Research Article

A polypyrimidine tract facilitates the expression of Kaposi's sarcoma-associated herpesvirus vFLIP through an internal ribosome entry site

Journal of General Virology 2004; 85(3):615 · https://doi.org/10.1099/vir.0.19733-0

View at publisher PubMed

With thanks to our partners for supporting this archive.

Abstract

We have identified a novel internal ribosome entry site (IRES) within a latently expressed Kaposi's sarcoma-associated herpesvirus (KSHV) gene (vCyclin) that controls the expression of a downstream open reading frame encoding an inhibitor of apoptosis (vFLIP). This IRES is the first such element to be identified in a DNA virus and may represent a novel mechanism through which this virus controls gene expression. We have used a dual luciferase reporter assay to identify important sequence elements essential for the activity of the IRES. A sequence of 32 nucleotides incorporating a polypyrimidine tract (PPT) was found to be required for the proper functioning of the IRES. We also show, using an electrophoretic mobility shift assay (EMSA), that proteins specific to a KSHV-infected cell line (BCP-1) but not a KSHV-negative cell line (HEK293) were able to form complexes with the IRES. By using an in vitro RNA binding assay, the cellular polypyrimidine tract binding protein (PTB, hnRNP-I) was found to bind to the IRES RNA. These results suggest that the interaction of PTB with the PPT may contribute to the correct functioning of the KSHV IRES in infected cells.
Kaposi's sarcoma-associated herpesvirus (KSHV), also known as human herpesvirus-8 (HHV-8), is the most recently identified member of the herpesvirus family to infect humans (Chang et al., 1994). KSHV, a gamma-2-herpesvirus, has been proposed as the aetiological agent for Kaposi's sarcoma as well as other malignancies such as primary effusion lymphoma (PEL) (Cesarman et al., 1995) and multicentric Castleman's disease (MCD) (Soulier et al., 1995).

KSHV is closely related to three other herpesviruses with oncogenic potential; herpesvirus saimiri (HVS), murine gammaherpesvirus (MHV-68) and, more distantly, to EpsteinBarr virus (EBV). The complete nucleotide sequence of KSHV DNA has revealed several genes which have probably been captured from the host cell during virus evolution, and whose products could also play a role in cellular transformation and tumour induction (Neipel et al., 1997; Russo et al., 1996). The three genes encoded by open reading frames (ORFs) K13, 72 and 73 [vFLIP (Fas-associated death domain-like IL-1β-converting enzyme-inhibitory protein) vCyclin and LANA] are transcribed from a common transcription start site in cell lines latently infected with KSHV. The resulting transcript is spliced to yield a 5·32 kb message encoding LANA, vCyclin, vFLIP and a 1·7 kb bicistronic message encoding vCyclin and vFLIP (Dittmer et al., 1998; Talbot et al., 1999).

The observation that a bicistronic transcript (Talbot et al., 1999) encodes vCyclin and vFLIP led to the investigation of the mechanism of translation of the vFLIP ORF. We (Bieleski & Talbot, 2001) and others (Grundhoff & Ganem, 2001; Low et al., 2001) were able to identify a novel internal ribosome entry site (IRES) within the latently expressed vCyclin gene that controls the expression of the downstream vFLIP ORF. This IRES is the first such element to be identified in a DNA virus. Recently, an IRES element has been described in the untranslated region of the EpsteinBarr nuclear antigen-1 (EBNA1) gene, which may contribute to the regulation of latent gene expression (Isaksson et al., 2003).

IRES elements were first identified in the 5' untranslated regions (UTR) of picornaviruses and are essential for the cap-independent translation of the viral polyprotein (Jang et al., 1988; Pelletier & Sonenberg, 1988). More recently IRES elements have been characterized in several cellular genes which encode growth factors (FGF-2, VEGF) (Stein et al., 1998; Vagner et al., 1995), proto-oncogenes (c-myc) (Nanbru et al., 1997) and an inhibitor of apoptosis (XIAP) (Holcik & Korneluk, 2000). IRES-dependent translation of these mRNAs may be essential for the survival and proliferation of cells under stressful conditions (Holcik et al., 2000). IRES elements in two cellular mRNAs [encoding ornithine decarboxlyase (Cornelis et al., 2000) and PITSLRE protein kinase (Pyronnet et al., 2000)] have been identified, and are regulated in a cell cycle-dependent manner. These data reveal a novel role for IRES elements in the translational regulation of protein expression during cell cycle progression. The IRES element that we have identified potentially controls the expression of a virus-encoded anti-apoptotic protein, vFLIP (Thome et al., 1997), which is intimately linked to the expression of a cell growth promoting protein, vCyclin (Cesarman et al., 1996; Godden-Kent et al., 1997).

This paper investigates sequence elements within the KSHV IRES essential for efficient translation of the downstream ORF. In addition the cell type-specific activity of the IRES and cell-specific protein factors interacting with the IRES are investigated.

Cells.
The KSHV-positive primary effusion lymphoma (PEL) B-cell line, BCP-1 (Boshoff et al., 1998), was grown in RPMI (Invitrogen) supplemented with 20 % (v/v) fetal calf serum (FCS), 2 mM glutamine, 60 µg penicillin ml-1 and 100 µg streptomycin ml-1. HEK293 cells (Graham et al., 1977) were grown in DMEM (Invitrogen) supplemented with 10 % (v/v) FCS, 2 mM glutamine, 60 µg penicillin ml-1 and 100 streptomycin µg ml-1. Cells were incubated at 37 °C under 4 % CO2.

Plasmids.
The plasmids pdLUC and pdLUC-SL were constructed as described previously (Bieleski & Talbot, 2001). The IRES sequence from encephalomyocarditis virus (EMCV) or fragments of KSHV vCyclin/vFLIP were cloned into the SmaINcoI or XhoINcoI sites of pdLUC (Fig. 1a). The following primers were used to PCR amplify specific IRES sequences:



(23K):

Fig. 1. (a) Schematic diagram of the plasmids pdLUC, showing the coding sequence for the Renilla and firefly luciferase enzymes cloned downstream of a T7 RNA polymerase promoter. (b) RNA sequence of vCyclin IRES. The sequence between the SacII and Eco47III sites (nucleotides 123206122973, Genebank accession no. U75698 (Russo et al., 1996), and positions of restriction sites used in deletion analysis are shown. The 5' ends of oligonucleotides (1, 2, 3 and 4; see Methods) used to PCR-amplify portions of the IRES are also indicated by arrows. The 11 nucleotide sequence complementary to 18S rRNA is shown in bold, and (c) the PPT is underlined and in in bold.

Primer 1: GCATCTCGAGACGGACGTCACTTCCTTCTTG

Primer 2: GCATCTCGAGGCTGGGGGGCTCCCAAC

Primer 3: GCATCCATGGCAACTAAGGCTTTTGTAATCAG

Primer 4: GCATCCATGGAGTCTTTGGGTCAACTAAGGC

Complementary oligonucleotides (TCGAGACGGACGTCACTTCCTTCTTGTTACTTAAATTC and CATGGAATTTAAGTAACAAGAAGGAAGTGACGTCCGTC) were annealed and cloned directly in the XhoINcoI sites of pdLUC and pdLUC-SL to yield the PPT-encoding plasmid.

The KSHV IRES [nucleotides 123206122973, GenBank accession no. U75698 (Russo et al., 1996)] was cloned into the pSP64Poly(A) vector (Promega) for use in the pull-down assay. Primers GTACAAGCTTCCGCGGCAGACTCCTTTTCCC and GTACGAGCTCGCTGATAATAGAGGCGGGCAAT (sense orientation) or GTACGAGCTCCCGCGGCAGACTCCTTTTCCC and GTACAAGCTTGCTGATAATAGAGGCGGGCAAT (antisense orientation) were used to amplify the KSHV IRES by PCR. The DNA was then inserted into the HindIIISacI sites of the vector.

Transfection of cells.
BCP-1 cells (1x105 cells per well), HEK293 (5x104 cells per well) were seeded in 24-well trays and incubated overnight. The cells were infected with vTF7-3 (Fuerst et al., 1986), a recombinant vaccinia virus expressing T7 RNA polymerase, at 5 p.f.u. per cell in 200 µl serum free medium (OptiMEM; Gibco-BRL) for 60 min at 37 °C. The inoculum was removed and the cells washed once with OptiMEM. The cells were then transfected with 0·5 µg of linearized (AflII and NotI) plasmid DNA and 1·5 µl Transfast transfection reagent per well according to the manufacturer's instructions (Promega). After incubation at 37 °C for 60 min, 1 ml of growth medium was added to the wells. The cells were assayed for luciferase activity 24 h later as described below.

Dual luciferase assays.
Transfected cells were washed twice in PBS, and then lysed by addition of 200 µl of passive lysis buffer (PLB, Promega). After incubation for 15 min at room temperature the cell lysates were transferred to Eppendorf tubes and snap-frozen on dry ice. The lysates were then thawed, vortexed for 1 min and the cell debris removed by spinning at 10 000 r.p.m. for 1 min. The activity of Renilla and firefly luciferase was assayed using the dual luciferase system as described by the manufacturer (Promega). Luciferase activities were measured using a Labsystems benchtop luminometer and the ratio of firefly luciferase to Renilla luciferase activity was calculated and used as a measure of IRES function.

Electrophoretic mobility shift assays (EMSAs).
RNA was transcribed in vitro from 0·2 µg of linearized plasmid using T3 RNA polymerase and labelled internally with [α-32P]UTP according to manufacturer's instructions (Life Science). Whole-cell lysate was prepared from BCP-1 or HEK293 cells by sonication for 15 min at 4 °C in binding buffer [20 mM HEPES/KOH pH 7·5, 50 mM KCl, 10 mM MgCl2, 0·01 % (v/v) NP40, 5 % (v/v) glycerol], and the cellular debris was removed by centrifugation at 10 000 g for 5 min. The binding reaction was carried out in binding buffer containing 25 000 c.p.m. of labelled RNA, 6 µg protein, 1 unit RNasin, and 0·05 µg poly(dIdT), in a total volume of 20 µl in the presence or absence of 10-fold excess of unlabelled competitor transcripts. After 15 min incubation at 20 °C, the samples were loaded on a 5 % (w/v) non-denaturing polyacrylamide gel containing 0·5x TBE. The gel was run in 0·5x TBE for 1 h at 30 mA before exposure to x-ray film (Hyperfilm) at -80 °C with an intensifying screen.

Preparation of S10 cell extract.
Cells (1x108) were centrifuged and washed three times with isotonic buffer (35 mM HEPES pH 7·4, 146 mM NaCl, 11 mM glucose), resuspended in 2 vols of hypotonic buffer (20 mM HEPES pH 7·4, 10 mM KCl, 1·5 mM magnesium acetate, 1 mM DTT) and incubated on ice for 10 min. The cells were disrupted with 25 strokes of a Dounce homogenizer (on ice), before addition of 0·1 vols of 10x buffer (0·2 M HEPES pH 7·4, 1·2 M potassium acetate, 40 mM magnesium acetate, 50 mM DTT). The nuclei were removed by centrifugation at 2000 r.p.m. for 10 min at 4 °C, followed by addition of CaCl2 (1 mM) and 75 units of S7 nuclease (Roche) per ml of supernatant. After incubation at 20 °C for 15 min the S7 nuclease was inactivated by adding EGTA to 2 mM. The S10 supernatant was centrifuged at 10 000 r.p.m. at 4 °C for 15 min before freezing in aliquots at -80 °C.

RNAprotein pull-down assays.
Plasmids derived from the pSP64Poly(A) vector were linearized with EcoRI, and then used as templates for transcription reactions. RNA transcripts [containing a 3' poly(A) tail of 30 residues] were produced and purified according to the manufacturer's instructions (Ambion; SP6 megascript). The KSHV vCyclin IRES RNA (sense or antisense) was captured onto oligo(dT) Dynabeads (Dynal, 0·5 ml) as described previously (Stassinopoulos & Belsham, 2001). The immobilized RNA transcripts were then incubated with BCP-1 cell S10 extract at 4 °C for 60 min on a rotating wheel. The magnetic beads were captured and the depleted S10 was removed. The beadsRNAprotein complex was washed twice in binding buffer, resuspended in SDS sample buffer, and incubated at 4 °C for 10 min. These samples were analysed by SDS-PAGE and Western blot analysis. The anti-PTB polyclonal antibody was a gift from R. J. Jackson (University of Cambridge, UK) (Hunt & Jackson, 1999; Mitchell et al., 2001).

A polypyrimidine tract is essential for the activity of the vCyclin IRES
We have described previously a 233 nucleotide sequence within the vCyclin gene of KSHV that efficiently promotes the translation of the downstream vFLIP orf via internal ribosome entry (Bieleski & Talbot, 2001). We noted the presence of two sequence elements within the IRES that could potentially modulate its activity. The first was a pyrimidine-rich sequence and the second an 11 nucleotide sequence complementary to a sequence in 18s rRNA (Fig. 1b). We have used a combination of restriction enzyme-directed deletion and PCR to determine the minimal sequence necessary for the activity of the IRES. These sequences were cloned into the pdLUC plasmid as shown in Fig. 1(a). These plasmids were transfected into the BCP-1 cell line (latently infected with KSHV), which had been infected with vaccinia vTF7-3 (Fuerst et al., 1986) at an m.o.i. of 5. The Renilla luciferase and firefly luciferase activities were measured in cell lysates 24 h post-transfection. The ratio of firefly luciferase to Renilla luciferase activity was calculated and used as a measure of IRES function. As shown in Table 1 we were able to delete the 18S rRNA sequence without significantly affecting IRES function, but deletion of the polypyrimidine tract (PPT) resulted in loss of IRES function. Two of these constructs (Primer 1&4 and 1&3) revealed a higher IRES activity than the other constructs and equivalent to the activity of the EMCV IRES. This may be due to the removal of inhibitory sequences or the presentation of the KSHV IRES in a more favourable structural conformation.


Table 1. Activity of the vCyclin IRES and deletion derivatives in BCP-1 cells


To confirm that the PPT was necessary and sufficient for IRES activity we cloned this sequence alone into the pdLUC plasmid using oligonucleotides encompassing the PPT (Fig. 1c). As seen in Table 1, the PPT alone was able to direct efficient expression of the downstream firefly luciferase. The cap-independent activity of this PPT sequence was confirmed using an equivalent reporter construct that contained an inverted repeat, with the potential to form a stable 28 bp stemloop structure in the 5' UTR immediately upstream from the Renilla luciferase start codon. Translation of the first cistron was efficiently inhibited by the presence of the stable stemloop structure, whereas translation of the second cistron via the PPT sequence within the vCyclin gene was unaffected by the presence of the stemloop (data not shown).

Cell-type specificity of KSHV IRES activity
We noted previously that the IRES activity was high in the PEL cell line BCP-1 (latently infected with KSHV) but that there was little or no activity in the cell lines HEK293, HeLa or KSIMM (Bieleski & Talbot, 2001). This suggests that cell-specific and/or KSHV-specific factors play an important role in the modulation of IRES activity. EMSA is a technique used to study the interaction of proteins with specific nucleic acid targets (DNA or RNA). Radiolabelled RNA encompassing the IRES was produced by in vitro transcription using T7 RNA polymerase mixed with protein (whole-cell lysate) and then electrophoresed through a non-denaturing polyacrylamide gel. Any RNAprotein complexes that are formed run with a slower mobility through the gel in comparison with non-complexed RNA. We have used this system to investigate the possibility of proteins interacting with the KSHV IRES. As shown in Fig. 2, several specific RNAprotein complexes (indicated by *) are formed when in vitro-transcribed IRES RNA is mixed with crude cell lysate from BCP-1 cells but not with cell lysate from HEK293 cells. The specificity of these RNAprotein interactions was confirmed by the fact that excess unlabelled IRES RNA successfully competed out these complexes. These data confirm the presence of specific protein factors present in the KSHV-positive BCP-1 cell line that may be essential for the activity of the IRES.



(56K):

Fig. 2. EMSA showing the formation of complexes between the vCyclin IRES and whole-cell extract from BCP-1 cells, but not with cell extract from HEK293 cells. Approximately 6 µg of protein was mixed with 25 000 c.p.m. of in vitro-transcribed KSHV IRES RNA in the presence or absence of 10-fold excess of unlabelled KSHV IRES RNA. The positions of four RNAprotein complexes are indicated by *.

Specificity of proteins interacting with IRES
We have defined a minimal fragment of vCyclin coding sequence that is able to function as an IRES in our dual luciferase assay. The most striking feature of this sequence is a PPT, 17 nucleotides in length. The presence of a PPT has been noted in several other IRES elements in viruses and cellular mRNAs (Pyronnet et al., 2000). Pyrimidine-rich sequences have been shown to interact with the PTB (hnRNP-I), and this protein is known to affect the function of certain IRES elements (Gosert et al., 2000; Hunt & Jackson, 1999; Mitchell et al., 2001). To test the possibility that PTB may bind to the KSHV IRES, we used an in vitro binding assay (Stassinopoulos & Belsham, 2001). The KSHV IRES (Fig. 1b; SacII and Eco47III) was cloned in both the sense and antisense direction into the plasmid pSP64poly(A) allowing the production of RNA tailed with a 30 nucleotide poly(A) sequence. This RNA was bound to oligo(dT) Dynabeads and the complex incubated with S10 protein extract from BCP-1 cells. Proteins bound to the RNA were analysed by SDS-PAGE and Western blot. As shown in Fig. 3, PTB was found to bind specifically to the KSHV IRES in the sense but not the antisense orientation.



(23K):

Fig. 3. In vitro RNAprotein binding assay showing the interaction of PTB (Hunt & Jackson, 1999; Mitchell et al., 2001) with the vCyclin IRES. Lanes 1 and 2, antisense RNA; lanes 3 and 4, sense RNA; lane 5, BCP-1 S10 input. Lanes 1 and 3, unbound protein; lanes 2 and 4, bound protein eluted from beads. PTB runs as a dimer of approximately 60 kDa.
We have previously reported the presence of an IRES element within the coding region of the vCyclin ORF encoded by KSHV that directs the expression of the vFLIP ORF on a bicistronic message (Bieleski & Talbot, 2001). We determined that the sequence requirements for the correct functioning of the IRES fell within a 233 nucleotide fragment. We noted that there were two potentially interesting sequence motifs within the IRES that might contribute to its efficient functioning. These were an 11 nucleotide sequence complementary to a sequence in 18S rRNA, and a 20 nucleotide PPT. Deletion of the 18S rRNA sequence had no effect on the functioning of the IRES, whereas deletion of the PPT abolished IRES activity in a dual-luciferase reporter assay. To confirm the essential role for the PPT, we tested this sequence (32 nucleotides) in isolation for IRES activity and found that it efficiently directed expression of a downstream ORF on a bicistronic message. The presence of pyrimidine-rich sequences has been noted in several other IRES elements in viruses and cellular mRNAs (Pyronnet et al., 2000).

We have used an EMSA to define IRESprotein complexes within permissive (BCP-1) and non-permissive cells (HEK293). Four distinct IRESprotein complexes were observed with BCP-1 lysate, whereas no distinct species were identified in HEK293 cells. In order to identify potential interacting proteins we used an in vitro binding assay using poly(A)-tailed IRES RNA and oligo(dT) magnetic beads. Proteins interacting with the IRES RNA were enriched from BCP-1 S10 extract and analysed by SDS-PAGE and Western blot. Using this technique we were able to show that the cellular PTB (hnRNP-I) selectively bound to KSHV IRES RNA, but not to the antisense IRES RNA used as a control. Clearly, PTB is not the sole determinant of IRES activity since it is expressed in a wide variety of cell types including HEK293 cells in which the KSHV IRES is non-functional. The potential interaction of PTB with the PPT of the IRES may provide a framework for the binding of further cellular and/or viral factors. We tested whether the expression of PTB in an in vitro transcription/translation system (rabbit reticulocyte lysate) would enhance the activity of the IRES, but found that it had no effect (data not shown). This also supports the idea that multiple protein factors are required for efficient IRES activity.

Some viral IRESs, e.g. the EMCV IRES, do not appear to require proteins other than canonical translation initiation factors for function (Pestova et al., 1996), while others require an additional complex set of factors for activity. Such factors include PTB, which binds specifically to several viral IRESs, although the absolute requirement of viral IRESs for this factor differs. For example, PTB stimulates the initiation of translation by internal ribosome entry from hepatitis C and A virus RNA in vivo (Gosert et al., 2000) and from the human rhinovirus (HRV) and poliovirus IRESs in vitro (Hunt & Jackson, 1999) but is not necessary for the activity of wild-type EMCV (Kaminski & Jackson, 1998). PTB is a cellular protein known to be involved in splicing and branch point selection (Grossman et al., 1998). It has been shown that the IRES element controlling the expression of the cellular gene Apaf-1, involved in the apoptotic cascade, requires both PTB and, upstream of N-ras (unr), two cellular RNA-binding proteins previously identified to be required for rhinovirus IRES activity (Mitchell et al., 2001). This study showed that PTB binding to the Apaf-1 IRES occurred only if unr was present.

We have shown that a PPT is essential for the activity of the KSHV IRES and that PTB interacts with KSHV IRES RNA in vitro. Additional IRES RNAprotein complexes were observed using an EMSA that are yet to be identified. Further investigations will be required to determine other binding and regulatory components necessary for the correct functioning of the KSHV IRES.

We thank R. J. Jackson for providing PTB antisera. This work was supported by an MRC career establishment grant to S. J. T. and a BBSRC studentship to C. H.

References

Bieleski, L. & Talbot, S. J. (2001). Kaposi's sarcoma-associated herpesvirus vCyclin open reading frame contains an internal ribosome entry site. J Virol 75, 18641869.[Abstract/Free Full Text]

Boshoff, C., Gao, S. J., Healy, L. E. & 10 other authors (1998). Establishing a KSHV+ cell line (BCP-1) from peripheral blood and characterizing its growth in Nod/SCID mice. Blood 91, 16711679.[Abstract/Free Full Text]

Cesarman, E., Chang, Y., Moore, P. S., Said, J. W. & Knowles, D. M. (1995). Kaposi's sarcoma-associated herpesvirus-like DNA sequences in AIDS-related body-cavity-based lymphomas. N Engl J Med 332, 11861191.[Abstract/Free Full Text]

Cesarman, E., Nador, R. G., Bai, F., Bohenzky, R. A., Russo, J. J., Moore, P. S., Chang, Y. & Knowles, D. M. (1996). Kaposi's sarcoma-associated herpesvirus contains G protein-coupled receptor and cyclin D homologs which are expressed in Kaposi's sarcoma and malignant lymphoma. J Virol 70, 82188223.[Abstract]

Chang, Y., Cesarman, E., Pessin, M. S., Lee, F., Culpepper, J., Knowles, D. M. & Moore, P. S. (1994). Identification of herpesvirus-like DNA sequences in AIDS-associated Kaposi's sarcoma. Science 266, 18651869.[Abstract/Free Full Text]

Cornelis, S., Bruynooghe, Y., Denecker, G., Van Huffel, S., Tinton, S. & Beyaert, R. (2000). Identification and characterization of a novel cell cycle-regulated internal ribosome entry site. Mol Cell 5, 597605.[CrossRef][Medline]

Dittmer, D., Lagunoff, M., Renne, R., Staskus, K., Haase, A. & Ganem, D. (1998). A cluster of latently expressed genes in Kaposi's sarcoma-associated herpesvirus. J Virol 72, 83098315.[Abstract/Free Full Text]

Fuerst, T. R., Niles, E. G., Studier, F. W. & Moss, B. (1986). Eukaryotic transient-expression system based on recombinant vaccinia virus that synthesizes bacteriophage T7 RNA polymerase. Proc Natl Acad Sci U S A 83, 81228126.[Abstract/Free Full Text]

Godden-Kent, D., Talbot, S. J., Boshoff, C., Chang, Y., Moore, P., Weiss, R. A. & Mittnacht, S. (1997). The cyclin encoded by Kaposi's sarcoma-associated herpesvirus stimulates cdk6 to phosphorylate the retinoblastoma protein and histone H1. J Virol 71, 41934198.[Abstract]

Gosert, R., Chang, K. H., Rijnbrand, R., Yi, M., Sangar, D. V. & Lemon, S. M. (2000). Transient expression of cellular polypyrimidine-tract binding protein stimulates cap-independent translation directed by both picornaviral and flaviviral internal ribosome entry sites in vivo. Mol Cell Biol 20, 15831595.[Abstract/Free Full Text]

Graham, F. L., Smiley, J., Russell, W. C. & Nairn, R. (1977). Characteristics of a human cell line transformed by DNA from human adenovirus type 5. J Gen Virol 36, 5974.[Abstract/Free Full Text]

Grossman, J. S., Meyer, M. I., Wang, Y. C., Mulligan, G. J., Kobayashi, R. & Helfman, D. M. (1998). The use of antibodies to the polypyrimidine tract binding protein (PTB) to analyze the protein components that assemble on alternatively spliced pre-mRNAs that use distant branch points. RNA 4, 613625.[Abstract]

Grundhoff, A. & Ganem, D. (2001). Mechanisms governing expression of the v-FLIP gene of Kaposi's sarcoma-associated herpesvirus. J Virol 75, 18571863.[Abstract/Free Full Text]

Holcik, M. & Korneluk, R. G. (2000). Functional characterization of the X-linked inhibitor of apoptosis (XIAP) internal ribosome entry site element: role of La autoantigen in XIAP translation. Mol Cell Biol 20, 46484657.[Abstract/Free Full Text]

Holcik, M., Sonenberg, N. & Korneluk, R. G. (2000). Internal ribosome initiation of translation and the control of cell death. Trends Genet 16, 469473.[CrossRef][Medline]

Hunt, S. L. & Jackson, R. J. (1999). Polypyrimidine-tract binding protein (PTB) is necessary, but not sufficient, for efficient internal initiation of translation of human rhinovirus-2 RNA. RNA 5, 344359.[Abstract]

Isaksson, A., Berggren, M. & Ricksten, A. (2003). EpsteinBarr virus U leader exon contains an internal ribosome entry site. Oncogene 22, 572581.[CrossRef][Medline]

Jang, S. K., Krausslich, H. G., Nicklin, M. J., Duke, G. M., Palmenberg, A. C. & Wimmer, E. (1988). A segment of the 5' nontranslated region of encephalomyocarditis virus RNA directs internal entry of ribosomes during in vitro translation. J Virol 62, 26362643.[Abstract/Free Full Text]

Kaminski, A. & Jackson, R. J. (1998). The polypyrimidine tract binding protein (PTB) requirement for internal initiation of translation of cardiovirus RNAs is conditional rather than absolute. RNA 4, 626638.[Abstract]

Low, W., Harries, M., Ye, H., Du, M. Q., Boshoff, C. & Collins, M. (2001). Internal ribosome entry site regulates translation of Kaposi's sarcoma-associated herpesvirus FLICE inhibitory protein. J Virol 75, 29382945.[Abstract/Free Full Text]

Mitchell, S. A., Brown, E. C., Coldwell, M. J., Jackson, R. J. & Willis, A. E. (2001). Protein factor requirements of the Apaf-1 internal ribosome entry segment: roles of polypyrimidine tract binding protein and upstream of N-ras. Mol Cell Biol 21, 33643374.[Abstract/Free Full Text]

Nanbru, C., Lafon, I., Audigier, S., Gensac, M. C., Vagner, S., Huez, G. & Prats, A. C. (1997). Alternative translation of the proto-oncogene c-myc by an internal ribosome entry site. J Biol Chem 272, 3206132066.[Abstract/Free Full Text]

Neipel, F., Albrecht, J. C. & Fleckenstein, B. (1997). Cell-homologous genes in the Kaposi's sarcoma-associated rhadinovirus human herpesvirus 8: determinants of its pathogenicity? J Virol 71, 41874192.[Medline]

Pelletier, J. & Sonenberg, N. (1988). Internal initiation of translation of eukaryotic mRNA directed by a sequence derived from poliovirus RNA. Nature 334, 320325.[CrossRef][Medline]

Pestova, T. V., Shatsky, I. N. & Hellen, C. U. (1996). Functional dissection of eukaryotic initiation factor 4F: the 4A subunit and the central domain of the 4G subunit are sufficient to mediate internal entry of 43S preinitiation complexes. Mol Cell Biol 16, 68706878.[Abstract]

Pyronnet, S., Pradayrol, L. & Sonenberg, N. (2000). A cell cycle-dependent internal ribosome entry site. Mol Cell 5, 607616.[CrossRef][Medline]

Russo, J. J., Bohenzky, R. A., Chien, M. C. & 8 other authors (1996). Nucleotide sequence of the Kaposi sarcoma-associated herpesvirus (HHV8). Proc Natl Acad Sci U S A 93, 1486214867.[Abstract/Free Full Text]

Soulier, J., Grollet, L., Oksenhendler, E. & 7 other authors (1995). Kaposi's sarcoma-associated herpesvirus-like DNA sequences in multicentric Castleman's disease. Blood 86, 12761280.[Abstract/Free Full Text]

Stassinopoulos, I. A. & Belsham, G. J. (2001). A novel protein-RNA binding assay: functional interactions of the foot-and-mouth disease virus internal ribosome entry site with cellular proteins. RNA 7, 114122.[Abstract]

Stein, I., Itin, A., Einat, P., Skaliter, R., Grossman, Z. & Keshet, E. (1998). Translation of vascular endothelial growth factor mRNA by internal ribosome entry: implications for translation under hypoxia. Mol Cell Biol 18, 31123119.[Abstract/Free Full Text]

Talbot, S. J., Weiss, R. A., Kellam, P. & Boshoff, C. (1999). Transcriptional analysis of human herpesvirus-8 open reading frames 71, 72, 73, K14, and 74 in a primary effusion lymphoma cell line. Virology 257, 8494.[CrossRef][Medline]

Thome, M., Schneider, P., Hofmann, K. & 11 other authors (1997). Viral FLICE-inhibitory proteins (FLIPs) prevent apoptosis induced by death receptors. Nature 386, 517521.[CrossRef][Medline]

Vagner, S., Gensac, M. C., Maret, A., Bayard, F., Amalric, F., Prats, H. & Prats, A. C. (1995). Alternative translation of human fibroblast growth factor 2 mRNA occurs by internal entry of ribosomes. Mol Cell Biol 15, 3544.[Abstract]

Received 20 October 2003; accepted 5 December 2003.