Cavanagh, 1997 ). PRRSV is a small enveloped virus with a positive-sense, single-stranded RNA genome of approximately 15 kb. The PRRSV genome contains nine open reading frames (ORFs) coding for the viral replicase (ORF1a and 1b), four membrane-associated glycoproteins (ORFs 2a to 5), two unglycosylated membrane proteins (ORF2b and ORF6) and the nucleocapsid protein N (ORF7) (Meulenberg et al., 1993 ; Meng et al., 1994 ; Wu et al., 2001 ).

Sequence comparison has shown that there are significant genetic differences between the prototype strains from North America (VR-2332) and Europe (Lelystad virus LV) (Meulenberg et al., 1993 ; Murtaugh et al., 1995 ; Nelsen et al., 1999 ). These prototype strains define the two genotypes of PRRSV which are currently recognized: American (US) and European (EU) types, which are clearly distinguishable antigenically as well as by sequencing (Meng, 2000 ; Dea et al., 2000 ). At the beginning of the global PRRSV epidemic, EU-types were detected only in Europe, while US-types were restricted to North and Central America (Andreyev et al., 1997 ) and Asia (Shibata et al., 1996 ). Now, EU-type PRRSV has been found in Canada (Dewey et al., 2000 ), and US-type PRRSV has been introduced to Europe through the use of a live vaccine (Bøtner et al., 1997 , 1999 ; Storgaard et al., 1999 ; Nielsen et al., 2001 , 2002 ).

Several studies have shown that a high degree of genetic variability exists within the US-type of PRRSV (Meng et al., 1995 ; Kapur et al., 1996 ; Andreyev et al., 1997 ; Pirzadeh et al., 1998 ; Morozov et al., 1995 ; Gagnon & Dea, 1998 ). While early studies suggested that a lower degree of variability might exist in EU-type PRRSV (Suarez et al., 1996 ; Drew et al., 1997 ; Le Gall et al., 1998 ), later studies in some countries, such as Denmark and Italy, have reported a high divergence of EU-type isolates (Madsen et al., 1998 ; Oleksiewicz et al., 2000 ; Nielsen et al., 2000 ; Forsberg et al., 2001 , 2002 ). A recent study demonstrated that PRRSV isolates from the Czech republic can be very dissimilar to the prototype Lelystad virus (Indik et al., 2000 ), and there are indications that PRRSV isolates from Russia may also be very different from West European PRRSV isolates (Andreyev et al., 1999 ). The increase in trade foreseen with an expansion of the European Union might therefore increase the risk of exchange of new PRRSV variants between Western and Eastern Europe.

Since protection against heterologous challenge may be limited after PRRSV infection (Meng, 2000 ), and PRRSV genetic drift can influence the reactivity of monoclonal antibodies (Rowland et al., 1999 ) or efficacy of PCR primers, ascertaining the true extent of variability in EU-type PRRSV is of major relevance for vaccine development as well as for diagnostics. To explore these issues, we determined the ORF5 and ORF7 sequences of several EU-type PRRSV strains, focusing on Poland and Lithuania, two Eastern European countries from which PRRSV sequences have not previously been reported. Also, the ORF5 sequences of two currently available live EU-type PRRSV vaccines, which are currently in use in Poland, were determined.

RTPCR.
RNA was extracted directly from clinical field samples submitted to the National Veterinary Research Institute at Puawy, Poland. The German Arnsberg strain was provided as a cell culture isolate by the National Animal Disease Center, Ames, Iowa, USA. The English H2 strain was provided as a cell culture isolate by the Veterinary Laboratories Agency (Weybridge), Addlestone, UK. RNA from 250 µl serum or 2050 mg tissue was extracted using a Total RNA Prep Plus kit, based on a modified Chomczynski method (Chomczynski & Sacchi, 1987 ), according to the manufacturer's protocol (A&A Biotechnology, Gdynia, Poland). After extraction, the RNA was eluted in 100 µl of RNase-free water.

Total RNA was used as template in a single-tube reverse transcription nested PCR specific for ORF5 of EU-type PRRSV. In the first step, 5 µl of 22% trehalose (Colaço et al., 1992 ) was used to store and maintain the following mixture in the lid of 0·2 ml Eppendorf tubes: 20 pmol of each of the inner primers ORF5F (5' ATGAGATGTTCTCACAAATTGGGGCG 3') and ORF5R (5' CTAGGCCTCCCATTGCTCAGCCGAAGT 3') (Suarez et al., 1996 ), 1 µl of dNTPs (10 mM) and 0·25 µl of Taq Polymerase (1·25 U, Fermentas, Vilnius, Lithuania). The tubes were left to dry for 2 h at room temperature prior to storage. In the next step, RTPCR was performed in the bottom of the tubes containing the dried, trehalose-treated reagents within the lid. Amplification was carried out in 50 µl volumes containing 5 µl of RNA and the following reagents: 5 µl 10x PCR buffer [100 mM TrisHCl (pH 8·8), 500 mM KCl], 0·8% Nonidet P40 (Fermentas), 5 µl MgCl2 (25 mM, Fermentas), 2 µl dNTPs (10 mM, Sigma), 5 pmol of each of outer primers EUORF5B (5' CAATGAGGTGGGCIACAACC 3') and EUORF5C (5' TATGTIATGCTAAAGGCTAGCAC 3') (Oleksiewicz et al., 1998 ), 1 µl 10% Triton X-100 (Sigma), 0·5 µl (2·5 U) Taq DNA polymerase (Fermentas), 0·25 µl (10 U) RNasin (Promega) and 0·5 µl (100 U) MMLV reverse transcriptase (Life Technologies). Mineral oil was included to act as a vapour barrier between the RTPCR reaction and the dried reagents within the lid. The tubes were then subjected to the following cycle parameters: 42 °C for 30 min, 95 °C for 5 min, and then 20 cycles at 94 °C for 1 min, 55 °C for 1 min and 72 °C for 1·5 min. The tubes were subsequently inverted several times to dissolve the dried reagents in the lid in order to initiate the nested PCR. The tubes were then centrifuged briefly before returning to the thermocycler for nested PCR, using 35 cycles of 94 °C for 1 min, 55 °C for 1 min and 72 °C for 1·5 min. A single extension step of 72 °C for 10 min completed the amplification process. The RTPCR resulted in a final amplicon of 606 bp.

From selected RNAs, ORF7 was also amplified. Five µl of RNA was mixed with 8·25 µl of water, 4 µl of 5x MMLV RT buffer (Life Technologies), 1 µl dNTPs (10 mM each), 0·5 µl MMLV (Life Technologies), 0·25 µl RNasin (Life Technologies) and 1 µl random hexanucleotides (100 ng) (Pharmacia). Mineral oil was added to act as a vapour barrier. To perform reverse transcription the mixtures were incubated at 37 °C for 90 min and at 95 °C for 10 min. Five µl amounts of cDNA were PCR amplified in a total volume of 50 µl (28·8 µl water, 10 µl 5x Taq polymerase reaction buffer, 5 µl 25 mM MgCl2, 4 µl dNTP mix, 1 U of Taq Polymerase (Fermentas) and 20 pmol of each primer: 5' GCCCCTGCCCAICACG 3' and 5' TCGCCCTAATTGAATAGGTGA 3' (Oleksiewicz et al., 1998 ). Thermal cycling was done using 35 cycles of 94 °C for 15 sec, 52 °C for 30 sec and 72 °C for 30 sec. A single extension step of 72 °C for 10 min completed the amplification process. The expected size of the ORF7 amplicon was 637 bp.

Nucleotide sequencing and analysis.
Prior to sequencing, the PCR products were electrophoresed on 1·5% agarose gels. After ethidium bromide staining and desalting in ultrafiltered water, bands of the expected size were excised from the gel, and the DNA was recovered using 0·45 µm Ultrafree-MC spin filter devices (Millipore). Gel-purified (not cloned) PCR products were cycle sequenced using the BigDye Terminator Cycle Sequencing kit (v2.0, Applied Biosystems) and an ABI310 genetic analyser (Applied Biosystems). Sequences from both strands of the ORF5 PCR products were determined with the same primers as used for the nested PCR amplification. ORF7 sequences were determined using primers R133 (5' TCGCCCTAATTGAATAGGTGACTC 3') and F132 (5' GTGCTGGGCGGCAAACGAGCTGGT 3') (Drew et al., 1997 ). The sequences were assembled using SeqMan (Lasergene program package, DNASTAR Inc.). The RTPCR and sequencing strategy described above allowed the determination of partial ORF5 sequences (432 nucleotides corresponding to positions 97528 of ORF5), and complete ORF7 sequences. All sequences reported in this study have been submitted to GenBank, as summarized in Table 1.


Table 1. Sequence summary


CLUSTAL X was used for sequence alignment (Thompson et al., 1994 ), and transition/transversion ratios were estimated with TREE-PUZZLE 5.0 (Strimmer & von Haeseler, 1996 ). These ratios were used as input for the DNADIST program of the PHYLIP package (Felsenstein, 1989 ) to establish the genetic distance, which is an estimation of the number of nucleotide substitutions per site, between pair of sequences. DNADIST calculations were based on the F84 substitution model (Thorne et al., 1992 ), which incorporates the common observation of different base frequencies and that transitions and transversions occur at different rates. Based on the distance matrix, phylogenetic trees were constructed according to the FitchMargoliash method, using the FITCH program of the PHYLIP package. Bootstrap sampling was carried out on 100 replicate datasets to assess the confidence limits of the branching pattern.

Antigenic determinants in the ORF5 protein were predicted with PROTEAN (Lasergene program package). PROTEAN uses the JamesonWolf algorithm, which takes into account hydrophilicity, surface probability, chain flexibility, hydropathy and secondary structure (Jameson & Wolf, 1988 ).

Geographical basis for PRRSV diversity in Europe
A total of 22 partial ORF5 sequences representing pathogenic field PRRSV strains were determined: 15 from Poland, 2 from Germany, 1 from Great Britain and 4 from Lithuania (Table 1). Also, two currently available EU-type live vaccines, Porcilis PRRS (Intervet, the Netherlands) (Mavromatis et al., 1999 ) and Pyrsvac-183 (SYVA, Spain) were sequenced (Table 1). Based on these 24 new ORF5 sequences, and selected EU-type ORF5 sequences available in GenBank (also summarized in Table 1), a phylogenetic tree was constructed (Fig. 1). The tree showed a tight clustering of sequences from the Netherlands, Great Britain, France and Belgium around the prototype Lelystad ORF5 sequence (NL1 in Fig. 1), which represents a Dutch field isolate from 1991 (Wensvoort et al., 1991 ). All the sequences in this tight Lelystad-like cluster were probably from 19911992 (Table 1). Some other minor clusters in the phylogeny could be explained by epidemiological links: For example, PL9 and PL11 were from farms exchanging pigs. LT2 and LT4 were from two farms that were in close geographical proximity. PL2, PL7 and PL15 were from the same farm but separated in time (Fig. 1 and Table 1). Some clusters had neither geographical nor temporal nor obvious epidemiological explanation, for example the cluster containing ES1 (Spain, 1992) and PL12 (Poland, 2000).



(15K):

Fig. 1. Phylogenetic tree of EU-type ORF5 sequences. The tree was made with the FITCH program of the PHYLIP package. The bootstrap values adjacent to the two main nodes represent the percentage of 100 trees that supported the clustering.

Sequences from Spain, but especially Denmark, the Czech Republic and Italy, were quite different from the tight Lelystad-like cluster (Fig. 1), as has been reported previously (Suarez et al., 1996 ; Indik et al., 2000 ; Oleksiewicz et al., 2000 ; Nielsen et al., 2000 ; Forsberg et al., 2001 , 2002 ). Because some of the Spanish sequences, and also the single Danish and Italian sequence, were obtained in 19911992, this indicated that different countries can harbour quite different PRRSV types at any one time (Suarez et al., 1996 ; Indik et al., 2000 ). However, examination of sequences from the start of the epidemic from more European countries appeared necessary, to establish whether this was a general feature, or unique to Denmark, Italy and Spain. In Poland, PRRSV was first detected in 1994 (Stadejek & Pejsak, 1995 ), and the sequence derived from the first Polish outbreak is called Bie94 (PL2 in Fig. 1). Bie94 did not group together with the Lelystad-like cluster, and also did not group together with Lek, another Polish isolate from 1994 (Fig. 1, compare Lek=PL1, and Bie94=PL2). Thus, based on sequences from Spain, Italy, Denmark and Poland, it appeared that it was a common rule that different European countries already harboured very different PRRSV strains at the start of the epidemic, i.e. that the genetic diversity of PRRSV has a geographical basis in Europe. Importantly, this geographical basis could not be explained by post-emergence evolution of a common European-type PRRSV ancestor. Instead, very different PRRSV isolates had apparently emerged independently but largely synchronously in different European countries (Fig. 1, compare NL1, ES1, ES2, DK1, IT1, which are all from 19911992).

Lithuanian PRRSV sequences are exceptionally diverse
While Spain, Denmark, the Czech Republic and Italy have previously been shown to hold the majority of PRRSV sequence diversity in Europe (Suarez et al., 1996 ; Indik et al., 2000 ; Forsberg et al., 2001 , 2002 ), we wished to re-examine this question in the light of the new sequences from Poland and Lithuania. Based on the simplest form of analysis, examination of percentage nucleotide identity, the two most distinct European sequences in our dataset were Nie from Poland (PL9 in Fig. 1) and Aus from Lithuania (LT1 in Fig. 1). Nie and Aus exhibited only 71·5% nucleotide identity between each other (not shown in detail, but see Fig. 1). Excluding the Polish and Lithuanian sequences from the dataset, the most distinct European sequences were 2156 (IT1) and Olot/91 (ES1), which had 82·4% nucleotide identity. Thus, the Polish and Lithuanian sequences expanded the known diversity range of European-type PRRSV. Nie (Poland, 1997) and Aus (Lithuania, 2000) were temporally as well as geographically distinct. When the analysis was restricted to sequences from the year 2000, the two most distinct sequences in our dataset were Sid from Lithuania and Krz from Poland (LT2 and PL13 in Fig. 1). Sid and Krz exhibited only 72·2% nucleic acid identity between each other (not shown in detail, but see Fig. 1). However, the Lithuanian sequences appeared to be exceptionally different from any other European-genotype sequence previously reported (Fig. 1, LT1LT4). Furthermore, the diversity between the Lithuanian sequences was as high as between any other European sequences (Fig. 1 and not shown).

Sequence analysis hints at common ancestor for EU and US genotypes
To see how the exceptionally different sequences from Lithuania (Fig. 1, LT14) were placed in the current EU-US PRRSV genealogy, a new phylogenetic tree was constructed, which also included a selection of the most diverse ORF5 sequences from North America and Asia (Table 1 and Fig. 2A). All the ORF5 sequences from European countries in the current study, including the Lithuanian ones, had consistently below 64% identity at the nucleotide level and below 70% identity at the amino acid level to US ORF5 sequences, and were therefore clearly of EU-type (not shown in detail, but see Fig. 2, large tree). However, the EUUS ORF5 tree (Fig. 2, large tree) showed that the exceptionally diverse virus populations of Lithuania connected onto the long internal EUUS branch. This branching pattern had high bootstrap support (Fig. 2, large tree). To investigate this finding further, we determined the complete ORF7 sequences for PL8, PL9, LT1 and LT2. A phylogenetic tree based on these ORF7 sequences (Fig. 2B) confirmed the branching pattern found for the ORF5 genealogy, albeit with lower bootstrap support (Fig. 2A). The same branching pattern observed for both ORF5 and ORF7 genealogies effectively excludes the possibility that the unique location of the Lithuanian samples was a result of ancestral recombination between EU and US types of PRRSV. Instead, the unique phylogenetic branching of ORF5 (Fig. 2, large tree) as well as ORF7 (Fig. 2, small tree) sequences, supported by high bootstrap values, suggested that the present-day European sequences are derived from common ancestral sequences that were more US-like than current European PRRSV.



(14K):

Fig. 2. Phylogenetic trees of EU-type and most diverse of US-type PRRSV sequences. The large tree (A) depicts the phylogenetic relationship of the ORF5 sequences. The small tree (B) was based on the ORF7 sequences.

Identification of variable and conserved parts of the ORF5 and ORF7 proteins
It was reported that the ORF5 protein of the Lelystad strain of PRRSV is N-glycosylated at two sites, corresponding to residues 46 and 53 of the protein (Meulenberg et al., 1995 ). These two glycosylation sites (defined as NXT, NXS, where X cannot be P) were conserved in all our sequences, except PL15 (Fig. 3A and not shown. Throughout this study, residue numbering in the ORF5 protein was done assigning the starting methionine number 1). Interestingly, the block of amino acids surrounding the conserved N-linked glycosylation sites was also highly conserved (Fig. 3A, residues 3855). A third N-glycosylation site at residue corresponding to amino acid 37 of Lelystad strain was previously reported in a number of American and European strains (Andreyev et al., 1997 ), and was also apparent in the majority of our sequences (Fig. 3A, and data not shown). The Spanish strain 5999 was found to have two overlapping glycosylation sites at positions 36 and 37 of the ectodomain (not shown).



(44K):

Fig. 3. Amino acid alignments of deduced ORF5 and ORF7 protein sequences. The most diverse sequences from the phylogenetic trees in Fig. 1 and Fig. 2 were selected for the amino acid alignment in this figure. All sequences are of EU-type except the US-type VR-2332 (USA1, bottom sequence), which is included for comparison. (A) Deduced ORF5 protein sequences. The EU-type ORF5 protein has in total 201 residues (including a predicted leader peptide of 32 residues), giving rise to a mature protein of 169 residues if signal peptidase cleavage occurs as predicted. The first position in the alignment shown is the first amino acid predicted by Signal IP (Nielsen et al., 1997 ) to be present in the mature ORF5 protein of Lelystad virus (NL1), after signal peptidase cleavage. Hence, the first position in the alignment shown is ORF5 amino acid number 33, counting the starting methionine as number 1. The first approximately 35 residues of the alignment are predicted to form the first ectodomain of the ORF5 protein (boxed). Positions approximately 89109 in the alignment are predicted to form the second ectodomain of the ORF5 protein (boxed). The C-terminal endodomain is predicted to start approximately at position 130 in the alignment. The assignment of endo- and ectodomain protein segments was based on available literature (Meulenberg et al., 1995 ; Mardassi et al., 1996 ; Snijder & Meulenberg, 1998 ; Dea et al., 2000 ), and confirmed by our own modelling of transmembrane regions using the software tools available at www.expasy.ch. However, it should be noted that the topology of the PRRSV ORF5 protein has not been examined experimentally, and the assignation of ectodomain residues (boxed) is speculative. ORF5 sequence beyond position 176 was not determined in this study. Horizontal, bold bars indicate predicted N-linked glycosylation sites. (B) Deduced ORF7 protein sequences. The EU-type ORF7 protein (exemplified by the prototypical Lelystad virus sequence, NL1 in the alignment) has 128 residues. The US-type ORF7 protein (exemplified by the prototypical VR2332 virus sequence, USA1 in the alignment) is slightly shorter, and has 123 residues. The Polish ORF7 protein sequences (PL8 and PL9) had 128 residues, as expected for EU-type viruses. Surprisingly, the Lithuanian ORF7 protein sequences had only 124 residues. Shaded boxes marked as A, B, C, D correspond to antigenic binding sites defined by Meulenberg et al. (1998) . The authors described the sites as containing epitopes that are conserved in European but not American PRRSV (sites A and C), containing epitopes that are conserved in European and American PRRSV (site B), and containing epitopes that are either conserved or not conserved in European and American PRRSV (site D).

The ORF5 protein is thought to exist in the virion envelope as a disulfide-linked heterodimer with the ORF6 protein (Mardassi et al., 1996 ), and the single ectodomain cysteine probably involved in the heterodimerization was completely conserved in all our sequences (Fig. 3A, cysteine-50). The most variable segments of the ORF5 protein appeared to be residues 3367 and 89109 of the protein (Fig. 3A). Interestingly, these segments were predicted to fall in the two ectodomains of the ORF5 protein (Fig. 3A). Because ectodomain residues would be expected to be more sensitive to selective pressure from the porcine antibody response, the variability profile of the ORF5 protein provides indirect support for the location of the second ectodomain in the residue 89109 segment, which is in agreement with transmembrane segment predictions (Fig. 3A and not shown). Intriguingly, three sequences from the same farm from 1994, 1997 and 2001 exhibited gradual changes in this region (Fig. 4, PL2, 7 and 15).


Table 1.


The ORF7 protein of EU-type PRRSV has been reported to be 128 residues while the ORF7 protein of US-type PRRSV is 123 residues (Dea et al., 2000 ). The diverse Polish EU-type strains had ORF7 proteins of 128 residues, as expected. Intriguingly, the exceptionally diverse EU-type Lithuanian strains had ORF7 proteins of only 124 residues (Fig. 3B). Also, the Lithuanian ORF7 sequences had an asparagine at position 50, which is typical of US but not EU ORF7 proteins (Fig. 3B).

Predicted antigenic differences between vaccine and field viruses
The finding of an exceptional diversity in ORF5 sequences in Poland and Lithuania, together with the suspected role of the ORF5 protein in virus neutralization (Dea et al., 2000 ), made it interesting to compare the antigenicity profiles of selected present-day very diverse field sequences to the currently available EU-type live PRRSV vaccines (Fig. 4). The residue 89109 region appeared to harbour the most pronounced changes in predicted antigenicity of the very diverse field sequences. Without exception, the residue 89109 region of the diverse field sequences had higher predicted antigenicity than VAC3 and VAC4 (Fig. 4). The residue 89109 region corresponds approximately to the predicted location of the second ectodomain of the ORF5 protein (Fig. 3A, boxed residues), and also constituted a variable segment of the ORF5 protein (Fig. 3A, boxed residues, and Fig. 4).

Since its emergence in the late 1980s, PRRSV has continued to cause major economical losses for swine farming. In North America, recent outbreaks of atypical/acute PRRSV were suggested to be due to the emergence of new PRRSV strains, against which current vaccines apparently did not provide protection (Meng, 2000 ). Theoretically, this scenario may not be limited to North America, and knowledge of the genetic diversity of EU-type PRRSV might improve our means of assessing the likelihood of similar events in Europe. The anticipated inclusion of Eastern European countries in the European Community is particularly relevant in this respect, because available data suggest that Russia and the Czech Republic may harbour PRRSV types that are different from those found in other European countries (Andreyev et al., 1999 ; Indik et al., 2000 ). Yet, the number of sequences reported from the Czech Republic was relatively low (Indik et al., 2000 ), and the Russian sequences have to our knowledge not been submitted to public databases (Andreyev et al., 1999 ). Hence, the present study was undertaken to further explore PRRSV sequence diversity in East Europe, by analysis of the first PRRSV sequences from Poland and Lithuania.

The main finding of the present study was that Lithuania harbours exceptionally diverse PRRSV strains. All four Lithuanian sequences were derived from RTPCR on porcine serum. In our opinion, this makes it likely that the Lithuanian sequences were derived from circulating, complete PRRSV virions, as opposed to being derived from, for example, intracellular defective RNA. We derived the viral sequences by direct sequencing of both strands of non-cloned PCR products to minimize Taq-induced artefacts. However, due to the highly surprising nature of the Lithuanian sequences, we performed additional controls to verify the RTPCR and sequencing strategy: First, we did repeated RTPCR and sequencing on selected serum samples and received identical DNA sequence. Second, we sequenced ORF5 as well as ORF7 for the Lithuanian viruses, and obtained identical phylogenetic clustering (Fig. 4). Furthermore, we estimate the diversity of Lithuanian PRRSV to resemble the diversity of Russian PRRSV strains, the nucleotide sequences of which were reported to differ up to 16% with Lelystad virus in ORF7 (Andreyev et al., 1999 ). Thus, we consider it highly unlikely that the unique nature of the Lithuanian sequences is an artefact of the methods used. The Lithuanian sequences exhibited a highly surprising and unusual branching pattern in EUUS phylogenies, in that they appeared to be derived from ancestral sequences more US-like than previously seen in Europe (Fig. 2). This interpretation is supported by the observation that the size of the ORF7 protein of Lithuanian PRRSV (124 residues) was intermediate between the sizes for prototypical EU-type (128 residues) and US-type (123 residues) ORF7 proteins (Fig. 3B). Recently, Verheije et al. (2001) found, using an infectious clone of EU-type PRRSV, that C-terminal truncation of the N protein was tolerated for up to six amino acids. However, the Lithuanian ORF7 sequences provide the first example that size polymorphism may occur in the ORF7 protein of field PRRSV isolates of EU type (Fig. 3B). This finding has obvious implication for, for example, the use of the size of ORF7 RTPCR amplicons for typing viruses (Oleksiewicz et al., 1998 ).

In the ORF5 segment sequenced by us, we found that some European PRRSV strains have as little as 71·5% nucleotide identity (Fig. 1, PL9 and LT1). For other plus-sense RNA viruses such as pestiviruses, a classification scheme based on pairwise sequence divergence of, for example, the E2 envelope glycoprotein gene has been suggested, using the categories isolate (up to 18·8% divergence), subgroups (17·433·8% divergence) and species (34·366·1% divergence) (Becher et al., 1999 ). For comparison, the 71·5% nucleotide identity observed in the ORF5 envelope glycoprotein gene of PL1 and Sid (Fig. 1) thus certainly seems to justify using the term subgroup for the Lithuanian PRRSVs, and may even place them in the subgroup/species grey zone.

Ideally, studies on the genetic diversity of European-type PRRSV should include a large number of isolates from all European countries, and preferably cover the time period from 1991 (the isolation of Lelystad virus, the first PRRSV isolate) until now. Clearly, this is not feasible. Thus, the true picture of European-type PRRSV sequence diversity will probably develop piecemeal, through successive complementary studies. The present study concerning the diversity of primarily Eastern European, EU-type PRRSV strains complemented previous studies on the diversity of EU type PRRSV (Suarez et al., 1996 ; Oleksiewicz et al., 2000 ; Indik et al., 2000 ; Forsberg et al., 2001 , 2002 ). The current picture appears to be that the presence of very diverse PRRSV strains may not be a special attribute of any one country, but a general rule in Europe, except for countries such as Holland, Belgium, France and England where the presence of very closely related (Lelystad-like) PRRSV strains can perhaps be explained by trading links. It remains to be determined whether this hypothesis is correct, i.e. whether, for example, PRRSV strains from the remaining European states will also prove very diverse.

Isolation of European-type PRRSV requires facilities to establish primary cultures of porcine pulmonary alveolar macrophages (PPAM). Such facilities are not routinely available in many East European countries. Hence, we have not yet been able to obtain Polish and Lithuanian PRRSV isolates for functional studies. For example, it would be interesting to perform cross-neutralization studies between Lithuanian and other EU-type PRRSV strains. Also, it would be very interesting to determine whether the ORF7 protein of Lithuanian PRRSV would react as EU- or US-type with the monoclonal antibodies currently used for PRRSV detection and typing. Based on theoretical antigenicity prediction, at least some present-day Lithuanian and Polish ORF5 protein sequences are different from the ORF5 protein of the currently used live EU-type PRRSV vaccine strains (Fig. 4). The N-terminal part of the ORF5 protein, for which sequence was obtained in the present study, was originally thought to be involved in virus receptor binding and neutralization (Dea et al., 2000 ; Snijder & Meulenberg, 1998 ). However, recent studies have questioned the involvement of the N terminus of the ORF5 protein in receptor binding (Dobbe et al., 2001 ), and in any case it is not known how the predicted antigenic differences between the ORF5 proteins of field and vaccine PRRSV isolates (Fig. 4) relate to cross-neutralization properties. While the first ectodomain of the ORF5 protein is known to be a target for the antibody response in the related EAV and LDV (Balasuriya et al., 1997 ), less is known about the antibody response to the PRRSV ORF5 protein. It was recently described that the C-terminal endodomain of the ORF5 protein is a target for the porcine antibody response (Dea et al., 2000 ; Rodriguez et al., 2001 ; Oleksiewicz et al., 2002 ). While the complete C-terminal ORF5 sequence was not determined in our study, we observed that amino acid changes appeared to cluster in the predicted two ectodomains at the N terminus of the ORF5 protein (Fig. 3A, boxed residues). It has previously been described that for PRRSV proteins, sequence diversity correlates with the extent of the porcine humoral antibody response (Oleksiewicz et al., 2000 , 2001 ). Therefore, the clustering of amino acid changes in the putative ORF5 protein ectodomains (Fig. 3A) suggests the presence of B-cell epitopes, which may have gone unnoticed due to, for example, a requirement for a particular ORF5 protein folding or glycosylation, as the studies by for example Rodriguez et al. (2001) and Oleksiewicz et al. (2002) mentioned above utilized assays that would predominantly identify linear epitopes.

In a similar vein, it has been suggested that the last 20 carboxy-terminal residues of the ORF7 protein are important for the overall conformation of the ORF7 protein of US-type PRRSV, and hence its reactivity with various monoclonal antibodies (Wootton et al., 1998 ). In contrast, Verheije et al. (2001) found that deletion of up to six amino acids from the C terminus of the ORF7 protein of EU-type PRRSV did not affect the reactivity of the protein with various monoclonal antibodies. Also, the first 12 residues of the ORF7 protein have been shown to form a linear epitope that is conserved in European but not American PRRSVs (Fig. 3BB, site A) (Meulenberg et al., 1998 ). The Lithuanian ORF7 protein sequences exhibited radical changes in N-terminal as well as C-terminal regions (Fig. 3B). However, the reactivity of monoclonal antibodies cannot be inferred from the linear sequence, and the antigenicity of the Lithuanian ORF7 protein remains to be investigated. It should be mentioned that sera from pigs on the four Lithuanian farms from which the LT14 sequences were obtained were positive for anti-PRRSV antibodies by ELISA (HerdChek PRRS ELISA, IDEXX Laboratories Inc., USA). Finally, it should be mentioned that the clinical signs reported on the Lithuanian farms were not different from those usually ascribed to PRRSV infection.

Nelsen et al. (1999) suggested that the EU- and US-types of PRRSV arose by the divergent evolution of related viruses on separate continents from a distant common ancestor. While the almost synchronous emergence of EU and US PRRSV in the late 1980s seems puzzling enough, our and previous results outline an even more surprising scenario, where genetically quite different EU-type PRRSV strains seem to have emerged independently in different European countries (Fig. 1, NL1, ES1, ES2, DK1, IT1 from 19911992, and PL1 and PL2 from 1994). The reasons for the near-simultaneous emergence of genetically very different PRRSV types and strains at different geographical locations are currently unknown, but have been speculated to be due to, for example, changes in farming management factors, although no candidate factors were suggested (Nelsen et al., 1999 ). A precise time estimate of the common ancestor of EU and US PRRSV might be helpful towards elucidating the reason for the split of the EU and US lineages, and the circumstances of PRRSV emergence in the late 1980s. We hope that the Lithuanian sequences, by virtue of their unique position in phylogenetic trees of EUUS sequences, may improve the precision of phylogenetic modelling of the very long branch connecting EU and US viruses (Fig. 2), and allow precise temporal information to be extracted from PRRSV phylogenetic trees.

P. Normann and B. Frcek are thanked for technical assistance. The work was in part supported by grants from the British Council (WAR/992/138) and the Polish Committee for Scientific Research (5P06K03314, 6PO6K02921). Dr A. Stankevicius stay in the National Veterinary Research Institute in Puawy, Poland, was funded by a grant from the Lithuanian Ministry of Education and Science. Dr David Paton is thanked for fruitful discussions. We are grateful to the farmers and practice veterinarians who performed the collection of clinical samples.

Footnotes

b Present address: Lithuanian Veterinary Institute, 4230 Kaisiadorys, Institutio 2, Lithuania.

c Present address: Novo Nordisk A/S, Novo Nordisk Park, 2760 Mløv, Denmark.

d Present address: Symphogen A/S, Elektrovej, Building 375, 2800 Lyngby, Denmark.

References

Andreyev, V. G., Wesley, R. D., Mengeling, W. L., Vorwald, A. C. & Lager, K. M. (1997). Genetic variation and phylogenetic relationships of 22 porcine reproductive and respiratory syndrome virus (PRRSV) field strains based on sequence analysis of open reading frame 5. Archives of Virology 142, 993-1001.[Medline]

Andreyev, V. G., Scherbakov, A. G., Pylnov, V. A. & Gusev, A. A. (1999). Genetic heterogeneity of PRRSV in Russia. In Proceedings of the Third International Symposium on Porcine Reproductive and Respiratory Syndrome (PRRS), pp. 211212.

Balasuriya, U. B. R., Patton, J. F., Rossitto, P. V., Timoney, P. J., McCollum, W. H. & MacLachlan, N. J. (1997). Neutralization determinants of laboratory strains and field isolates of equine arteritis virus: identification of four neutralization sites in the amino-terminal ectodomain of the GL envelope glycoprotein. Virology 232, 114-128.[Medline]

Becher, P., Orlich, M., Kosmidou, A., Konig, M., Baroth, M. & Thiel, H.-J. (1999). Genetic diversity of pestiviruses: identification of novel groups and implications for classification. Virology 262, 64-71.[Medline]

Bøtner, A., Strandbygaard, B., Sørensen, K. J., Have, P., Madsen, K. G., Madsen, E. S. & Alexandersen, S. (1997). Appearance of acute PRRS-like symptoms in sow herds after vaccination with a modified live PRRS vaccine. Veterinary Record 141, 497-499.[Free Full Text]

Bøtner, A., Nielsen, J., Oleksiewicz, M. B. & Storgaard, T. (1999). Heterologous challenge with porcine reproductive and respiratory syndrome (PRRS) vaccine virus: no evidence of reactivation of previous European-type PRRS virus infection. Veterinary Microbiology 68, 187-195.[Medline]

Cavanagh, D. (1997). Nidovirales: a new order comprising Coronaviridae and Arteriviridae. Archives of Virology 142, 629-633.[Medline]

Chomczynski, P. & Sacchi, N. (1987). Single-step method of RNA isolation by acid guanidinium thiocyanate- phenol-chloroform extraction. Analytical Biochemistry 162, 156-159.[Medline]

Colaço, C., Sen, S., Thangavelu, M., Pinder, S. & Roser, B. (1992). Extraordinary stability of enzymes dried in trehalose: simplified molecular biology. Biotechnology 10, 1007-1011.[Medline]

Dea, S., Gagnon, C. A., Mardassi, H., Pirzadeh, B. & Rogan, D. (2000). Current knowledge on the structural proteins of porcine reproductive and respiratory syndrome (PRRS) virus: comparison of the North American and European isolates. Archives of Virology 145, 659-688.[Medline]

Dewey, C., Charbonneau, G., Carman, S., Hamel, A., Nayar, G., Friendship, R., Eernisse, K. & Swenson, S. (2000). Lelystad-like strain of porcine reproductive and respiratory syndrome virus (PRRSV) identified in Canadian swine. Canadian Veterinary Journal 41, 493-494.

Dobbe, J. C., van der Meer, Y., Spaan, W. J. & Snijder, E. J. (2001). Construction of chimeric arteriviruses reveals that the ectodomain of the major glycoprotein is not the main determinant of equine arteritis virus tropism in cell culture. Virology 288, 283-294.[Medline]

Drew, T. W., Lowings, J. P. & Yapp, F. (1997). Variation in open reading frames 3, 4 and 7 among porcine reproductive and respiratory syndrome virus isolates in the UK. Veterinary Microbiology 55, 209-221.[Medline]

Felsenstein, J. (1989). PHYLIP Phylogeny Interference Package (Version 3.2). Cladistics 5, 164-166.

Forsberg, R., Oleksiewicz, M. B., Krabbe Petersen, A.-M., Hein, J., Bøtner, A. & Storgaard, T. (2001). A molecular clock dates the common ancestor of European-type porcine reproductive and respiratory syndrome virus at more than 10 years before onset of the current epidemic. Virology 289, 174-179.[Medline]

Forsberg, R., Storgaard, T., Nielsen, H. S., Oleksiewicz, M. B., Cordioli, P., Sala, G., Hein, J. & Bøtner, A. (2002). The genetic diversity of European type PRRSV is similar to that of North American type but is geographically skewed within Europe. Virology (in press).

Gagnon, C. A. & Dea, S. (1998). Differentiation between porcine reproductive and respiratory syndrome virus isolates by restriction fragment length polymorphism of their ORF's 6 and 7 genes. Canadian Journal of Veterinary Research 62, 110-116.

Indik, S., Valicek, L., Klein, D. & Klanova, J. (2000). Variations in the major envelope glycoprotein GP5 of Czech strains of porcine reproductive and respiratory syndrome virus. Journal of General Virology 81, 2497-2502.[Abstract/Free Full Text]

Jameson, B. A. & Wolf, H. (1988). The antigenic index: a novel algorithm for predicting antigenic determinants. Computer Applications in the Biosciences 4, 181-186.[Abstract/Free Full Text]

Kapur, V., Elam, M. R., Pawlovich, T. M. & Murtaugh, M. P. (1996). Genetic variation in porcine reproductive and respiratory syndrome virus isolates in the Midwestern United States. Journal of General Virology 77, 1271-1276.[Abstract/Free Full Text]

Keffaber, K. K. (1989). Reproductive failure of unknown etiology. American Association of Swine Practitioners Newsletter 1, 1-10.

Le Gall, A., Legeay, O., Bourhy, H., Arnauld, C., Albina, E. & Jestin, A. (1998). Molecular variation in the nucleoprotein gene (ORF7) of the porcine reproductive and respiratory syndrome virus (PRRSV). Virus Research 54, 9-21.[Medline]

Lindhaus, W. & Lindhaus, B. (1991). Rätselhafte Schweinekrankheit. Praktische Tierarztliche 5, 423-425.

Madsen, K. G., Hansen, C. M., Madsen, E. S., Strandbygaard, B., Bøtner, A. & Sørensen, K. J. (1998). Sequence analysis of porcine reproductive and respiratory syndrome virus of the American type collected from Danish swine herds. Archives of Virology 143, 1683-1700.[Medline]

Mardassi, H., Massie, B. & Dea, S. (1996). Intracellular synthesis, processing, and transport of proteins encoded by ORFs 5 to 7 of porcine reproductive and respiratory syndrome virus. Virology 221, 98-112.[Medline]

Mavromatis, I., Kritas, S. K., Alexopoulos, C., Tsinas, A. & Kyriakis, S. C. (1999). Field evaluation of a live vaccine against porcine reproductive and respiratory syndrome in fattening pigs. Zentralblatt für Veterinaermedizin Reihe B 46, 603-612.

Meng, X. J. (2000). Heterogeneity of porcine reproductive and respiratory syndrome virus: implications for current vaccine efficacy and future vaccine development. Veterinary Microbiology 74, 309-329.[Medline]

Meng, X. J., Paul, P. S. & Halbur, P. G. (1994). Molecular cloning and nucleotide sequencing of the 3'-terminal genomic RNA of the porcine reproductive and respiratory syndrome virus. Journal of General Virology 75, 1795-1801.[Abstract/Free Full Text]

Meng, X. J., Paul, P. S., Halbur, P. G. & Lum, M. A. (1995). Phylogenetic analyses of the putative M (ORF 6) and N (ORF 7) genes of porcine reproductive and respiratory syndrome virus (PRRSV): implication for the existence of two genotypes of PRRSV in the U. S. A. and Europe. Archives of Virology 140, 745-755.[Medline]

Meulenberg, J. M., Hulst, M. M., de Meijer, P., Moonen, J. M., den Besten, A., de Kluyver, E. P., Wensvoort, G. & Moorman, R. J. M. (1993). Lelystad virus, the causative agent of porcine epidemic abortion and respiratory syndrome (PEARS), is related to LDV and EAV. Virology 192, 62-74.[Medline]

Meulenberg, J. J. M., Petersen-den Besten, A., De Kluyver, E. P., Moormann, R. J. M., Schaaper, W. M. M. & Wensvoort, G. (1995). Characterization of proteins encoded by ORFs 2 to 7 of Lelystad virus. Virology 206, 155-163.[Medline]

Meulenberg, J. J. M., van Nieuwstadt, A. P., van EssenZandbergen, A., Bosde Ruijter, J. N. A., Langeveld, J. P. M. & Meloen, R. H. (1998). Localization and fine mapping of antigenic sites on the nucleocapsid protein N of porcine reproductive and respiratory syndrome virus with monoclonal antibodies. Virology 252, 106-114.[Medline]

Morozov, I., Meng, X. J. & Paul, P. S. (1995). Sequence analysis of open reading frames (ORFs) 2 to 4 of a U. S. isolate of porcine reproductive and respiratory syndrome virus. Archives of Virology 140, 1313-1319.[Medline]

Murtaugh, M. P., Elam, M. R. & Kakach, L. T. (1995). Comparison of the structural protein coding sequences of the VR-2332 and Lelystad virus strains of the PRRS virus. Archives of Virology 140, 1451-1460.[Medline]

Nelsen, C. J., Murtaugh, M. P. & Faaberg, K. S. (1999). Porcine reproductive and respiratory syndrome virus comparison: divergent evolution on two continents. Journal of Virology 73, 270-280.[Abstract/Free Full Text]

Nielsen, H., Engelbrecht, J., Brunak, S. & von Heijne, G. (1997). Identification of prokaryotic and eukaryotic signal peptides and prediction of their cleavage sites. Protein Engineering 10, 1-6.[Abstract/Free Full Text]

Nielsen, H. S., Storgaard, T. & Oleksiewicz, M. B. (2000). Analysis of ORF 1 in European porcine reproductive and respiratory syndrome virus by long RTPCR and restriction fragment length polymorphism (RFLP) analysis. Veterinary Microbiology 76, 221-228.[Medline]

Nielsen, H. S., Oleksiewicz, M. B., Forsberg, R., Stadejek, T., Bøtner, A. & Storgaard, T. (2001). Reversion of a live porcine reproductive and respiratory syndrome virus vaccine investigated by parallel mutations. Journal of General Virology 82, 1263-1272.[Abstract/Free Full Text]

Nielsen, J., Bøtner, A., Bille-Hansen, V., Oleksiewicz, M. B. & Storgaard, T. (2002). Experimental infection of late-term pregnant sows with a field isolate of porcine reproductive and respiratory syndrome vaccine-derived virus. Veterinary Microbiology 84, 1-13.[Medline]

Oleksiewicz, M. B., Bøtner, A., Madsen, K. G. & Storgaard, T. (1998). Sensitive detection and typing of porcine reproductive and respiratory syndrome virus by RTPCR amplification of whole viral genes. Veterinary Microbiology 64, 7-22.[Medline]

Oleksiewicz, M. B., Bøtner, A., Toft, P., Grubbe, T., Nielsen, J., Kamstrup, S. & Storgaard, T. (2000). Emergence of porcine reproductive and respiratory syndrome virus deletion mutants: correlation with the porcine antibody response to a hypervariable site in the ORF3 structural glycoprotein. Virology 267, 135-140.[Medline]

Oleksiewicz, M. B., Bøtner, A., Toft, P., Normann, P. & Storgaard, T. (2001). Epitope mapping porcine reproductive and respiratory syndrome virus by phage display: the nsp2 fragment of the replicase polyprotein contains a cluster of B-cell epitopes. Journal of Virology 75, 3277-3290.[Abstract/Free Full Text]

Oleksiewicz, M. B., Normann, P. & Bøtner, A. (2002). Porcine B-cells recognize epitopes which are conserved between the structural proteins of American- and European-type porcine reproductive and respiratory syndrome virus. Journal of General Virology 83, 1407-1418.[Abstract/Free Full Text]

Pirzadeh, B., Gagnon, C. A. & Dea, S. (1998). Genomic and antigenic variations of porcine reproductive and respiratory syndrome virus major envelope GP5 glycoprotein. Canadian Journal of Veterinary Research 62, 170-177.

Rodriguez, M. J., Sarraseca, J., Fominaya, J., Cortes, E., Sanz, A. & Casal, J. I. (2001). Identification of an immunodominant epitope in the C terminus of glycoprotein 5 of porcine reproductive and respiratory syndrome virus. Journal of General Virology 82, 995-999.[Abstract/Free Full Text]

Rowland, R. R., Steffen, M., Ackerman, T. & Benfield, D. A. (1999). The evolution of porcine reproductive and respiratory syndrome virus: quasispecies and emergence of a virus subpopulation during infection of pigs with VR-2332. Virology 259, 262-266.[Medline]

Shibata, I., Uruno, K. & Mori, M. (1996). Serological property and replication in cell cultures of porcine reproductive and respiratory syndrome viruses isolated in Japan. Journal of Veterinary Medical Science 58, 805-807.[Medline]

Shimizu, M., Yamada, S., Murakami, Y., Morozumi, T., Kobayashi, H., Mitani, K., Ito, N., Kubo, M., Kimura, K., Kobayashi, M. & others (1994). Isolation of porcine reproductive and respiratory syndrome (PRRS) virus from Heko-Heko disease of pigs. Journal of Veterinary Medical Science 56, 389391.[Medline]

Snijder, E. J. & Meulenberg, J. J. M. (1998). The molecular biology of arteriviruses. Journal of General Virology 79, 961-979.[Medline]

Stadejek, T. & Pejsak, Z. (1995). Application of IPMA for serological diagnosis of porcine reproductive and respiratory syndrome (PRRS). Medycyna Weterynaryjna 51, 340-342.

Storgaard, T., Oleksiewicz, M. B. & Bøtner, A. (1999). Examination of the selective pressures on a live PRRS vaccine virus. Archives of Virology 144, 2389-2401.[Medline]

Strimmer, K. & von Haeseler, A. (1996). Quartet puzzling: a quartet maximum likelihood method for reconstruction tree topologies. Molecular Biology and Evolution 13, 964-969.

Suarez, P., Zardoya, R., Martin, M. J., Prieto, C., Dopazo, J., Solana, A. & Castro, J. M. (1996). Phylogenetic relationships of European strains of porcine reproductive and respiratory syndrome virus (PRRSV) inferred from DNA sequences of putative ORF-5 and ORF-7 genes. Virus Research 42, 159-165.[Medline]

Thompson, J. D., Higgins, D. G. & Gibson, T. J. (1994). CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Research 22, 4673-4680.[Abstract/Free Full Text]

Thorne, J. L., Kishino, H. & Felsenstein, J. (1992). Inching toward reality: an improved likelihood model of sequence evolution. Journal of Molecular Evolution 34, 3-16.[Medline]

Verheije, M., Kroese, M., Rottier, P. & Meulenberg, J. (2001). Viable porcine arteriviruses with deletions proximal to the 3' end of the genome. Journal of General Virology 82, 2607-2614.[Abstract/Free Full Text]

Wensvoort, G., Terpstra, C., Pol, J. M. A., ter Laak, E. A., Bloemraad, M., de Kluyver, E. P., Kragten, C., van Buiten, L., den Besten, A., Wagenaar, F. & others (1991). Mystery swine disease in the Netherlands: the isolation of Lelystad virus. Veterinary Quarterly 13, 121130.[Medline]

Wootton, S. K., Nelson, E. A. & Yoo, D. (1998). Antigenic structure of the nucleocapsid protein of porcine reproductive and respiratory syndrome virus. Clinical and Diagnostic Laboratory Immunology 5, 773-779.[Abstract/Free Full Text]

Wu, W.-H., Fang, Y., Farwell, R., Steffen-Bien, M., Rowland, R. R. R., Christopher-Hennings, J. & Nelson, E. (2001). A 10-kDa structural protein of porcine reproductive and respiratory syndrome virus encoded by ORF2b. Virology 287, 183-191.[Medline]

Received 12 November 2001; accepted 26 March 2002.