Abstract
A Flaviviridae family member, HCV possesses a positive-sense, ssRNA genome of about 9600 nucleotides (Reed & Rice, 2000). The HCV genome consists of highly conserved 5'- and 3'-noncoding regions (NCR), and a large open reading frame (ORF) that encodes a polyprotein of approximately 3010 amino acids. The polyprotein is processed co- and post-translationally by both host and viral proteases into at least 10 structural (core, E1, E2 and p7) and nonstructural (NS) proteins (NS2, NS3, NS4A, NS4B, NS5A and NS5B). Recent studies also show the existence of an alternative ORF within the core-coding region that encodes a novel HCV protein of unknown function (Varaklioti et al., 2002; Walewski et al., 2001; Xu et al., 2001). The 5' terminus of the HCV genome possesses a complex secondary structure that functions as an internal ribosome-entry site (IRES) to mediate viral protein translation in a cap-independent manner (Hellen & Pestova, 1999; Rijnbrand & Lemon, 2000). The HCV IRES was mapped between about 40 and 370 nucleotides from the 5'-end of the genome, including most of the 5'-NCR and a small beginning portion of the core-coding region (Honda et al., 1996; Reynolds et al., 1995; Rijnbrand et al., 1995). Three distinct elements have been shown to be involved in HCV IRES-mediated translation: (1) integrity of the global structure of HCV IRES (Hellen & Pestova, 1999); (2) the 3'-terminal region of the HCV genome; (3) trans-acting cellular factors that interact with the HCV IRES element and assist in translation initiation. Furthermore, the HCV core protein-coding sequence, but not the core protein, has been suggested to modulate HCV IRES-directed translation efficiency, possibly through long-range RNARNA interaction (Honda et al., 1999; Wang et al., 2000). However, another recent study suggested that core protein caused autogenous inhibition of HCV IRES translation, which may imply a mechanism for switching from translation to RNA replication and/or encapsidation during the virus life-cycle (Zhang et al., 2002). Interestingly, HCV IRES-mediated translation seems to be regulated by cell cycle-associated mechanisms, and it is known that the HCV IRES activity varies with the cell cycle (Honda et al., 2000; Pietschmann et al., 2001).
Being a highly conserved, virus-specific mechanism, the IRES-mediated translation of HCV constitutes an excellent target for development of the next generation of antiviral drugs for HCV (Jubin, 2001). However, because of the lack of an efficient in vitro infection system, the regulatory mechanisms of HCV IRES-mediated translation still remain poorly characterized. Previous studies focused on the roles of HCV genomic RNA sequences and structures, and in trans cellular proteins, in regulation of HCV IRES-directed translation. Few studies have characterized the effects of HCV-encoded proteins on HCV translation, and it remains largely unknown whether any HCV-encoded nonstructural protein(s) can regulate IRES-directed translation, as part of the virus's strategies to control its life-cycle. In this study, using both the HCV replicon cells and human liver cells transiently expressing HCV nonstructural proteins, we investigated the function of HCV nonstructural proteins in regulating HCV IRES-mediated translation. We also characterized the possible molecular mechanisms underlying the phenotype and suggest a novel mechanism by which HCV modulates its cap-independent translation and facilitates virus persistence.
Cell culture and plasmid construction.The HCV subgenomic replicon construct (Fig. 1A) has been described previously, and the Huh7-derived HCV replicon cells were generated and maintained as previously described (Blight et al., 2000; Lohmann et al., 1999). The Huh7 human haematoma cells were cultured in DMEM supplemented with 2 mM L-glutamine, nonessential amino acids, 100 U penicillin ml-1, 100 µg streptomycin ml-1 and 10 % foetal calf serum, at 37 °C in the presence of 5 % CO2. The Tet-On Huh7 cell line was constructed using the Tet-On Gene Expression System (Clontech) according to the manufacturer's instructions, and was maintained in DMEM supplemented with 2 mM L-glutamine, nonessential amino acids, 100 U penicillin ml-1, 100 µg streptomycin ml-1, 10 % foetal calf serum and 200 µg G418 ml-1, at 37 °C in the presence of 5 % CO2. In order to construct the expression plasmids carrying the individual replicon nonstructural protein genes, the individual replicon nonstructural protein coding sequences were amplified by PCR from pHCVneo17 (Blight et al., 2000), and inserted into the SacII and XbaI sites of pTRE vector (Clontech), resulting in pTRE-NS3, pTRE-NS4A, pTRE-NS4B, pTRE-NS5A and pTRE-NS5B. The following PCR primers were used (sequences in 5' to 3'): GTACCGCGGATGGCGCCTATTACG and TCGTCTAGACGTGACGACCTCCAGGTCAG (for NS3 coding sequence); CGACCGCGGATGAGCACCTGGGTG and ACGTCTAGAGCACTCTTCCATCTCATCG (for NS4A coding sequence); TTACCGCGGATCGCCTCACACCTCCCTTAC and ACGTCTAGAGCATCCCGTGGAGCAGTC (for NS4B coding sequence); GTACCGCGGATGTCCGGCTCGTGGCTAAG and ACGTCTAGAGCAGCAGACGACGTCCTCAC (for NS5A coding sequence); and GTACCGCGGATGTCGATGTCCTACACATGG and GCTTCTAGATCGGTTGGGGAGTAGATAG (for NS5B coding sequence). pCDNA3-NS5A-1a, pCDNA3-NS5A-1b1 and pCDNA3-NS5A-1b5 have been described previously (Gale et al., 1997, 1998, 1999). The pTRE-β-galactosidase construct will be described in a future publication (G. K. Geiss and others).
|
Luciferase reporter constructs and luciferase assays.
The dual-luciferase reporter constructs containing the HCV IRES, the poliovirus IRES and the encephalomyocarditis virus (EMCV) IRES have been described previously (Collier et al., 1998; Creancier et al., 2001; Poulin et al., 1998) (Fig. 1B). 2x105 cells in 35 mm tissue culture plates were transiently transfected with 1 µg of each plasmid DNA using SuperFect (Qiagen) according to the manufacturer's instructions. The dual-luciferase assays were performed with the Dual-Luciferase Reporter Assay System (Promega), according to the manufacturer's instructions, on a Beckman Coulter LS6500 scintillation counter. All the luciferase assays were performed in triplicate and mean values are shown.
Interferon and ribavirin treatment.
Human type I IFN was purchased from Access. Ribavirin was purchased from Sigma. For IFN treatment, Huh7 and HCV replicon cells were incubated with media containing type I IFN (5 and 50 IU ml-1) for 24 h at 37 °C in the presence of 5 % CO2. For ribavirin treatment, Huh7 and HCV replicon cells were incubated with media containing ribavirin (400 and 1000 µM) for 24 h at 37 °C in the presence of 5 % CO2.
Antibodies and immunoblot assays.
Antibodies specific to HCV NS3, NS4A and NS5B were described previously (Tomei et al., 1993). The antibody specific to HCV NS5A was purchased from ID Labs. Antibodies specific to phosphorylated eIF2α (Ser51), total eIF2α, phosphorylated eIF4E (Ser209), total eIF4E, phosphorylated Erk1/2 (Thr180/Tyr182) and total Erk1/2 were previously described (He et al., 2001). For immunoblot analysis, cell lysates were collected and protein concentrations were determined as described previously (He et al., 2001). Equal amounts of cell lysates were resolved on SDS-PAGE (12 %), followed by electroblotting to nitrocellulose membrane (Schleicher and Schuell). The immunoblot analysis was performed as previously described (He et al., 2001). The relative levels of protein phosphorylation were determined by quantifying the immunoblots with ImageQuant (version 5.1). The signals from the phospho-specific immunoblots were normalized against their individual control signals and the ratio of phospho-specific signal to control signal was calculated as previously described (He et al., 2001).
In this study we utilized the recently developed HCV replicon system to study the effect of HCV nonstructural proteins on HCV IRES-mediated translation. The HCV replicon cells are Huh7 human hepatoma cells stably transfected with self-replicating, subgenomic HCV RNA constructs carrying the HCV nonstructural coding region (Fig. 1A), and express the nonstructural proteins (NS3, NS4A, NS4B, NS5A and NS5B) (Blight et al., 2000; Lohmann et al., 1999). Expression of the HCV proteins (NS3, NS4A, NS5A and NS5B) and replication of the subgenomic construct in the replicon cells were confirmed by immunoblot and RT-PCR analysis, respectively (data not shown).
We examined the effect of HCV replicon on HCV IRES-mediated translation using an established dual-luciferase reporter gene construct containing a genotype 1b HCV IRES element (Fig. 1B). In this bicistronic reporter construct, translation of the upstream Renilla luciferase gene is initiated in a cap-dependent mechanism, while translation of the downstream firefly luciferase gene is mediated by an HCV IRES element contained within the HCV 5'NTR in a cap-independent manner. This construct allows internally controlled quantification of the IRES-directed translational level since the two luciferase reporters are apparently translated from the same transcripts. The HCV-IRES dual-luciferase reporter construct was transiently transfected into either the HCV replicon cells (clone 10A) (Blight et al., 2000) or Huh7 cells, the parental control cell line. Cell lysates were collected at different time-points post-transfection and dual-luciferase assays were performed on the lysates (Fig. 2A). The relative IRES-activity levels were expressed as the ratio of the activity of firefly luciferase (IRES-dependent) over that of Renilla luciferase (cap-dependent). The activity of the HCV IRES in Huh7 cells was arbitrarily taken as 100 % with the activity of the IRES in replicon cells expressed relative to this. As shown in Fig. 2(A), at 12 h post-transfection, there was no significant difference in HCV IRES-directed translational levels between the replicon and Huh7 cells. However, at 24 h post-transfection, an almost 2-fold increase in relative HCV IRES activity was observed in the replicon cells over that of Huh7 cells. In our experiments the effects of NS proteins on IRES were not observed at early time-points after transfection, which is probably due to the recovery phase of cells following the rather cytotoxic transfection procedure. Examination of the absolute Renilla and firefly luciferase activity levels showed that HCV replicon caused an increase in the IRES-dependent firefly luciferase activity, but not in cap-directed Renilla luciferase reporter activity (data not shown). In addition, no significant difference in the global cellular protein synthesis rates was observed between Huh7 and replicon cells by pulse-labelling analysis (data not shown). This suggests that the HCV replicon cells specifically stimulate HCV IRES-directed translation, but not cap-dependent global mRNA translation. Similar, but more dramatic, results (a 5·5-fold increase) were acquired with another HCV replicon cell line clone (clone Huh-9-13) (Lohmann et al., 1999), although slightly different kinetics was observed in this cell line (Fig. 2B). The difference in relative HCV IRES activity levels and kinetics may be caused by variations in either experimental conditions and/or replicon clones. Collectively, these results suggest that the stimulatory effect of HCV replicon on HCV IRES activity is not clone-specific, and is thus likely due to HCV-encoded function(s).
|
Since numerous viruses employ an IRES-mediated translational initiation mechanism (Gale et al., 2000), this raised the question of whether the HCV replicon only stimulates the HCV IRES-mediated translation specifically, or if it may also enhance the activity of other viral IRES elements. We thus compared the effects of HCV replicon on the activity of HCV, poliovirus and EMCV IRES, using dual-luciferase reporter constructs that contain these different viral IRES elements (Fig. 1B). The different reporter constructs were transfected into both HCV replicon cells (clone 10A) and Huh7 cells, and the relative IRES activity levels were determined at 24 h post-transfection as described above (Fig. 2C, D). The activities of the viral IRES in Huh7 cells were arbitrarily taken as 100 % with the IRES activities in replicon cells expressed relative to this. The HCV replicon caused a 3- to 5-fold increase in HCV IRES activity levels, while either only a slight increase in poliovirus IRES activity (Fig. 2C) or no significant difference in EMCV IRES activity (Fig. 2D) was observed. These results indicate that HCV replicon specifically stimulates HCV, but not other viral IRES-mediated translation, and the underlying mechanism is thus likely to be HCV-specific.
The effect of HCV replicon on HCV IRES-mediated translation is sensitive to both IFN and ribavirin treatment
However, it was unclear whether the enhancement of HCV IRES activity by replicon cells was caused by HCV-encoded function(s) or by adaptive cellular mutations that occurred during the replicon cell line construction process. We next attempted to address this question by inhibiting replication of the HCV replicon in clone 10A replicon cells with IFN and ribavirin treatment. Both IFN and ribavirin are used in the current therapies for HCV infection (Hoofnagle, 1999), and have been shown to perturb HCV genome replication in different cell culture systems, including the replicon system (Blight et al., 2000; Chung et al., 2001; Frese et al., 2001; Maag et al., 2001). If the HCV IRES-stimulatory effect of the replicon cells were due to HCV-encoded protein function(s), we would speculate that anti-HCV drug treatment, which inhibits HCV genome replication and protein expression, would therefore inhibit the IRES-stimulatory effect of HCV replicon cells.
In the experiment shown in Fig. 3(A), both Huh7 and clone 10A replicon cells were transiently transfected with the HCV IRES-containing dual-luciferase reporter construct, immediately followed by treatment either with different concentrations of type I IFN (lanes 36) or with ribavirin (lanes 710). Untreated cells were used as controls (lanes 1 and 2). At 24 h post-transfection and drug treatment, cell lysates were collected and dual-luciferase assays were performed to determine relative IRES activity levels as described above. The activity of the HCV IRES in untreated Huh7 cells was arbitrarily taken as 100 % with the activities of the IRES under other conditions expressed relative to this. As shown in Fig. 3(A), the drug treatment did not have a significant effect on relative HCV IRES activity in the parental Huh7 cells (lanes 3, 5, 7 and 9), while in replicon cells 2- to 3-fold inhibitions of HCV IRES activity were observed (lanes 4, 6, 8 and 10). The inhibition of relative HCV IRES activity in replicon cells was primarily caused by a decrease in IRES-directed firefly luciferase activity level, while the cap-dependent Renilla luciferase activity level remained almost unchanged (Fig. 3B). These results suggest that the mechanism(s) responsible for the enhancement of HCV IRES activity by replicon cells is sensitive to anti-HCV drug treatment, and is thus likely to be an HCV-encoded function(s), rather than adaptive cellular mutations in the replicon cells. Inhibition of HCV replicon RNA levels by IFN treatment in our experiments was observed by RT-PCR analysis (data not shown), which is consistent with the results of previous studies (Blight et al., 2000; Chung et al., 2001). IFN treatment was also found to reduce HCV protein levels in the replicon cells (data not shown). All these results argue forcefully in supporting the notion that HCV upregulates its own cap-independent translation process.
|
The NS5A protein stimulates HCV IRES activity
Knowing that the HCV replicon upregulates HCV IRES activity, we next examined which HCV nonstructural protein(s) was responsible for the function. The individual HCV nonstructural protein coding regions (NS3, NS4A, NS4B, NS5A and NS5B) were subcloned from the parental HCV replicon plasmid construct and expressed separately in Huh7 cells by transient transfection, in combination with the HCV IRES-containing dual-luciferase reporter gene. As shown in Fig. 4(A), expression of NS3, NS4A and NS5B did not seem to have any significant effect on the activity level of HCV IRES, as compared with the vector control. On the other hand, expression of NS5A increased HCV IRES-mediated translation level by about 2-fold. In addition, NS4B expression also seemed to increase HCV IRES activity levels to a lesser extent. These results indicate that NS5A and NS4B may be the HCV nonstructural proteins that upregulate HCV IRES activity, although it is possible different HCV proteins may function synergistically. The expression of the HCV nonstructural proteins was confirmed by immunoblot analysis (data not shown).
|
To gain insight into the molecular mechanism(s) by which NS5A protein enhances HCV IRES-directed translation, we tested the effect of different NS5A isolates on HCV IRES activity level. As shown in Fig. 4(B), an independent NS5A isolate, NS5A-1b1, which carries a wild-type, IFN-resistant ISDR (IFN sensitivity-determining region) sequence (Gale et al., 1997), increased IRES activity level to a similar extent (about 2-fold), as compared with both the vector control and the expression of an unrelated protein, β-galactosidase. Interestingly, in the same experiment, an NS5A isolate carrying a mutant, IFN-sensitive ISDR sequence, NS5A-1b5 (Gale et al., 1997), was defective in enhancing the activity of HCV IRES. The expression of both NS5A-1b1 and NS5A-1b5 was confirmed by immunoblot analysis and comparable expression levels were observed (data not shown). Therefore, the ability of NS5A to mediate IFN-resistance of HCV is correlated to its ability to regulate HCV protein translation and replication (He & Katze, 2002).
HCV replicon cells show decreased levels of eIF2α and eIF4E phosphorylation
Our previous study (He et al., 2001) showed that NS5A was able to decrease the phosphorylation levels of both eIF2α and eIF4E, suggesting a possible mechanism by which HCV may differentially regulate cap-dependent and -independent translation initiation. So we next examined the phosphorylation status of eIF2α and eIF4E in Huh7 and clone 10A replicon cells, in order to probe the possible molecular mechanisms by which HCV replicon stimulates HCV IRES activity. By performing immunoblot analysis with antibodies that specifically recognize the phosphorylated forms of eIF2α and eIF4E (Fig. 5A, B), lower phosphorylation levels of both eIF2α and eIF4E were detected in replicon cells than in Huh7 parental cells, which is consistent with our previous results. Importantly, HCV replicon did not seem to alter the total protein levels of eIF2α and eIF4E, as shown by immunoblot analysis with antibodies that recognize total eIF2α and eIF4E (Fig. 5A, B). However, it remains uncertain whether in replicon cells the modulation of eIF2α and eIF4E phosphorylation levels is due to NS5A action. Since it is known that the phosphorylation of eIF4E is regulated by the mitogen-activated protein kinase (MAPK) pathway, the activation level of the Erk1/2 MAPK was also compared in Huh7 and replicon cells, by performing immunoblot analysis with antibody specific for the phosphorylated, activated forms of Erk1/2 MAPKs. Consistent with the reduced level of eIF4E phosphorylation in replicon cells, the level of Erk1/2 MAPK phosphorylation observed in replicon cells was lower than in Huh7 cells (Fig. 5C) (He et al., 2002). These results suggest that HCV replicon caused reduced phosphorylation levels of both eIF2α and eIF4E, which may play a role in the enhancement of HCV IRES activity in these cells. However, considering the fact that HCV replicon stimulated HCV IRES function specifically, and had no significant effect of other viral IRES elements, it is likely that an additional HCV-specific mechanism(s) is responsible for the HCV IRES-specific phenotype of the replicon cells.
|
In persistent viral infections, such as those by HCV or the DNA tumour viruses, constitutive modulation of host translational control pathways and release of translational suppression may make important contributions to viral pathogenesis/oncogenesis. However, little is known of the nature of viral translational programming as it pertains to persistent infection, although it clearly requires that the host mRNA translation remain sufficient to sustain the host cell and support virus persistence. Analyses of the mechanisms by which viruses may mediate persistence and latency suggest that host cell integrity and translational competence are maintained through (i) viral modulation of specific cellular mRNA translation and (ii) viral modification of host signalling and translational regulatory pathways (Gale et al., 2000). In the case of HCV, our understanding of viral translational control mechanisms is further limited by the lack of efficient virus infection systems, and the current working models are based on results from in vitro and surrogate systems. Both NS5A and E2 proteins of HCV have been shown to interact with and inhibit PKR (Gale et al., 1997, 1998; Taylor et al., 1999). Inhibition of PKR-dependent eIF2α phosphorylation can be seen as a mechanism to ensure overall translational competence during virus infection. Our previous study also showed that NS5A protein inhibits eIF4E (the mRNA cap-binding protein) phosphorylation, through both Grb2- and PKR-dependent pathways (He et al., 2001). The downregulation of eIF4E phosphorylation and activation may negatively affect the translation of at least a subset of cellular mRNAs, especially those that are more sensitive to the phosphorylation status of eIF4E, such as some genes regulating cell growth and stress response (Gingras et al., 1999; Sonenberg & Gingras, 1998). So in addition to favouring viral protein synthesis, the modulation of eIF4E by NS5A may contribute to regulation of host cell growth and stress response, suggesting a new mechanism of viral pathogenesis.
The most important implication of this study is that HCV encodes nonstructural proteins, possibly NS4B and NS5A, that specifically enhance HCV IRES-directed translation. This is the first indication that an HCV nonstructural protein upregulates the activity of its own IRES, probably in order to facilitate viral protein synthesis and virus replication. Although the underlying molecular mechanism remains basically unclear, it is possible that HCV nonstructural proteins modulate viral IRES activity through interaction with host cell proteins involved in the translation machinery or translational control pathways. It is also possible that different HCV NS proteins may collaborate in this process. It would be interesting to test the effect of different combinations of HCV NS proteins on HCV IRES activity in future studies. (This would be technically challenging if we consider the number of NS proteins involved and the different possible combinations.) Interestingly, it is known that picornavirus leader and 2A proteinases enhance picornavirus IRES activity either indirectly, by cleaving eIF4G, as well as possibly directly, by an unknown mechanism that does not involve eIF4G cleavage (Hambidge & Sarnow, 1992; Macadam et al., 1994; Ventoso & Carrasco, 1995). It seems that these different groups of viruses employ diversified mechanisms to achieve a common goal: to boost viral translation and replication. It is noteworthy that NS5A-1b1 and -1b5, two isolates related to different responses to IFN treatment in patients (Gale et al., 1997), show different abilities to enhance HCV IRES activity. Thus the biological differences between HCV genotypes/isolates, such as IFN-resistance, may be due, in part, to the variations in IRES-dependent translation efficiency, which in turn influence virus replication. Eventually, the biological relevance of our results awaits careful examination in a biologically relevant virus infection system, which is still not available due to technical obstacles.
The IRES is the most conserved part of the HCV genome, and may play multifunctional roles in translation, replication or packaging of the viral genome (Hellen & Sarnow, 2001). Interestingly, the translation initiation process on the HCV IRES has simpler factor requirements than many other translation initiation mechanisms (only the cricket paralysis virus IRES has even simpler factor requirements that the HCV IRES) (Hellen & Pestova, 1999; Wilson et al., 2000), indicating that HCV employs a very unique translation control mechanism, even among the various IRES-utilizing viruses. IRES-mediated translation is not a common feature among cellular mRNAs, and thus may represent a valid and new target for therapeutic intervention in viral mRNA translation (Jubin, 2001), and remains a promising new area for the development of effective antiviral compounds, which mostly has been limited to inhibitors of viral enzymes.
Y. H. and W. Y. contributed equally to this study. We are grateful to Dr Raffaele De Francesco and Dr Petra Neddermann (IRBM) for providing the HCV replicon cells. We thank Dr Richard M. Elliott (University of Glasgow), Dr Nahum Sonenberg (McGill University) and Dr Anne-Catherine Prats (Institut national de la santé et de la recherche médicale), for providing the dual-luciferase reporter constructs containing the HCV IRES, the poliovirus IRES and the EMCV IRES, respectively. We are grateful to Dr Marcus J. Korth for editorial assistance, and Marlene Wambach and Cecilla Boyer for technical and administrative support. This work was supported by grants from the National Institutes of Health (AI-22646, RR-00166, AI-41629, AI-47304 and AI-48214) to M. G. K. and AI-48235 to M. G.Footnotes
†Present address: Antiviral Research, Abbott Laboratories, 200 Abbott Park Road, Abbott Park, 60064 IL, USAReferences
Blight, K. J., Kolykhalov, A. A. & Rice, C. M. (2000). Efficient initiation of HCV RNA replication in cell culture. Science 290, 19721974.
Chung, R. T., He, W., Saquib, A., Contreras, A. M., Xavier, R. J., Chawla, A., Wang, T. C. & Schmidt, E. V. (2001). Hepatitis C virus replication is directly inhibited by IFN-α in a full-length binary expression system. Proc Natl Acad Sci U S A 98, 98479852.
Collier, A. J., Tang, S. & Elliott, R. M. (1998). Translation efficiencies of the 5' untranslated region from representatives of the six major genotypes of hepatitis C virus using a novel bicistronic reporter assay system. J Gen Virol 79, 2359366.[Abstract]
Creancier, L., Mercier, P., Prats, A. C. & Morello, D. (2001). c-myc Internal ribosome entry site activity is developmentally controlled and subjected to a strong translational repression in adult transgenic mice. Mol Cell Biol 21, 18331840.
Frese, M., Pietschmann, T., Moradpour, D., Haller, O. & Bartenschlager, R. (2001). Interferon-α inhibits hepatitis C virus subgenomic RNA replication by an MxA-independent pathway. J Gen Virol 82, 723733.
Gale, M., Jr. & Beard, M. R. (2001). Molecular clones of hepatitis C virus: applications to animal models. ILAR J 42, 139151.[Medline]
Gale, M. J., Korth, M. J., Tang, N. M., Tan, S. L., Hopkins, D. A., Dever, T. E., Polyak, S. J., Gretch, D. R. & Katze, M. G. (1997). Evidence that hepatitis C virus resistance to interferon is mediated through repression of the PKR protein kinase by the nonstructural 5A protein. Virology 230, 217227.[CrossRef][Medline]
Gale, M., Blakely, C. M., Kwieciszewski, B. & 7 other authors (1998). Control of PKR protein kinase by hepatitis C virus nonstructural 5A protein: molecular mechanisms of kinase regulation. Mol Cell Biol 18, 52085218.
Gale, M., Kwieciszewski, B., Dossett, M., Nakao, H. & Katze, M. G. (1999). Antiapoptotic and oncogenic potentials of hepatitis C virus are linked to interferon resistance by viral repression of the PKR protein kinase. J Virol 73, 65066516.
Gale, M., Tan, S. L. & Katze, M. G. (2000). Translational control of viral gene expression in eukaryotes. Microbiol Mol Biol Rev 64, 239280.
Gingras, A. C., Raught, B. & Sonenberg, N. (1999). eIF4 initiation factors: effectors of mRNA recruitment to ribosomes and regulators of translation. Annu Rev Biochem 68, 913963.[CrossRef][Medline]
Hambidge, S. J. & Sarnow, P. (1992). Translational enhancement of the poliovirus 5' noncoding region mediated by virus-encoded polypeptide 2A. Proc Natl Acad Sci U S A 89, 1027210276.
He, Y. & Katze, M. G. (2002). To interfere and to anti-interfere: the interplay between hepatitis C virus and interferon. Viral Immunology 15, 95119.[CrossRef][Medline]
He, Y., Tan, S. L., Tareen, S. U., Vijaysri, S., Langland, J. O., Jacobs,B. L. & Katze, M. G. (2001). Regulation of mRNA translation and cellular signaling by hepatitis C virus nonstructural protein NS5A. J Virol 75, 50905098.
He, Y., Nakao, H., Tan, S. L., Polyak, S. J., Neddermann, P., Vijaysri, S., Jacobs, B. L. & Katze, M. G. (2002). Subversion of host signaling pathways by hepatitis C virus nonstructural 5A protein via interaction with Grb2 and p85 PI3-kinase. J Virol 76, 92079217.
Hellen, C. U. & Pestova, T. V. (1999). Translation of hepatitis C virus RNA. J Viral Hepat 6, 7987.[CrossRef][Medline]
Hellen, C. U. & Sarnow, P. (2001). Internal ribosome entry sites in eukaryotic mRNA molecules. Genes Dev 15, 15931612.
Honda, M., Brown, E. A. & Lemon, S. M. (1996). Stability of a stem-loop involving the initiator AUG controls the efficiency of internal initiation of translation on hepatitis C virus RNA. RNA 2, 955968.[Abstract]
Honda, M., Rijnbrand, R., Abell, G., Kim, D. & Lemon, S. M. (1999). Natural variation in translational activities of the 5' nontranslated RNAs of hepatitis C virus genotypes 1a and 1b: evidence for a long- range RNARNA interaction outside of the internal ribosomal entry site. J Virol 73, 49414951.
Honda, M., Kaneko, S., Matsushita, E., Kobayashi, K., Abell, G. A. & Lemon, S. M. (2000). Cell cycle regulation of hepatitis C virus internal ribosomal entry site-directed translation. Gastroenterology 118, 152162.[CrossRef][Medline]
Hoofnagle, J. H. (1997). Hepatitis C: the clinical spectrum of disease. Hepatology 26, 15S20S.[CrossRef][Medline]
Hoofnagle, J. H. (1999). Management of hepatitis C: current and future perspectives. J Hepatol 31, 264268.
Jubin, R. (2001). Hepatitis C IRES: translating translation into a therapeutic target. Curr Opin Mol Ther 3, 278287.[Medline]
Lohmann, V., Korner, F., Koch, J., Herian, U., Theilmann, L. & Bartenschlager, R. (1999). Replication of subgenomic hepatitis C virus RNAs in a hepatoma cell line. Science 285, 110113.
Maag, D., Castro, C., Hong, Z. & Cameron, C. E. (2001). Hepatitis C virus RNA-dependent RNA polymerase (NS5B) as a mediator of the antiviral activity of ribavirin. J Biol Chem 276, 4609446098.
Macadam, A. J., Ferguson, G., Fleming, T., Stone, D. M., Almond, J. W. & Minor, P. D. (1994). Role for poliovirus protease 2A in cap independent translation. EMBO J 13, 924927.[Medline]
Moradpour, D. & Blum, H. E. (1999). Current and evolving therapies for hepatitis C. Eur J Gastroenterol Hepatol 11, 1199202.[Medline]
Pietschmann, T., Lohmann, V., Rutter, G., Kurpanek, K. & Bartenschlager, R. (2001). Characterization of cell lines carrying self-replicating hepatitis C virus RNAs. J Virol 75, 12521264.
Poulin, F., Gingras, A. C., Olsen, H., Chevalier, S. & Sonenberg, N. (1998). 4E-BP3, a new member of the eukaryotic initiation factor 4E-binding protein family. J Biol Chem 273, 1400214007.
Reed, K. E. & Rice, C. M. (2000). Overview of hepatitis C virus genome structure, polyprotein processing, and protein properties. Curr Top Microbiol Immunol 242, 5584.[Medline]
Reynolds, J. E., Kaminski, A., Kettinen, H. J., Grace, K., Clarke, B. E., Carroll, A. R., Rowlands, D. J. & Jackson, R. J. (1995). Unique features of internal initiation of hepatitis C virus RNA translation. EMBO J 14, 60106020.[Medline]
Rijnbrand, R. C. & Lemon, S. M. (2000). Internal ribosome entry site-mediated translation in hepatitis C virus replication. Curr Top Microbiol Immunol 242, 85116.[Medline]
Rijnbrand, R., Bredenbeek, P., van der Straaten, T., Whetter, L., Inchauspe, G., Lemon, S. & Spaan, W. (1995). Almost the entire 5' non-translated region of hepatitis C virus is required for cap-independent translation. FEBS Lett 365, 115119.[CrossRef][Medline]
Sonenberg, N. & Gingras, A. C. (1998). The mRNA 5' cap-binding protein eIF4E and control of cell growth. Curr Opin Cell Biol 10, 268275.[CrossRef][Medline]
Taylor, D. R., Shi, S. T., Romano, P. R., Barber, G. N. & Lai, M. M. (1999). Inhibition of the interferon-inducible protein kinase PKR by HCV E2 protein. Science 285, 107110.
Thompson, S. R. & Sarnow, P. (2000). Regulation of host cell translation by viruses and effects on cell function. Curr Opin Microbiol 3, 366370.[CrossRef][Medline]
Tomei, L., Failla, C., Santolini, E., De Francesco, R. & La Monica, N. (1993). NS3 is a serine protease required for processing of hepatitis C virus polyprotein. J Virol 67, 40174026.
Varaklioti, A., Vassilaki, N., Georgopoulou, U. & Mavromara, P. (2002). Alternate translation occurs within the core coding region of the hepatitis C viral genome. J Biol Chem 277, 1771317721.
Ventoso, I. & Carrasco, L. (1995). A poliovirus 2Apro mutant unable to cleave 3CD shows inefficient viral protein synthesis and transactivation defects. J Virol 69, 62806288.
Walewski, J. L., Keller, T. R., Stump, D. D. & Branch, A. D. (2001). Evidence for a new hepatitis C virus antigen encoded in an overlapping reading frame. RNA 7, 710721.[Abstract]
Wang, T. H., Rijnbrand, R. C. & Lemon, S. M. (2000). Core protein-coding sequence, but not core protein, modulates the efficiency of cap-independent translation directed by the internal ribosome entry site of hepatitis C virus. J Virol 74, 1134711358.
Wilson, J. E., Pestova, T. V., Hellen, C. U. & Sarnow, P. (2000). Initiation of protein synthesis from the A site of the ribosome. Cell 102, 511520.[CrossRef][Medline]
Xu, Z., Choi, J., Yen, T. S. B., Lu, W., Strohecker, A., Govindarajan, S., Chien, D., Selby, M. J. & Ou, J.-H. (2001). Synthesis of a novel hepatitis C virus protein by ribosomal frameshift. EMBO J 20, 38403848.[CrossRef][Medline]
Zhang, J., Yamada, O., Yoshida, H., Iwai, T. & Araki, H. (2002). Autogenous translational inhibition of core protein: implication for switch from translation to RNA replication in hepatitis C virus. Virology 293, 141150.[CrossRef][Medline]
Received 13 June 2002; accepted 24 November 2002.