Research Article

Loss of virus-specific CD4+ T cells with increases in viral loads in the chronic phase after vaccine-based partial control of primary simian immunodeficiency virus replication in macaques

Journal of General Virology 2004; 85(7):1955 · https://doi.org/10.1099/vir.0.79890-0

Download PDF View at publisher PubMed

With thanks to our partners for supporting this archive.

Abstract

Virus-specific cellular immune responses play an important role in the control of immunodeficiency virus replication. However, preclinical trials of vaccines that induce virus-specific cellular immune responses have failed to contain simian immunodeficiency virus (SIV) replication in macaques. A defective provirus DNA vaccine system that efficiently induces virus-specific CD8+ T-cell responses has previously been developed. The vaccinated macaques showed reduced viral loads, but failed to contain SIVmac239 replication. In this study, macaques that showed partial control of SIV replication were followed up to see if or how they lost this control in the chronic phase. Two of them showed increased viral loads about 4 or 8 months after challenge and finally developed AIDS. Analysis of SIV-specific T-cell levels by detection of SIV-specific gamma interferon (IFN-γ) production revealed that these two macaques maintained SIV-specific CD8+ T cells, even after loss of control, but lost SIV-specific CD4+ T cells when plasma viral loads increased. The remaining macaque kept viral loads at low levels and maintained SIV-specific CD4+ T cells, as well as CD8+ T cells, for more than 3 years. Additional analysis using macaques vaccinated with a Gag-expressing Sendai virus vector also found loss of viraemia control, with loss of SIV-specific CD4+ T cells in the chronic phase of SIV infection. Thus, SIV-specific CD4+ T cells that were able to produce IFN-γ in response to SIV antigens were preserved by the vaccine-based partial control of primary SIV replication, but were lost with abrogation of control in the chronic phase.
Cellular immune responses play a critical role in the control of immunodeficiency virus infections (Brander & Walker, 1999; Seder & Hill, 2000). The importance of virus-specific CD8+ T cells, especially cytotoxic T lymphocytes (CTLs), in this control has been indicated in human immunodeficiency virus type 1 (HIV-1)-infected individuals (Borrow et al., 1994; Koup et al., 1994; Ogg et al., 1998) and in macaque AIDS models (Matano et al., 1998; Jin et al., 1999; Schmitz et al., 1999). Therefore, CTL-based vaccine strategies may be promising for the development of AIDS vaccine candidates.

AIDS vaccine strategies have been evaluated in macaque models by using simian immunodeficiency viruses (SIV) or simianhuman immunodeficiency viruses (SHIV) (Nathanson et al., 1999). Macaques infected with a pathogenic SIV strain, SIVmac239 (Kestler et al., 1990), generally show chronic clinical courses in the development of AIDS, whereas infections with a pathogenic SHIV strain, SHIV89.6P (Karlsson et al., 1997), induce acute CD4+ T-cell depletion in a few weeks, leading to the acute onset of AIDS in macaques. Recently, in the latter model, several groups have developed vaccine strategies that induced high levels of virus-specific CTLs, leading to containment of SHIV89.6P replication (Barouch et al., 2000; Amara et al., 2001; Matano et al., 2001; Rose et al., 2001; Shiver et al., 2002). However, it has been suggested that SIV infection models may reflect HIV-1 infections in humans more closely, whereas no preclinical vaccine trials successfully contained SIV replication in rhesus macaques (Feinberg & Moore, 2002; Horton et al., 2002).

We previously developed a DNA vaccine system by using FMSIV (Matano et al., 2000), which is a chimeric SHIV with ecotropic Friend murine leukaemia virus (FMLV) env in place of SHIV env, in combination with the FMLV receptor, mCAT1 (Albritton et al., 1989), which is not normally expressed in primate cells. Vaccination of macaques with both FMSIV proviral DNA and mCAT1 expression plasmid DNA allowed mCAT1-dependent FMSIV replication and efficiently induced SIV-specific CD8+ T-cell responses (Matano et al., 2000; Takeda et al., 2000). After intravenous SIVmac239 challenge, the vaccinated macaques showed low plasma viral loads during the early phase of infection, although they failed to contain SIV replication.

Further, we established a Sendai virus (SeV) vector-based vaccine system that efficiently induced virus-specific CD8+ T-cell responses (Kano et al., 2002). Intranasal immunization of macaques with a recombinant SeV vector expressing SIV Gag (SeVGag) elicited Gag-specific CD8+ T-cell responses, leading to marked reduction in set point plasma viral loads after intravenous SIVmac239 challenge (Kano et al., 2000).

This study is a longitudinal analysis of those vaccinated macaques that showed partial control of primary SIVmac239 replication after challenge. Analysis revealed that some of them failed to keep plasma viral loads at low levels. Analysis of SIV-specific T-cell levels by detection of SIV-specific gamma interferon (IFN-γ) production revealed that the increases in viral loads in the chronic phase were accompanied by loss of SIV-specific CD4+ T cells, but occurred in the presence of SIV-specific CD8+ T cells.

DNA and SeV vectors.
DNA of an infectious SHIV clone, SHIVMD14YE (Shibata et al., 1997), was provided by M. A. Martin. The gene fragment encoding the Env surface protein of SHIVMD14YE was removed and replaced with an FMLV env fragment (Koch et al., 1983) to obtain infectious FMSIV clone DNA, as described previously (Matano et al., 2000). The 3' portion of the env gene and the 5' quarter of the nef gene were deleted in the FMSIV DNA. Therefore, the FMSIV DNA has SIV-derived long terminal repeat, gag, pol, vif, vpx and partial vpr sequences, HIV-1-derived partial vpr, tat, rev and partial env (containing the second exon of tat, the second exon of rev, and RRE) sequences and FMLV-derived env sequences. A plasmid expressing mCAT1, pJET (Albritton et al., 1989), was provided by J. M. Cunningham. An env- and nef-deleted SHIV proviral DNA, SIVGP1 DNA, was obtained by removing the whole FMLV env region from the FMSIV DNA (Matano et al., 2001). An infectious SIVmac239 clone DNA, pBRmac239, was provided by T. Kodama and R. C. Desrosiers (Kestler et al., 1990). The plasmid pVSV-G, which expresses vesicular stomatitis virus G protein (VSV-G), was purchased from Clontech. A recombinant SeV vector expressing SIV Gag (SeVGag) was prepared as described previously (Kato et al., 1996; Kano et al., 2002).

Animal experiments.
All Indian rhesus macaques (Macaca mulatta) and cynomolgus macaques (Macaca fascicularis) used in this study were male and were maintained in accordance with the Guidelines for Laboratory Animals of the National Institute of Infectious Diseases. These macaques tested negative for SeV and SIV before use. Blood collection, lymph node (LN) biopsy, vaccination and virus challenge were performed under ketamine anaesthesia. The DNA vaccine experiment using rhesus macaques was performed as described previously (Matano et al., 2000). Rhesus macaques #20, #21 and #18 received FMSIV DNA and pJET (100 or 200 µg of each DNA intramuscularly and 5 or 10 µg of each DNA by gene gun) five times at weeks 0, 1, 2, 6 and 12 after the initial vaccination. Rhesus macaque #17 received 200 µg FMSIV DNA intramuscularly and 10 µg FMSIV DNA by gene gun five times at weeks 0, 1, 2, 6 and 12 as a control. Rhesus macaque #22 was a naive control. These macaques were challenged intravenously with 100 TCID50 (50 percent tissue culture infective dose) of SIVmac239 12 weeks after the last vaccination. Macaque #21 was observed until week 218 after challenge and other rhesus macaques were observed until their death. The SeVGag vaccine experiment using cynomolgus macaques was performed as described previously (Kano et al., 2000). Cynomolgus macaques Cy01 and Cy62 were immunized intranasally with 108 cell infectious units (CIU) of SeVGag three times at weeks 0, 4 and 14 after the initial vaccination and challenged intravenously with 100 TCID50 of SIVmac239 8 weeks after the last vaccination. These macaques were observed until week 60. Diagnosis of AIDS was based on clinical signs, such as diarrhoea and loss of body weight, and histological signs, such as lymphocyte depletion and lymphoma.

Quantification of plasma viral loads.
Plasma RNA was extracted by using a High Pure Viral RNA kit (Roche). For quantification of plasma SIV RNA levels, serial five-fold dilutions of RNA samples were amplified in quadruplicate by reverse transcription and nested PCR using SIV gag-specific primers to determine the end point as described previously (Shibata et al., 1997). For preparing the RNA standard, we first set up the method for quantification of SHIV RNA copy number by using HIV-1 vpu-specific primers and an HIV-1 standard, which was quantified by an Amplicor HIV-1 monitor (Roche). By using this method, we prepared an SHIV standard for the present assay. At several time-points, RNA copy number was reassessed by real-time PCR using the LightCycler system (Roche) with SIV gag-specific primers (GTAGTATGGGCAGCAAATGA and TGTTCCTGTTTCCACCACTA) and probes (GCATTCACGCAGAAGAGAAAGTGAAACA and ACTGAGGAAGCAAAACAGATAGTGCAGAGA).

Flow cytometric analysis of SIV-specific IFN-γ induction.
We measured frequencies of SIV-specific T cells by flow cytometric analysis of intracellular IFN-γ induction after SIV-specific stimulation, as described previously (Matano et al., 2001). In brief, COS-1 cells were cotransfected with SIVGP1 and pVSV-G to obtain a pseudotyped SIV bearing VSV-G, SIVGP1(VSV-G). Alternatively, another pseudotyped SIV, SIV239(VSV-G), was obtained by cotransfection of COS-1 cells with pBRmac239 and pVSV-G. Peripheral blood mononuclear cells (PBMCs) were prepared by density-gradient centrifugation using Ficoll-Paque PLUS (Amersham Biosciences) and frozen until use. For SIV-specific stimulation, PBMCs were co-cultured with autologous herpesvirus papio-immortalized B lymphoblastoid cells (BLCs) (Voss et al., 1992) that were infected with SIVGP1(VSV-G) or SIV239(VSV-G). Stimulation with SIVGP1(VSV-G)-infected BLCs was expected to stimulate SIV Gag-, Pol-, Vif- and Vpx-specific T cells and is referred to as Env-independent SIV-specific or SIVGagPol-specific stimulation. On the other hand, stimulation with SIV239(VSV-G) was expected to stimulate all T cells that were reactive to SIV antigens and is referred to as SIVGagPolEnv-specific stimulation. For non-specific stimulation, a VSV-G-pseudotyped murine leukaemia virus (MLV), MLVGP(VSV-G), was used instead of SIVGP1(VSV-G) or SIV239(VSV-G). After co-culture in the presence of GolgiStop (monensin) (Becton Dickinson) for 6 h, intracellular IFN-γ staining was performed by using a CytofixCytoperm kit (Becton Dickinson). FITC-conjugated anti-human CD4, peridinin chlorophyll protein-conjugated anti-human CD8, allophycocyanin-conjugated anti-human CD3, FITC-conjugated anti-human CD45RA and phycoerythrin-conjugated anti-human IFN-γ antibodies (Becton Dickinson) were used. Stained samples were collected by FACSCalibur and analysed by using CellQuest software (Becton Dickinson). SIV-specific T-cell levels were calculated by subtracting the IFN-γ+ T-cell frequencies after non-specific stimulation from those after SIV-specific stimulation. The frequencies of CD4+ IFN-γ+ T cells in CD4+ T cells or those of CD8+ IFN-γ+ T cells in CD8+ T cells after non-specific stimulation were <0·05 %.

Follow-up of DNA-vaccinated macaques after SIV challenge
In our previous study (Matano et al., 2000), two rhesus macaques (#20 and #21) that had been immunized with our DNA vaccine system using FMSIV and mCAT1 DNA were challenged intravenously with SIVmac239; both of them showed reduced plasma viral loads, compared to the control rhesus macaques (#22 and #17) in the early phase of infection. In addition, rhesus macaque #18 was subjected to the same FMSIV and mCAT1 DNA vaccine and SIVmac239 challenge protocol and also showed partial control of primary SIV replication with low plasma viral loads, <2x103 copies ml1, at the set point. We followed up these macaques in the chronic phase of SIV infection in this study.

The unvaccinated macaque, #22, failed to control viraemia after challenge and showed acute onset of AIDS, as described previously (Matano et al., 2000). The animal lost its body weight with severe diarrhoea and maintained high plasma viral loads, >1x106 RNA copies ml1, until its death at week 17. Macaque #17, which was vaccinated with FMSIV DNA alone, also failed to control viraemia, with high set point plasma viral loads of >1x105 RNA copies ml1, as described previously (Matano et al., 2000), and showed disease progression with loss of body weight until euthanasia at week 45 (data not shown). The autopsy revealed malignant lymphoma and Pneumocystis carinii pneumonia.

Three macaques that were vaccinated with FMSIV and mCAT1 DNA showed partial control of primary SIV replication, but two of them lost this control and developed AIDS 2 or 3 years after challenge. In macaque #18 (Fig. 1), plasma viral loads were kept at low levels (<2x103 copies ml1) until week 24 after challenge, but began to increase after that. The animal maintained high viral loads, about 1x106 RNA copies ml1, after week 36, began to lose body weight after week 54 and died at week 81. In macaque #20 (Fig. 2), plasma viral loads were kept at low levels, about 1x104 RNA copies ml1, until week 12, but began to increase after that. Peripheral CD4+ T-cell counts decreased gradually after week 15. The animal remained alive with a high viral load for more than 2 years, but finally developed AIDS and was euthanized at week 136. On the other hand, macaque #21 showed sustained control of SIV replication without disease for more than 3 years (Fig. 3). Plasma viral loads were below or just above the detectable level from week 31 to week 139 and then began to increase gradually, but were still <2x104 RNA copies ml1, even at week 218.



(15K):

Fig. 1. Follow-up of macaque #18 after SIV challenge. (a) Body weight (kg); (b) peripheral CD4+ T-cell count (µl1); (c) plasma viral load (SIV RNA copy number ml1); (d) SIV-specific T-cell level, measured by assessing frequencies of IFN-γ producing cells after SIVGagPol-specific stimulation. Proportions of SIVGagPol-specific CD4+ T-cell number in the total CD4+ T-cell number () and of SIVGagPol-specific CD8+ T-cell number in the total CD8+ T-cell number () are shown.


(17K):

Fig. 2. Follow-up of macaque #20 after SIV challenge. Legend as for Fig. 1.


(20K):

Fig. 3. Follow-up of macaque #21 after SIV challenge.Legend as for Fig. 1.

SIV-specific T-cell levels in DNA-vaccinated macaques after SIV challenge
The FMSIV DNA used in the vaccine has SIVmac239 Gag-, Pol-, Vif- and Vpx-coding regions. To detect T cells that were specific for the FMSIV-derived SIV antigens, we previously developed the SIVGagPol-specific stimulation method (see Methods). We measured SIV-specific T-cell levels by using this method in the present study. In addition, we examined IFN-γ induction after SIVGagPolEnv-specific stimulation (see Methods) at several time-points to detect all T cells that were reactive to SIV antigens, including Env.

We first examined SIV-specific T-cell levels at week 12 after challenge in both control macaques that failed to control viraemia (data not shown). SIV-specific CD8+ T cells were undetectable in macaque #22, but were detected in macaque #17. However, SIV-specific CD4+ T cells were undetectable in both macaques.

In contrast, SIV-specific CD4+ T cells, as well as CD8+ T cells, were detected in the early phase in all three vaccinated macaques, which showed low set point viral loads. In macaque #18, SIV-specific CD4+ T cells and CD8+ T cells were detected at week 5 and their levels increased at week 12. Levels of both were maintained at week 24, when the animal still kept viral loads at low levels, but SIV-specific CD4+ T cells were lost suddenly at week 36, when plasma viral loads increased (Fig. 1). In contrast, SIV-specific CD8+ T cells were maintained after that until death.

In macaque #20, SIV-specific CD4+ T cells and CD8+ T cells were both maintained until week 12, but SIV-specific CD4+ T cells were lost at week 18, when plasma viral loads increased to >1x105 RNA copies ml1 (Fig. 2). In contrast, SIV-specific CD8+ T cells were maintained after that and their levels increased until death. Not only SIVGagPol-specific CD4+ T cells, but also SIVGagPolEnv-specific CD4+ T cells were undetectable after loss of the partial control in macaques #18 and #20 (#18, at weeks 42 and 77; #20, at weeks 32, 62 and 90).

In macaque #21, which showed sustained control, SIV-specific CD4+ T cells, as well as CD8+ T cells, were detected in the early phase and were maintained for more than 3 years (Fig. 3). After this time, the animal showed gradual increases in plasma viral loads and decreases in SIV-specific CD4+ T-cell levels. However, these cells were still detectable at week 218.

Specific CD8+ T cells with IFN-γ-producing function can be divided into CD45RAand CD45RA+ subpopulations; the latter has been suggested to be more differentiated (Hamann et al., 1997; Sallusto et al., 1999). We examined whether the CD45RA+ subpopulation in SIV-specific CD8+ T cells was maintained in macaques #20 and #21 (Fig. 4). In macaque #21, about 30 % of SIV-specific CD8+ T cells were CD45RA+ at week 12 and this proportion was almost constant, even in the late phase, indicating maintenance of SIV-specific CD8+ CD45RA+ T cells. Macaque #20 showed a higher percentage of the CD45RA+ subpopulation in SIV-specific CD8+ T cells, compared to macaque #21, at week 12. The fraction decreased, but was still >30 % at week 39. Although levels of SIV-specific CD8+ T cells in this animal were increasing, most of them were CD45RA after that. We further examined levels in the inguinal LN at week 133, but found no significant difference between PBMCs and the LN. These results show loss of the CD45RA+ subpopulation in SIV-specific CD8+ T cells after increases in viral loads in macaque #20.



(27K):

Fig. 4. Dot plots showing CD45RA+ and CD45RA subpopulations in SIV-specific CD8+ T cells in macaques #20 and #21. PBMCs at indicated time-points were subjected to intracellular IFN-γ staining after SIVGagPol-specific stimulation. Gating was performed on the CD3+ CD8+ lymphocyte subpopulation. The proportion of the CD45RA+ IFN-γ+ cell number in the IFN-γ+ cell number in each dot plot is shown.

SIV-specific T-cell levels in SeVGag-vaccinated macaques in the chronic phase of SIV infection
We also examined SIV-specific T-cell levels in the chronic phase of SIVmac239 infection in SeVGag-vaccinated cynomolgus macaques. Two, Cy01 and Cy62, received intranasal SeVGag vaccinations and then were challenged intravenously with SIVmac239. These two macaques showed greatly reduced set point plasma viral loads (Fig. 5). However, one of them (Cy01) lost control of viraemia at week 30 post-challenge and showed decreases in peripheral CD4+ T cells after that. In this animal, SIV-specific CD4+ T cells were undetectable, whereas high levels of SIV-specific CD8+ T cells were observed at week 49. In contrast, we found significant levels of SIV-specific CD4+ T cells, as well as CD8+ T cells, at week 45 in macaque Cy62. Again, SIV-specific CD4+ T cells were maintained in the macaque that kept control of viraemia, but were undetectable in the one that lost this control.



(18K):

Fig. 5. Follow-up of SeVGag-vaccinated macaques, Cy01 () and Cy62 (), after SIV challenge. (a) Peripheral CD4+ T-cell counts (µl1); (b) plasma virus loads (SIV RNA copy number ml1); (c) dot plots showing SIV-specific CD4+ T cells and CD8+ T cells in PBMCs that were subjected to intracellular IFN-γ staining after SIVGagPol-specific stimulation. Gating was performed on the CD3+ CD4+ (left panels) or CD3+ CD8+ (right panels) lymphocyte subpopulations. The proportion of the IFN-γ+ cell number in the gated cell number in each dot plot is shown.
In our previous studies (Kano et al., 2000; Matano et al., 2000), macaques immunized with FMSIV plus mCAT1 DNA or SeVGag showed high levels of virus-specific CD8+ T cells, leading to reductions in plasma viral loads during the early phase of SIVmac239 infections. In the present follow-up study of these macaques, some of them failed to keep control of SIV replication and showed increased viral loads in the presence of SIV-specific CD8+ T cells. These results indicate that, in macaques with high viral loads, these cells were not able to contain SIV replication.

Recent reports suggested functional impairment of virus-specific CD8+ T cells during the chronic phase of immunodeficiency virus infections (Appay et al., 2000; Champagne et al., 2001; Kostense et al., 2001; Vogel et al., 2001; Migueles et al., 2002). The SIV-specific CD8+ T cells observed in this study were able to produce IFN-γ in response to SIV antigens. We then examined a differentiation marker, CD45RA, in virus-specific CD8+ T cells. The macaque that showed sustained control (#21) maintained the CD45RA+ subpopulation of SIV-specific CD8+ T cells, even in the late phase. In contrast, macaque #20 lost SIV-specific CD8+ CD45RA+ T cells 1 year after infection. This may be a consequence of increases in viral loads, but could promote the increases if it is related to functional impairment of SIV-specific CD8+ T cells. Regarding killing function, we performed a 51Cr-release assay as described previously (Matano et al., 2000) and Gag-specific killing activities in PBMCs that were subjected to 1 week Gag-specific stimulation were detected in macaque #20, as well as #21, at week 129 (data not shown), indicating that these SIV-specific CD8+ T cells were able to kill the target cells, at least after ex vivo stimulation.

It has been indicated that virus-specific CD4+ T cells, as well as CD8+ T cells, play an important role in the control of immunodeficiency virus infections (Matloubian et al., 1994; Rosenberg et al., 1997; Altfeld & Rosenberg, 2000). Recent studies have reported that HIV-1-infected patients with viraemia frequently retain HIV-1-specific CD4+ T cells that are able to produce IFN-γ, but do not have those that are able to proliferate and produce interleukin-2 (IL2) in response to HIV-1 antigens (Iyasere et al., 2003; Harari et al., 2004). The studies suggested that the HIV-1-specific CD4+ T-cell subpopulation that is able to produce IFN-γ in HIV-1-infected patients with viraemia may not contribute to proliferative responses for CD4+ T-cell helper function. On the other hand, macaques that failed to keep control of SIV replication in this study lost SIV-specific CD4+ T cells that were able to produce IFN-γ in response to SIV antigens when they lost this control. It is possible that the SIV-specific CD4+ T-cell subpopulation that is able to produce IFN-γ in vaccinated macaques may have had some function in supporting the control of SIV replication. It remains to be determined how it was lost in this study, but loss of the SIV-specific CD4+ T-cell subpopulation that is able to produce IFN-γ and loss of that that is able to proliferate and produce IL2 would have different effects on disease progression. Understanding of the function of each SIV-specific CD4+ T-cell subpopulation and the effect of its loss may provide insights into the pathogenesis of immunodeficiency virus infections.

We thank J. M. Cunningham for providing pJET DNA, M. A. Martin for providing SHIVMD14YE DNA, T. Kodama and R. C. Desrosiers for providing SIVmac239 DNA, F. Ono, K. Komatsuzaki, K. Oto, R. Mukai, A. Yamada and K. Terao for assistance in the animal experiments and Y. Ami, A. Kato, A. Kojima, T. Takemori and N. Yamamoto for their help. W.-H. L. is a postdoctoral STA fellow supported by the Japan Science and Technology Corporation (JST) and the Japan Society for the Promotion of Sciences (JSPS). This work was supported by Health Sciences Research grants from the Ministry of Health, Labor and Welfare, by grants from the Human Sciences Foundation and by a grant from the Ministry of Education and Science in Japan.

References

Albritton, L. M., Tseng, L., Scadden, D. & Cunningham, J. M. (1989). A putative murine ecotropic retrovirus receptor gene encodes a multiple membrane-spanning protein and confers susceptibility to virus infection. Cell 57, 659666.[CrossRef][Medline]

Altfeld, M. & Rosenberg, E. S. (2000). The role of CD4+ T helper cells in the cytotoxic T lymphocyte response to HIV-1. Curr Opin Immunol 12, 375380.[CrossRef][Medline]

Amara, R. R., Villinger, F., Altman, J. D. & 19 other authors (2001). Control of a mucosal challenge and prevention of AIDS in rhesus macaques by a multiprotein DNA/MVA vaccine. Science 292, 6974.[Abstract/Free Full Text]

Appay, V., Nixon, D. F., Donahoe, S. M. & 13 other authors (2000). HIV-specific CD8+ T cells produce antiviral cytokines but are impaired in cytolytic function. J Exp Med 192, 6376.[Abstract/Free Full Text]

Barouch, D. H., Santra, S., Schmitz, J. E. & 26 other authors (2000). Control of viremia and prevention of clinical AIDS in rhesus monkeys by cytokine-augmented DNA vaccination. Science 290, 486492.[Abstract/Free Full Text]

Borrow, P., Lewicki, H., Hahn, B. H., Shaw, G. M. & Oldstone, M. B. A. (1994). Virus-specific CD8+ cytotoxic T-lymphocyte activity associated with control of viremia in primary human immunodeficiency virus type 1 infection. J Virol 68, 61036110.[Abstract/Free Full Text]

Brander, C. & Walker, B. D. (1999). T lymphocyte responses in HIV-1 infection: implications for vaccine development. Curr Opin Immunol 11, 451459.[CrossRef][Medline]

Champagne, P., Ogg, G. S., King, A. S. & 12 other authors (2001). Skewed maturation of memory HIV-specific CD8 T lymphocytes. Nature 410, 106111.[CrossRef][Medline]

Feinberg, M. B. & Moore, J. P. (2002). AIDS vaccine models: challenging challenge viruses. Nat Med 8, 207210.[CrossRef][Medline]

Hamann, D., Baars, P. A., Rep, M. H. G., Hooibrink, B., Kerkhof-Garde, S. R., Klein, M. R. & van Lier, R. A. W. (1997). Phenotypic and functional separation of memory and effector human CD8+ T cells. J Exp Med 186, 14071418.[Abstract/Free Full Text]

Harari, A., Petitpierre, S., Vallelian, F. & Pantaleo, G. (2004). Skewed representation of functionally distinct populations of virus-specific CD4 T cells in HIV-1-infected subjects with progressive disease: changes after antiretroviral therapy. Blood 103, 966972.[Abstract/Free Full Text]

Horton, H., Vogel, T. U., Carter, D. K. & 15 other authors (2002). Immunization of rhesus macaques with a DNA prime/modified vaccinia virus Ankara boost regimen induces broad simian immunodeficiency virus (SIV)-specific T-cell responses and reduces initial viral replication but does not prevent disease progression following challenge with pathogenic SIVmac239. J Virol 76, 71877202.[Abstract/Free Full Text]

Iyasere, C., Tilton, J. C., Johnson, A. J. & 13 other authors (2003). Diminished proliferation of human immunodeficiency virus-specific CD4+ T cells is associated with diminished interleukin-2 (IL-2) production and is recovered by exogenous IL-2. J Virol 77, 1090010909.[Abstract/Free Full Text]

Jin, X., Bauer, D. E., Tuttleton, S. E. & 11 other authors (1999). Dramatic rise in plasma viremia after CD8+ T cell depletion in simian immunodeficiency virus-infected macaques. J Exp Med 189, 991998.[Abstract/Free Full Text]

Kano, M., Matano, T., Nakamura, H., Takeda, A., Kato, A., Ariyoshi, K., Mori, K., Sata, T. & Nagai, Y. (2000). Elicitation of protective immunity against simian immunodeficiency virus infection by a recombinant Sendai virus expressing the Gag protein. AIDS 14, 12811282.[CrossRef][Medline]

Kano, M., Matano, T., Kato, A., Nakamura, H., Takeda, A., Suzaki, Y., Ami, Y., Terao, K. & Nagai, Y. (2002). Primary replication of a recombinant Sendai virus vector in macaques. J Gen Virol 83, 13771386.[Abstract/Free Full Text]

Karlsson, G. B., Halloran, M., Li, J. & 7 other authors (1997). Characterization of molecularly cloned simian-human immunodeficiency viruses causing rapid CD4+ lymphocyte depletion in rhesus monkeys. J Virol 71, 42184225.[Abstract]

Kato, A., Sakai, Y., Shioda, T., Kondo, T., Nakanishi, M. & Nagai, Y. (1996). Initiation of Sendai virus multiplication from transfected cDNA or RNA with negative or positive sense. Genes Cells 1, 569579.[Abstract]

Kestler, H., Kodama, T., Ringler, D. & 8 other authors (1990). Induction of AIDS in rhesus monkeys by molecularly cloned simian immunodeficiency virus. Science 248, 11091112.[Abstract/Free Full Text]

Koch, W., Hunsmann, G. & Friedrich, R. (1983). Nucleotide sequence of the envelope gene of Friend murine leukemia virus. J Virol 45, 19.[Abstract/Free Full Text]

Kostense, S., Ogg, G. S., Manting, E. H. & 8 other authors (2001). High viral burden in the presence of major HIV-specific CD8+ T cell expansions: evidence for impaired CTL effector function. Eur J Immunol 31, 677686.[CrossRef][Medline]

Koup, R. A., Safrit, J. T., Cao, Y., Andrews, C. A., McLeod, G., Borkowsky, W., Farthing, C. & Ho, D. D. (1994). Temporal association of cellular immune responses with the initial control of viremia in primary human immunodeficiency virus type 1 syndrome. J Virol 68, 46504655.[Abstract/Free Full Text]

Matano, T., Shibata, R., Siemon, C., Connors, M., Lane, H. C. & Martin, M. A. (1998). Administration of an anti-CD8 monoclonal antibody interferes with the clearance of chimeric simian/human immunodeficiency virus during primary infections of rhesus macaques. J Virol 72, 164169.[Abstract/Free Full Text]

Matano, T., Kano, M., Odawara, T., Nakamura, H., Takeda, A., Mori, K., Sato, T. & Nagai, Y. (2000). Induction of protective immunity against pathogenic simian immunodeficiency virus by a foreign receptor-dependent replication of an engineered avirulent virus. Vaccine 18, 33103318.[CrossRef][Medline]

Matano, T., Kano, M., Nakamura, H., Takeda, A. & Nagai, Y. (2001). Rapid appearance of secondary immune responses and protection from acute CD4 depletion after a highly pathogenic immunodeficiency virus challenge in macaques vaccinated with a DNA prime/Sendai virus vector boost regimen. J Virol 75, 1189111896.[Abstract/Free Full Text]

Matloubian, M., Concepcion, R. J. & Ahmed, R. (1994). CD4+ T cells are required to sustain CD8+ cytotoxic T-cell responses during chronic viral infection. J Virol 68, 80568063.[Abstract/Free Full Text]

Migueles, S. A., Laborico, A. C., Shupert, W. L. & 11 other authors (2002). HIV-specific CD8+ T cell proliferation is coupled to perforin expression and is maintained in nonprogressors. Nat Immunol 3, 10611068.[CrossRef][Medline]

Nathanson, N., Hirsch, V. M. & Mathieson, B. J. (1999). The role of nonhuman primates in the development of an AIDS vaccine. AIDS 13 (suppl. A), S113S120.

Ogg, G. S., Jin, X., Bonhoeffer, S. & 12 other authors (1998). Quantitation of HIV-1-specific cytotoxic T lymphocytes and plasma load of viral RNA. Science 279, 21032106.[Abstract/Free Full Text]

Rose, N. F., Marx, P. A., Luckay, A. & 7 other authors (2001). An effective AIDS vaccine based on live attenuated vesicular stomatitis virus recombinants. Cell 106, 539549.[CrossRef][Medline]

Rosenberg, E. S., Billingsley, J. M., Caliendo, A. M., Boswell, S. L., Sax, P. E., Kalams, S. A. & Walker, B. D. (1997). Vigorous HIV-1-specific CD4+ T cell responses associated with control of viremia. Science 278, 14471450.[Abstract/Free Full Text]

Sallusto, F., Lenig, D., Forster, R., Lipp, M. & Lanzavecchia, A. (1999). Two subsets of memory T lymphocytes with distinct homing potentials and effector functions. Nature 401, 708712.[CrossRef][Medline]

Schmitz, J. E., Kuroda, M. J., Santra, S. & 13 other authors (1999). Control of viremia in simian immunodeficiency virus infection by CD8+ lymphocytes. Science 283, 857860.[Abstract/Free Full Text]

Seder, R. A. & Hill, A. V. S. (2000). Vaccines against intracellular infections requiring cellular immunity. Nature 406, 793798.[CrossRef][Medline]

Shibata, R., Maldarelli, F., Siemon, C., Matano, T., Parta, M., Miller, G., Fredrickson, T. & Martin, M. A. (1997). Infection and pathogenicity of chimeric simian-human immunodeficiency viruses in macaques: determinants of high virus loads and CD4 cell killing. J Infect Dis 176, 362373.[Medline]

Shiver, J. W., Fu, T. M., Chen, L. & 49 other authors (2002). Replication-incompetent adenoviral vaccine vector elicits effective anti-immunodeficiency-virus immunity. Nature 415, 331335.[CrossRef][Medline]

Takeda, A., Nakamura, H. & Matano, T. (2000). Confined replication of a chimeric simian immunodeficiency virus. Jpn J Infect Dis 53, 209211.[Medline]

Vogel, T. U., Allen, T. M., Altman, J. D. & Watkins, D. I. (2001). Functional impairment of simian immunodeficiency virus-specific CD8+ T cells during the chronic phase of infection. J Virol 75, 24582461.[Abstract/Free Full Text]

Voss, G., Nick, S., Stahl-Hennig, C., Ritter, K. & Hunsmann, G. (1992). Generation of macaque B lymphoblastoid cell lines with simian Epstein-Barr-like viruses: transformation procedure, characterization of the cell lines and occurrence of simian foamy virus. J Virol Methods 39, 185195.[CrossRef][Medline]

Received 10 December 2003; accepted 15 March 2004.