Research Article

PCR-based cloning and immunocytological titration of infectious porcine endogenous retrovirus subgroup A and B

Journal of General Virology 2002; 83(9):2231

PubMed

Abstract

Two pig endogenous retroviruses (PERV), PERV-A and -B, productively infect human cells and are therefore considered to constitute a potential risk in pig-to-human xenotransplantation. A PCR-based cloning technique to isolate infectious PERV proviruses was established. Overlapping 3' half and 5' halves of PERV proviral genomes were amplified using DNA extracted from human 293 cells infected with PERV-A or -B. These clones were fused at a unique restriction site in the overlapping region and tested for their infectivity. Representative constructs possessed the same infectious properties as their parent isolates. We also developed a polyclonal anti-PERV serum by using recombinant PERV capsid protein derived from one of the infectious constructs as immunogen and established an immunocytological method for detection and titration of PERV infection. This detection method proved to be more sensitive than the current method of choice (transfer of MLV-lacZ vectors) for infectivity assessment of PERV. These findings should be considered for future characterization of PERV isolates.
Xenotransplantation is considered a potential solution to overcome the increasing shortage of organs and tissues available for transplantation into humans and overall pigs are the most suitable source species (Cozzi et al., 2000 ; Takeuchi & Weiss, 2000 ). Clinical trials using porcine tissues are currently ongoing for a number of different therapeutic indications. These procedures, however, bring with them the possibility of introducing infectious agents from the pig into the xenograft recipient and ultimately the community at large (Birmingham, 1999 ; Platt, 2000 ; Takeuchi & Weiss, 2000 ). The risk of zoonosis may be reduced by extensive screening to provide source animals free of exogenous pathogens. However, endogenous agents and agents that current detection strategies do not identify are difficult or impossible to eliminate by current barrier derivation technologies. For this reason there has been extensive interest in studying the biology of pig endogenous retroviruses (PERVs) carried in the chromosomes of every pig (Patience et al., 1997 ; Le Tissier et al., 1997 ).

Among several PERV families within the pig genome (Ericsson et al., 2001 ; Patience et al., 2001 ), one family produces infectious viruses whose closest relatives are the gammaretroviruses gibbon ape leukaemia virus (GALV) and mouse leukaemia virus (MLV) (Le Tissier et al., 1997 ; Patience et al., 1997 ; Akiyoshi et al., 1998 ). Since the discovery of PERVs in the 1970s (Breese, 1970 ; Armstrong et al., 1971 ; Todaro et al., 1974 ), it has been shown that several pig cell lines, including the pig kidney cell line PK-15, as well as primary pig cells such as endothelial and mitogenically activated peripheral blood mononuclear cells release PERV particles which are infectious for human cells (Patience et al., 1997 ; Martin et al., 1998a , 2000a , b ; Wilson et al., 1998 , 2000 ). Molecular isolation and analysis of partial and full-length proviruses confirmed the presence of at least three different classes of PERV genomes, termed PERV-A, -B and -C, with high homology in the gag and pol genes but a significant divergence within sequences encoding the outer envelope glycoprotein (Le Tissier et al., 1997 ; Patience et al., 1997 ; Akiyoshi et al., 1998 ; Czauderna et al., 2000 ; Wilson et al., 2000 ; Krach et al., 2001 ). Pseudotyping experiments with the PERV envelope glycoproteins indicated that PERV-A, -B and -C use different receptors from each other for cell entry (Takeuchi et al., 1998 ) and that a significant number of cell lines of human and animal origin are permissive to entry of PERV-A and -B. While it was shown that the host range of PERV-C is mostly restricted to porcine cells (Takeuchi et al., 1998 ), a range of different cell lines derived from human, primates, mink, mouse, rat, rabbit, bat, hamster and dog is permissive to entry of PERV-A and/or -B (Takeuchi et al., 1998 ; Blusch et al., 2000 ; Martin et al., 2000a , b ; Wilson et al., 2000 ). PERV-A and -B can productively infect human primary cells of endothelial and vascular origin (Martin et al., 2000a , b ), cell types which would become extensively exposed to potential xenografts.

PERVs have thus raised major concern regarding the safety of xenotransplantation, and the potential of cross-species infection by PERV has been reported by recent findings of PERV infection in non-obese diabetic severe combined immunodeficiency (NOD-SCID) mice after pig islet cell transplantation (Deng et al., 2000 ; van der Laan et al., 2000 ). However, studies of immunosuppressed non-human primates (Martin et al., 1998b ; Switzer et al., 1999 ; Templin et al., 2000 ; Winkler et al., 2000 ) and extensive retrospective studies of patients treated with living pig tissues or cells mostly for a short period of time did not result in any evidence of PERV infection (Patience et al., 1998 ; Heneine et al., 1998 , 2001 ; Paradis et al., 1999 ; Pitkin & Mullon, 1999 ; Dinsmore et al., 2000 ; Herring et al., 2001 ; Tacke et al., 2001 ). While the lack of evidence of PERV infection in primates and humans has been reassuring, these observations do not rule out that a risk exists.

Pig genomes have been reported to contain up to 50 copies of PERV, although many of them are likely to be defective (Patience et al., 1997 ; Le Tissier et al., 1997 ; Akiyoshi et al., 1998 ; Bosch et al., 2000 ; Krach et al., 2001 ). PERV integration patterns in different pig individuals showed only limited conservation (Le Tissier et al., 1997 ), suggesting that individual pigs harbour different sets of PERV with significant heterogeneity. Because retroviruses can evolve fast, it is possible that new forms of infectious PERV will emerge in the process of xenotransplantation. Replication competent, molecular clones of PERV will be useful to study PERV biology by genetic approaches. Infectious clones have recently been isolated by screening a phage genomic library derived from human 293 cells infected with PK15-derived PERV (Czauderna et al., 2000 ; Krach et al., 2001 ). In this study, we isolated infectious PERV clones using a PCR-based method, which is less labour intensive and more widely applicable than the classical method of phage library construction followed by hybridization screening. In addition, a titration method for PERV infection was established using polyclonal antibodies raised against PERV capsid protein, which allowed us to quantitatively compare infectivity of PERV-A and -B clones and their parental isolates as well as other standard gammaretrovirus strains.

PCR based cloning.
PERV proviruses were amplified in two overlapping halves. Primers (+)GGGGTACCCGAATT(A/C)CAGACCCTGCTGGCTGCC and (-) GGGGTACCTTTGTGGGGCAGGATTTCCTTCCC were designed to amplify a 5071 nt long 5' half spanning the region from the 5' LTR to integrase in pol. These primer sequences correspond to nucleotide positions 67 to 93 and 5165 to 5189, respectively, in PERV clone 293-PERV-A(42). 3' halves spanning 3926 nt from pol to U5 in the 3' LTR were amplified with primers (+) GGACTAGTGGGGGTTGCTTACCTCAGCAGGGAGGG and (-) CCACTAGTCCGGGCTCGGAAGAGGCGACACCCC, whose sequences correspond to nucleotide positions 4845 to 4871 and 8793 to 8819, respectively, in PERV clone 293-PERV-A(42). PCR reactions were performed in 100 µl volumes using Pfu polymerase (Stratagene) according to the manufacturers instructions with 100 ng genomic DNA derived from PERV infected or uninfected 293 cells as template. Genomic DNA was extracted with the QIAamp DNA Blood Mini Kit from Qiagen according to the manufacturers instructions. PCR reactions were run on a PTC-225 Peltier Thermal Cycler (MJ Research) at 94 °C for 4 min followed by 30 cycles of 1 min denaturation at 94 °C, 1 min annealing at 58 °C and a 12 min extension step at 72 °C. PCR products were analysed by gel-electrophoresis and purified using a Qiagen Gel Extraction Kit according to the manufacturers instructions. PCR products of the 5' half were subcloned using the Zero Blunt TOPO PCR Cloning Kit (Invitrogen) according to the manufacturers instructions. 3' half PCR products were digested with the restriction enzyme SpeI (SpeI site was included in the primers), ligated into SpeI-digested pBluescript SKII and transformed into the bacterial strain HB101. Minipreparations of DNA of positive transformants of 5' and 3' halves were checked for orientation of insertion. The unique restriction site NheI, located within the overlap between the 5' and 3' halves of PERV-A and -B, as well as the vector-specific restriction site NotI, which was present in both pBluescript KSII and pCR TOPO but not in the PERV sequence, were used to fuse 5' and 3' halves to full-length proviruses. Sequences of the clones were obtained by dye terminator cycle sequencing using a CEQ 2000 and accessories (Beckman). Homology scores of sequences were revealed using sequence analysis software Geneworks (Aladdin Systems Inc.).

PCR screening.
PCR reactions were performed in 50 µl volumes using Taq polymerase (Promega) according to the manufacturers instructions with 50 to 100 ng genomic DNA as template. Reactions were run at standard conditions using an extension time of 1 min per kb target sequence. Primer sequences for different amplicons were previously described (Patience et al., 1997 ).

Bacterial expression of capsid protein.
A His-tagged capsid (His6-capsid) expression vector was constructed by PCR with Pfu polymerase (Stratagene) and the primers (+) GATCGCCATGGTACCGCTGCGCACCTATGG and (-) CCACCTCGAGCAAGATCTTAGTCAAAT. A capsid-encoding 800 bp band was amplified using cycling conditions of 94 °C for 4 min followed by 30 cycles of 1 min denaturation at 94 °C, 1 min annealing at 56 °C followed by 1 min 20 s extension at 72 °C. The PCR product was purified with the QIAquick PCR Purification Kit, digested with the restriction enzymes XhoI and NcoI and ligated into the XhoI/NcoI-digested bacterial expression vector pET21D (Novagen). Expression of the His6-capsid protein was performed in the bacterial strain BL21 DE3 codon + (Stratagene). When 3 litres of bacterial culture reached an OD595 of 0·5, protein expression was induced with IPTG at a final concentration of 1 mM and the culture incubated with shaking at 37 °C for 4 h. After harvest the bacterial pellet was resuspended in 250 ml lysis buffer containing 50 mM Tris, 150 mM NaCl, 5 mM imidazole pH 8, 1 mM PMSF and protease inhibitor cocktail (Roche). Lysozyme was added to a final concentration of 0·1 mg/ml. To aid lysis the culture was freezethawed once and then sonicated followed by a 30 min centrifugation at 11000 r.p.m. at 4 °C. The supernatant containing the soluble protein fraction was batch-bound to 3 ml Ni2+agarose beads (Qiagen) for 1·5 h at 4 °C on a rotating wheel. The beads were then loaded onto a column and washed sequentially with (a) 50 ml of 50 mM Tris, 600 mM NaCl, 5 mM imidazole pH 8, 0·1% Tween, 0·1% Triton X-100, (b) 50 ml of 50 mM Tris, 150 mM NaCl, 5 mM imidazole pH 8, 0·1% Tween, 0·1% Triton X-100 and (c) 50 ml of 50 mM Tris, 150 mM NaCl, 10 mM imidazole pH 8, 0·1% Tween, 0·1% Triton X-100. The His6-caspid protein was eluted in a buffer consisting of 50 mM Tris, 150 mM NaCl, 100 mM imidazole pH 8, 1 mM PMSF and protease inhibitor cocktail. His6-capsid fractions were pooled and dialysed against 50 mM Tris, 150 mM NaCl, 0·5 mM DTT at 4 °C overnight.

Antibody production.
His6-capsid protein (440 µg) was adjusted to a volume of 2 ml with PBS and added to one vial of the adjuvant MPL+TDM+CWS (M6661, Sigma), according to the manufacturers instructions, and injected into a rabbit. Total serum was recovered after four further boosts with the same antigen/adjuvant preparation.

Immunoblotting and in situ staining.
Cell-lysates were analysed by SDSPAGE, transferred onto nitrocellulose membrane using a semi-dry blotting system (Hoefer) and probed with rabbit antibodies (dilution was 1/500 for the antibody produced in this study as well as that obtained from Q-One Biotech) using chemiluminescence-based detection (Amersham) according to the manufacturers instructions.

The detection of lacZ pseudotypes was performed as previously described (Takeuchi et al., 1994 ). For in situ staining with anti-PERV capsid antibody 293 cells were fixed for 15 min with an ice-cold 1:1 mixture of methanol and acetone and then left to dry. Fixed cells were stored at -20 °C if not processed immediately. Cells were washed twice in PBS and then blocked for 10 min at room temperature with PBS containing 10% foetal calf serum (FCS) followed by a 1 h incubation with PBS containing 1% FCS and anti-PERV capsid antibody at a dilution of 1:250. This was followed by two washes in PBS, 1% FCS and a 1 h incubation with PBS, 1% FCS containing secondary goat anti-rabbit antibody conjugated to alkaline phosphatase (Jackson). After two washes in PBS, 1% FCS and two washes in PBS, alkaline phosphatase was detected using NBT/BCIP ready-to-use tablets (Roche) according to the manufacturers instructions.

Viruses and cell culture.
The origins of the MLV-A and GALV SF virus strains, the lacZ pseudotypes and the human embryonic kidney fibroblasts 293 used here have been described previously (Takeuchi et al., 1998 ). The cell-free infection was carried out essentially as described previously (Takeuchi et al., 1994 ). Briefly, 104 cells per well of 293 cells were seeded in a 96-multiwell plate; 24 h later virus dilutions were added in the presence of 4 µg/ml polybrene and then incubated for 3 days before fixation and staining. Transfections into 293 cells were performed using lipofectamine from GIBCO according to the manufacturers instructions.

Nucleotide sequence accession numbers.
The complete nucleotide sequences of PERV-17 (AY099324) and PERV-60 (AY099323) have been deposited at GenBank. Sequences used for sequence comparison are PK15-ERV (AF038601) (Akiyoshi et al., 1998 ), 293-PERV-A(42) (AJ133817) (Krach et al., 2001 ) and 293-PERV-B(43) (AJ133818) (Czauderna et al., 2000 ).

Isolation of infectious PERV-A and PERV-B clones.
To investigate the relationship between biological and molecular properties of PERVs we have isolated replication competent molecular genomes from biological PERV isolates using a PCR-based technique. Viral isolates of PERV-A and -B were previously obtained by a limiting dilution of PK-15 cell supernatant on human 293 cells (Takeuchi et al., 1998 ). Clonal PERV-A or -B introduced by initial, single infection have spread to be saturated by many rounds of infection in these cell populations. These cultures are therefore likely to be mixtures of cells containing PERV proviruses integrated in different loci but enriched for infectious PERV proviruses. Genomic DNA (gDNA) of these PERV-A or -B infected 293 cells was isolated and used as template in PCR reactions to amplify PERV proviruses in two overlapping halves. These halves were then fused to full-length proviruses using a unique NheI restriction site located within the overlap (see Fig. 1). Several PCR reactions for amplification of 5' and 3' halves of each PERV subgroup were run in parallel and kept separate in the subsequent cloning procedure. PERV-specific PCR products of the expected sizes were obtained only from gDNA of PERV-A or -B infected 293 cells, while no signal was detected with gDNA of uninfected 293 cells (data not shown). PERV-A and -B 5' and 3' fragments were isolated, subcloned and fused to generate full-length proviruses using the unique restriction site within the overlap between 5' and 3' halves. Altogether nine 5' half clones (five PERV-A, four PERV-B) and eight 3' half clones (four PERV-A and four PERV-B) were randomly fused to generate nineteen PERV proviruses (nine PERV-A, six PERV-B, four PERV -A/-B chimera).



(10K):

Fig. 1. Scheme for the PCR-based isolation of full-length PERV genomes. A scheme of full-length PERV provirus is shown with the LTR sequences U3, R and U5 displayed as dark grey, light grey and black boxes and ORFs displayed as open boxes. The primer-binding site (PBS) is indicated. Two primer pairs, designated by arrows, amplified the provirus in two overlapping halves, shown as dashed lines. Primers span from nt 67 in U3 to nt 5189 in pol for the 5' half and from nt 4845 in pol to nt 8819 in U5 of the 3' LTR for the 3' half [reference for nucleotide positions is PERV clone 293-PK15-A(42)]. A vertical arrow indicates the NheI restriction site at nt position 4930 used to fuse 5' and 3' halves.

Screen for infectious PERV proviruses
To identify infectious proviruses the 19 clones were initially tested for their ability to express Gag proteins by transfection into human 293 cells; 9 days later cell lysates were prepared, analysed by SDSPAGE and probed with a rabbit polyclonal antibody against PERV capsid protein, kindly provided by Q-One Biotech (Fig. 2A). Of the nineteen PERV proviruses, six expressed Gag proteins (Fig. 2A, lanes 5, 10, 12, 14, 17 and 19) with a pattern identical to that found in 293 cells infected with a biological PERV-B isolate (lane 22). No signal was detected in lysates derived from untransfected or pcDNA-GFP-transfected cells (lanes 20, 21).



(48K):

Fig. 2. Screen for infectious PERV proviruses by expression of Gag proteins and transmission of proviral sequences into 293 target cells. (A) Cell lysates were screened with an antibody against recombinant PERV-capsid protein 9 days after transfection of 19 PERV proviral constructs into 293 cells (lanes 119). Numbers of Gag-expressing proviral clones are designated on top (lanes 5, 10, 12, 14, 17, 19); lanes 20, 21 are lysates of untransfected and pcDNA-GFP-transfected 293 cells, respectively; lane 22, lysate of 293 cells infected with biological isolate of PERV-B. (B) Supernatant of cellular cultures of PERV-17, -43, -53, -60, -69 and -71 (lanes 16) as well as that of pcDNA-GFP-transfected 293 cells (lane 7) and 293 cells infected with biological isolates of PERV-A or PERV-B (lanes 8 and 9, respectively) was transferred onto 293 cells. Four weeks later genomic DNA of the target 293 cells was prepared and tested for PCR amplification using primers specific to viral protease, PERV-A- and PERV-B-specific envelope sequences and to human GAPDH.

To test infectivity, cell-free supernatants of the six Gag-expressing cultures were harvested 30 days after transfection and used to challenge naive 293 cells. Successful transmission of PERV proviruses into target 293 cells was assayed by PCR for PERV-specific sequences (Fig. 2B). A primer pair specific for viral protease sequence amplified a band of the correct size from gDNA of five of the six target cell populations (Fig. 2B, lanes 1, 2, 3, 4, 6) as well as from gDNA of 293 cells infected with biological isolates of PERV-A or -B (lanes 8, 9). No transmission of protease sequence could be detected for provirus 69 (lane 5) and supernatant from pcDNA-GFP-transfected cells (lane 7), while the presence of template gDNA in all reactions was confirmed with primers specific for the human gene glyceraldehyde-3-phosphate dehydrogenase (Fig. 2B, GAPDH). Further PCR analysis with primers specific for PERV-A or -B envelope sequences confirmed clones 17 and 43 to display type B envelopes [Fig. 2B, env(B), lanes 1, 2] and clones 53 and 60 to display type A envelopes [Fig. 2B, env(A), lanes 3, 4]. The amplification of envelope sequence for clone 71 was not efficient in this particular experiment [Fig. 2B, env(A/B), lane 6]. However, clone 71 was subsequently shown to contain a PERV-A envelope sequence by PCR (data not shown) as well as sequencing analysis. Infectivity of the five PERV clones 17, 43, 53, 60 and 71 was further demonstrated by maintaining the cell cultures and serially transferring cell-free supernatants onto fresh 293 cells after every sixth cell passage (about every three weeks). Efficient virus replication of all five proviruses after the third serial transfer was demonstrated by detection of Gag expression using an antibody raised against recombinant capsid protein derived from the PERV clone 53 (Fig. 3, lanes 15). Sequence analysis showed that the capsid open reading frame of the expression construct is identical to that of the representative PERV-A clone, PERV-60 (data not shown).



(63K):

Fig. 3. Transmission of the molecular PERV clones on 293 cells after three serial transfers of supernatant. Supernatants from 293 cells transfected with PERV-17, -43, -53, -60, -71 or pcDNA-GFP were serially transferred three times onto fresh 293 cells every 3 weeks; 8 days after the third transfer, cell lysates were prepared and probed with an anti-PERV capsid antibody.

In summary, nine 5' half clones (5 PERV-A, 4 PERV-B) and eight 3' half clones (four PERV-A and four PERV-B) were randomly combined to construct nineteen PERV proviruses (nine PERV-A, six PERV-B, four PERV -A/-B chimera), of which five were found to be replication competent. Three 5' half and five 3' half clones were used to construct these five infectious proviral constructs, indicating that at least eight out of total fifteen half clones tested are functional. While PERV-60, which contains a PERV-A env, shares the same 5' half derived from PERV-A-infected 293 cells with PERV-43 and -53, PERV-17 consists of halves both derived from 293/PERV-B cells. PERV-43 is a chimeric construct derived from PERV-A 5' half and PERV-B 3' half. PERV-60 representing PERV-A and PERV-17 representing PERV-B were further studied in detail.

Genome analysis of infectious PERV- A and -B clones
To determine their genomic structure, proviruses PERV-17 and -60 were sequenced and compared to three PK-15-derived PERV database sequences. 293-PERV-A(42) and 293-PERV-B(43) are infectious clones from a λ phage library based on 293 cells infected with PK-15 supernatant (Czauderna et al., 2000 ; Krach et al., 2001 ). PK15-ERV is a PERV-A cDNA clone from PK-15 cells which is non-infectious due to deletions in pol and at the beginning of the env open reading frame (Akiyoshi et al., 1998 ). The isolated proviruses PERV-60 and PERV-17 consist of 8714 and 8704 nt, respectively, and are 99% identical to the corresponding sequences displayed by 293-PERV-A(42) and 293-PERV-B(43), respectively.

The sequence differences between PERV-60 and 293-PERV-A(42) as well as between PERV-17 and 293-PERV-B(43) are summarized in Table 1. While the LTRs and leader sequence contained interesting changes, the open reading frames of gag, pol and env were found to be highly homologous to database PERV sequences. Overall, the majority of base changes found in the genomes of PERV-17 and -60 were conserved in PK15-ERV and were also present in two or more of the five separately isolated molecular PERV clones (data not shown). This suggests that most of these changes reflect the sequence of the template proviruses rather than PCR errors. Limited sequencing of the other three infectious clones proved that they have small number of base changes and therefore are independent clones.


Table 1. Sequence comparison of PERV-60 and -17 proviral sequences with 293-PERV-A(42) and 293-PERV-B(43)


The deduced Gag amino acid sequences of PERV-60, -17 and 293-PERV-A(42) were identical while Gag of 293-PERV-B(43) differed in one residue. The deduced Pol amino acid sequences of PERV-60 and PERV-17 displayed five residue changes, and the deduced envelope sequences two changes each in comparison to 293-PERV-A(42) and 293-PERV-B(43). Finally, PERV-60 displayed a loss of one residue in Pol. However, the majority of these changes were found to be conserved in PK15-ERV (see Table 1) and other PERV database sequences (data not shown).

The LTR and leader sequences of PERV-17 and -60 were highly homologous to those of 293-PERV-A(42) and 293-PERV-B(43) with 97 and 98% nucleotide identity, respectively. Within U3 of the 5' LTR PERV-60 contained a deletion of 39 nt compared to 293-PERV-A(42). This sequence motif has previously been shown to act as viral enhancer and to multimerize dynamically upon serial passage of PERV in human cells (Scheef et al., 2001 ). PERV-17 and -60 contain two such enhancer repeats within their 5' LTR and three within their 3' LTR. The 5' LTR of PERV-60 was also found to contain a base triplet insertion (CGC) located 5 nt downstream of the transcriptional start site at the beginning of R (Czauderna et al., 2000 ), which is not present in any other PERV sequence and whose function is unknown.

The primer binding sites (PBS) of 293-PERV-A(42) and 293-PERV-B(43) are complementary to the last 18 nt of tRNAGly but differ from those of PERV-60 and -17 at one position (G677A, G638A, respectively), as shown in Table 2. However, this change is conserved in other endogenous retroviruses, feline RD114 and yellow baboon (Papio cynocephalus) endogenous retrovirus (Mang et al., 1999 ; van der Kuyl et al., 1999 ), and a database search (Sprinzel et al., 1999 ) identified this sequence as complementary to a human tRNAGly sequence. The PBS of PERV-17 contains an additional base change (T640G) which is only conserved in a mouse retrovirus-like 30S genetic element. The effect of this second base change in the PBS of PERV-17 on priming of reverse transcription is unclear but overall the replication efficiency of this virus was comparable to that of the other molecular and biological PERV isolates (data not shown). PBS changes have not been reported for PERV previously. While HIV as well as avian viruses have been shown to be stringent in tRNA primer utilization, MLV, a close relative of PERV seems to have less stringent requirements. Similar to our observations for PERV, endogenous MLVs with altered PBSs have been isolated (Nikbakht et al., 1985 ; Colicelli & Goff, 1986 ; Petersen et al., 1991 ; Yamauchi et al., 1995 ; Lund et al., 2000 ). However, subtle base changes in the PBS of MLV have been shown to restore replication in a non-permissive embryonic stem cell-line through the disruption of a negative regulatory element in the immediate vicinity of the PBS (Petersen et al., 1991 ; Yamauchi et al., 1995 ). While the alterations in the PBS had no effect on the replication efficiency of our PERV clones in 293 cells, it remains to be determined whether this is the case in other cell types. The remainder of the leader sequence of PERV-17 contained three further nucleotide changes and one insert of 8 nt compared to 293-PERV-B(43), but all these changes were conserved in PERV-A sequences.


Table 2. Sequence analysis of the primer binding site


Quantitative analysis of infectivity of molecular and biological PERV isolates
To compare the replication efficiency of molecular and biological PERV isolates, an in situ focus forming assay by immunostaining was established by modifying a previously established method for HIV titration (Simmons et al., 1995 ). Immunoperoxidase staining for PERV antigens of the same principle has been reported previously (Krach et al., 2000 ; Stephan et al., 2001 ; Tacke et al., 2001 ). 293 cells infected by PERV were screened for expression of Gag proteins 2 or 3 days after infection using our polyclonal antibody raised against a recombinant PERV-A capsid protein in combination with alkaline phosphatase-labelled secondary antibodies. Cells infected by MLV-A and GALV were also clearly stained due to cross-reaction of the primary anti-PERV antibody with their capsid proteins. Pseudotype assays using MLV-based vectors have been used to quantify virus entry and integration by us and others (Qari et al., 2001 ; Takeuchi et al., 1998 ; Wilson et al., 2000 ). To compare these two focus forming assays by immunostaining and vector transfer, we introduced the MFGnlslacZ vector genome into 293 cells persistently infected with PERV isolates as well as MLV-A and GALV. Supernatants of cell populations, more than 99% of which expressed both capsid and LacZ proteins and therefore were supposed to produce both replication competent virus and lacZ vector particles, were obtained and titrated on 293 cells in duplicate. One series was stained for capsid expression and the other for LacZ after a 3 day incubation. Examples of the two detection methods are shown in Fig. 4 and a representative set of results of three repeated experiments is shown in Table 3.



(50K):

Fig. 4. Comparison of focus forming assays by immunostaining and vector transfer. Supernatant of 293 cells persistently infected with PERV-A and expressing the MFGnlslacZ vector genome was titrated on 293 cells in duplicate. After a 3 day incubation one set was stained for capsid expression and the other for lacZ expression. 50 µl of neat virus supernatant or its 6-fold dilution was added to 293 cell cultures in 96-well plates (LacZ staining for 6-fold dilution is not shown). Control stains were performed on uninfected 293 cells.

Table 3. PERV titration on 293 cells by two focus forming assays


Molecular clones PERV-60 and -17 had similar titres to their parental, biological isolates, PERV-A and -B respectively, by both titration methods, suggesting that both molecular clones represent their parental isolates. PERV-A and -B have been suggested to have relatively low infectivity compared to other standard gammaretroviruses, such as MLV-A and GALV, while there has previously been no quantitative comparison of infectivity between PERV-A, -B, and other gammaretrovirus isolates. Our results showed that infectious titres of GALV and MLV-A were indeed significantly higher than those of the PERV clones irrespective of the focus forming assay used (Table 3). Furthermore, the titres of PERV-A isolates repeatedly were more than two magnitudes higher than those of PERV-B clones, suggesting that PERV-A is more infectious for 293 cells than PERV-B. Finally, we noted a significant difference in the titres obtained for PERV by the two focus forming assays. While the PERV-A titres obtained by lacZ vector transfer were in the range previously reported (about 103 iU/ml) (Takeuchi et al., 1998 ; Wilson et al., 2000 ), the immunostain revealed up to 8·6x104 iU/ml, suggesting that this detection method is more sensitive. We calculated the difference in sensitivity between immunostaining and lacZ transfer to be as much as 40-fold for PERV. For MLV and GALV, however, the difference in sensitivity between the two focus forming assays was only between 2- and 5-fold, suggesting that these viruses transfer lacZ vectors more efficiently than PERV. Thus, in retrospect, PERV infectivity and host-range studies assessed by transfer of MLV-reporter vectors should be interpreted carefully as the infectivity of wild-type PERV may have been underestimated. The PERV immunostaining assay described here retains the advantage of being a short-term assay while providing a more sensitive and accurate measurement of PERV infection.

Endogenous retroviruses are known to evolve rapidly and only minor genetic variations within retroviral genomes have been shown to alter tropism in the past. Up to now very few infectious clones of PERV have been analysed and assessed for their ability to evolve by mutation or recombination, and indeed one PERV envelope recombinant has already been reported (Wilson et al., 2000 ). In order to understand PERV replication and its associated risks for humans in xenotransplantation it will be important to isolate various different PERV genomes from different sources to assess their infectivity as well as their ability to mutate or recombine into novel forms with altered biological properties. We isolated PERV-A and -B proviruses with the same infectious properties as their parent isolates by a PCR-based method. These clones will be useful as standard clones, whilst this cloning method, in combination with the sensitive and quantitative immunocytological detection method described here, will be useful to address these issues.

This work was supported by the Medical Research Council. We thank Jonathan Stoye for helpful discussions, Dimitrios Stefanidis for technical assistance and David Onions (Q-One-Biotech) for the donation of anti-PERV antibody.

Footnotes

b † Present address: Laboratoire de Vectorologie Rétrovirale et Thérapie Génique, INSERM U412, École Normale Supérieure de Lyon, 46 allée d'Italie, 69364 Lyon Cedex 07, France.

References

Akiyoshi, D. E., Denaro, M., Zhu, H., Greenstein, J. L., Banerjee, P. & Fishman, J. A. (1998). Identification of a full-length cDNA for an endogenous retrovirus of miniature swine. Journal of Virology 72, 4503-4507.[Abstract/Free Full Text]

Armstrong, J. A., Porterfield, J. S. & De Madrid, A. T. (1971). C-type virus particles in pig kidney cell lines. Journal of General Virology 10, 195-198.[Abstract/Free Full Text]

Birmingham, K. (1999). FDA subcommittee finds no evidence of PERV transmission. Nature Medicine 5, 855.

Blusch, J. H., Patience, C., Takeuchi, Y., Templin, C., Roos, C., Von Der Helm, K., Steinhoff, G. & Martin, U. (2000). Infection of nonhuman primate cells by pig endogenous retrovirus. Journal of Virology 74, 7687-7690.[Abstract/Free Full Text]

Bosch, S., Arnauld, C. & Jestin, A. (2000). Study of full-length porcine endogenous retrovirus genomes with envelope gene polymorphism in a specific-pathogen-free Large White swine herd. Journal of Virology 74, 8575-8581.[Abstract/Free Full Text]

Breese, S. S.Jr (1970). Virus-like particles occurring in cultures of stable pig kidney cell lines. Archiv für die Gesamte Virusforschung 30, 401-404.[Medline]

Colicelli, J. & Goff, S. P. (1986). Isolation of a recombinant murine leukemia virus utilizing a new primer tRNA. Journal of Virology 57, 37-45.[Abstract/Free Full Text]

Cozzi, E., Masroor, S., Soin, B., Vial, C. & White, D. J. (2000). Progress in xenotransplantation. Clinical Nephrology 53, 13-18.

Czauderna, F., Fischer, N., Boller, K., Kurth, R. & Tonjes, R. R. (2000). Establishment and characterization of molecular clones of porcine endogenous retroviruses replicating on human cells. Journal of Virology 74, 4028-4038.[Abstract/Free Full Text]

Deng, Y. M., Tuch, B. E. & Rawlinson, W. D. (2000). Transmission of porcine endogenous retroviruses in severe combined immunodeficient mice xenotransplanted with fetal porcine pancreatic cells. Transplantation 70, 1010-1016.[Medline]

Dinsmore, J. H., Manhart, C., Raineri, R., Jacoby, D. B. & Moore, A. (2000). No evidence for infection of human cells with porcine endogenous retrovirus (PERV) after exposure to porcine fetal neuronal cells. Transplantation 70, 1382-1389.[Medline]

Ericsson, T., Oldmixon, B., Blomberg, J., Rosa, M., Patience, C. & Andersson, G. (2001). Identification of novel porcine endogenous betaretrovirus sequences in miniature swine. Journal of Virology 75, 2765-2770.[Abstract/Free Full Text]

Heneine, W., Tibell, A., Switzer, W. M., Sandstrom, P., Rosales, G. V., Mathews, A., Korsgren, O., Chapman, L. E., Folks, T. M. & Groth, C. G. (1998). No evidence of infection with porcine endogenous retrovirus in recipients of porcine islet-cell xenografts. Lancet 352, 695-699.[Medline]

Heneine, W., Switzer, W. M., Soucie, J. M., Evatt, B. L., Shanmugam, V., Rosales, G. V., Matthews, A., Sandstrom, P. & Folks, T. M. (2001). Evidence of porcine endogenous retroviruses in porcine factor VIII and evaluation of transmission to recipients with hemophilia. Journal of Infectious Diseases 183, 648-652.[Medline]

Herring, C., Cunningham, D. A., Whittam, A. J., Fernandez-Suarez, M. & Langford, G. A. (2001). Monitoring xenotransplant recipients for infection by PERV. Clinical Biochemistry 34, 23-27.[Medline]

Krach, U., Fischer, N., Czauderna, F., Kurth, R. & Tonjes, R. R. (2000). Generation and testing of a highly specific anti-serum directed against porcine endogenous retrovirus nucleocapsid. Xenotransplantation 7, 221-229.[Medline]

Krach, U., Fischer, N., Czauderna, F. & Tonjes, R. R. (2001). Comparison of replication-competent molecular clones of porcine endogenous retrovirus class A and class B derived from pig and human cells. Journal of Virology 75, 5465-5472.[Abstract/Free Full Text]

Le Tissier, P., Stoye, J. P., Takeuchi, Y., Patience, C. & Weiss, R. A. (1997). Two sets of human-tropic pig retrovirus. Nature 389, 681-682.[Medline]

Lund, A. H., Duch, M. & Pedersen, F. S. (2000). Selection of functional tRNA primers and primer binding site sequences from a retroviral combinatorial library: identification of new functional tRNA primers in murine leukemia virus replication. Nucleic Acids Research 28, 791-799.[Abstract/Free Full Text]

Mang, R., Goudsmit, J. & van der Kuyl, A. C. (1999). Novel endogenous type C retrovirus in baboons: complete sequence, providing evidence for baboon endogenous virus gagpol ancestry. Journal of Virology 73, 7021-7026.[Abstract/Free Full Text]

Martin, U., Kiessig, V., Blusch, J. H., Haverich, A., von der Helm, K., Herden, T. & Steinhoff, G. (1998a). Expression of pig endogenous retrovirus by primary porcine endothelial cells and infection of human cells. Lancet 352, 692-694.[Medline]

Martin, U., Steinhoff, G., Kiessig, V., Chikobava, M., Anssar, M., Morschheuser, T., Lapin, B. & Haverich, A. (1998b). Porcine endogenous retrovirus (PERV) was not transmitted from transplanted porcine endothelial cells to baboons in vivo. Transplantation International 11, 247-251.

Martin, U., Winkler, M. E., Id, M., Radecke, H., Arseniev, L., Groteluschen, R., Simon, A. R. & Steinhoff, G. (2000a). Transmission of pig endogenous retrovirus to primary human cells. Transplantation Proceedings 32, 1157.[Medline]

Martin, U., Winkler, M. E., Id, M., Radeke, H., Arseniev, L., Takeuchi, Y., Simon, A. R., Patience, C., Haverich, A. & Steinhoff, G. (2000b). Productive infection of primary human endothelial cells by pig endogenous retrovirus (PERV). Xenotransplantation 7, 138-142.[Medline]

Nikbakht, K. N., Ou, C. Y., Boone, L. R., Glover, P. L. & Yang, Z. K. (1985). Nucleotide sequence analysis of endogenous murine leukemia virus-related proviral clones reveals primer-binding sites for glutamine tRNA. Journal of Virology 54, 889-893.[Abstract/Free Full Text]

Paradis, K., Langford, G., Long, Z., Heneine, W., Sandstrom, P., Switzer, W. M., Chapman, L. E., Lockey, C., Onions, D. & Otto, E. (1999). Search for cross-species transmission of porcine endogenous retrovirus in patients treated with living pig tissue. Science 285, 1236-1241.[Abstract/Free Full Text]

Patience, C., Takeuchi, Y. & Weiss, R. A. (1997). Infection of human cells by an endogenous retrovirus of pigs. Nature Medicine 3, 282-286.[Medline]

Patience, C., Patton, G. S., Takeuchi, Y., Weiss, R. A., McClure, M. O., Rydberg, L. & Breimer, M. E. (1998). No evidence of pig DNA or retroviral infection in patients with short- term extracorporeal connection to pig kidneys. Lancet 352, 699-701.[Medline]

Patience, C., Switzer, W. M., Takeuchi, Y., Griffiths, D. J., Goward, M. E., Heneine, W., Stoye, J. P. & Weiss, R. A. (2001). Multiple groups of novel retroviral genomes in pigs and related species. Journal of Virology 75, 2771-2775.[Abstract/Free Full Text]

Petersen, R., Kempler, G. & Barklis, E. (1991). A stem cell-specific silencer in the primer-binding site of a retrovirus. Molecular Cell Biology 11, 1214-1221.[Abstract/Free Full Text]

Pitkin, Z. & Mullon, C. (1999). Evidence of absence of porcine endogenous retrovirus (PERV) infection in patients treated with a bioartificial liver support system. Artificial Organs 23, 829-833.[Medline]

Platt, J. L. (2000). Xenotransplantation. New risks, new gains. Nature 407, 27, 2930.[Medline]

Qari, S. H., Magre, S., Garcia-Lerma, J. G., Hussain, A. I., Takeuchi, Y., Patience, C., Weiss, R. A. & Heneine, W. (2001). Susceptibility of the porcine endogenous retrovirus to reverse transcriptase and protease inhibitors. Journal of Virology 75, 1048-1053.[Abstract/Free Full Text]

Scheef, G., Fischer, N., Krach, U. & Tonjes, R. R. (2001). The number of a U3 repeat box acting as an enhancer in long terminal repeats of polytropic replication-competent porcine endogenous retroviruses dynamically fluctuates during serial virus passages in human cells. Journal of Virology 75, 6933-6940.[Abstract/Free Full Text]

Simmons, G., McKnight, A., Takeuchi, Y., Hoshino, H. & Clapham, P. R. (1995). Cell-to-cell fusion, but not virus entry in macrophages by T-cell line tropic HIV-1 strains: a V3 loop-determined restriction. Virology 209, 696-700.[Medline]

Sprinzel, M., Vassilenko, K. S., Emmerich, J. & Bauer, F. (1999). Compilation of tRNA sequences and sequences of tRNA genes. http/uni-bayreuth.de/departments/biochemie/trna/, r1r54.

Stephan, O., Schwendemann, J., Specke, V., Tacke, S. J., Boller, K. & Denner, J. (2001). Porcine endogenous retroviruses (PERVs): generation of specific antibodies, development of an immunoperoxidase assay (IPA) and inhibition by AZT. Xenotransplantation 8, 310-316.[Medline]

Switzer, W. M., Shanmugam, V., Chapman, L. & Heneine, W. (1999). Polymerase chain reaction assays for the diagnosis of infection with the porcine endogenous retrovirus and the detection of pig cells in human and nonhuman recipients of pig xenografts. Transplantation 68, 183-188.[Medline]

Tacke, S. J., Bodusch, K., Berg, A. & Denner, J. (2001). Sensitive and specific immunological detection methods for porcine endogenous retroviruses applicable to experimental and clinical xenotransplantation. Xenotransplantation 8, 125-135.[Medline]

Takeuchi, Y. & Weiss, R. A. (2000). Xenotransplantation: reappraising the risk of retroviral zoonosis. Current Opinion in Immunology 12, 504-507.[Medline]

Takeuchi, Y., Cosset, F. L., Lachmann, P. J., Okada, H., Weiss, R. A. & Collins, M. K. (1994). Type C retrovirus inactivation by human complement is determined by both the viral genome and the producer cell. Journal of Virology 68, 8001-8007.[Abstract/Free Full Text]

Takeuchi, Y., Patience, C., Magre, S., Weiss, R. A., Banerjee, P. T., Le Tissier, P. & Stoye, J. P. (1998). Host range and interference studies of three classes of pig endogenous retrovirus. Journal of Virology 72, 9986-9991.[Abstract/Free Full Text]

Templin, C., Schroder, C., Simon, A. R., Laaff, G., Kohl, J., Chikobava, M., Lapin, B., Steinhoff, G. & Martin, U. (2000). Analysis of potential porcine endogenous retrovirus transmission to baboon in vitro and in vivo. Transplantation Proceedings 32, 1163-1164.[Medline]

Todaro, G. J., Benveniste, R. E., Lieber, M. M. & Sherr, C. J. (1974). Characterization of a type C virus released from the porcine cell line PK(15). Virology 58, 65-74.[Medline]

van der Kuyl, A. C., Dekker, J. T. & Goudsmit, J. (1999). Discovery of a new endogenous type C retrovirus (FcEV) in cats: evidence for RD-114 being an FcEV(GagPol)/baboon endogenous virus BaEV(Env) recombinant. Journal of Virology 73, 7994-8002.[Abstract/Free Full Text]

van der Laan, L. J., Lockey, C., Griffeth, B. C., Frasier, F. S., Wilson, C. A., Onions, D. E., Hering, B. J., Long, Z., Otto, E., Torbett, B. E. & Salomon, D. R. (2000). Infection by porcine endogenous retrovirus after islet xenotransplantation in SCID mice. Nature 407, 90-94.[Medline]

Wilson, C. A., Wong, S., Muller, J., Davidson, C. E., Rose, T. M. & Burd, P. (1998). Type C retrovirus released from porcine primary peripheral blood mononuclear cells infects human cells. Journal of Virology 72, 3082-3087.[Abstract/Free Full Text]

Wilson, C. A., Wong, S., VanBrocklin, M. & Federspiel, M. J. (2000). Extended analysis of the in vitro tropism of porcine endogenous retrovirus. Journal of Virology 74, 49-56.[Abstract/Free Full Text]

Winkler, M. E., Martin, U., Loss, M., Arends, H., Rensing, S., Kaup, F. J., Hedrich, H. J., Klempnauer, J. & Winkler, M. (2000). Porcine endogenous retrovirus is not transmitted in a discordant porcine-to-cynomolgus xenokidney transplantation model with long-term survival of organ recipients. Transplantation Proceedings 32, 1162.[Medline]

Yamauchi, M., Freitag, B., Khan, C., Berwin, B. & Barklis, E. (1995). Stem cell factor binding to retrovirus primer binding site silencers. Journal of Virology 69, 1142-1149.[Abstract/Free Full Text]

Received 14 January 2002; accepted 3 May 2002.