Abstract
The GenBank/EMBL/DDBJ accession numbers for the sequences reported in this paper are given in Table 1 (roman type).
Beet necrotic yellow vein virus (BNYVV, Benyvirus) is the causal agent of sugar beet rhizomania (Tamada & Baba, 1973) and is transmitted by zoospores of the soil-borne plasmodiophorid Polymyxa betae [Reviewed by Rush (2003)]. The disease was initially reported in Italy (Canova, 1959) and is now distributed worldwide in most sugar-beet-growing areas. BNYVV contains four genomic messenger-like RNAs with some isolates harbouring a fifth RNA (Tamada et al., 1989). Single-strand conformation polymorphism and restriction fragment length polymorphism analysis have revealed the existence of three major subgroups, the A, B and P types (Kruse et al., 1994; Koenig et al., 1995), which cannot be distinguished serologically. The A type is present in most European countries, Iran, North America, China and Japan, whereas the B type is detected frequently in France and Germany, and in some cases in Sweden, China and Japan (Saito et al., 1996; Miyanishi et al., 1999; Lennefors et al., 2000; Sohi & Maleki, 2004).
RNA-5-containing BNYVV isolates that have been identified in the Pithiviers area of France (Koenig et al., 1997) and in Kazakhstan (Koenig & Lennefors, 2000) have been designated P-type isolates. RNA-5-containing isolates have also been found in the UK (Harju et al., 2002), China (Koenig & Lennefors, 2000) and Japan (Tamada et al., 1996). However, their presence was assessed in only a limited number of samples. Such RNA-5-containing isolates are reported to be more pathogenic than other BNYVV isolates (Tamada et al., 1996; Miyanishi et al., 1999). Moreover, P-type isolates show a higher virus titre when compared to A- or B-type isolates, in particular when infecting resistant cultivars commonly used to avoid significant sugar-yield losses (Tamada et al., 1996; Heijbroek et al., 1999). Due to strong selective pressures exerted by the sugar beet resistance genes Rz1 (Biancardi et al., 2002) and Rz2 (Scholten et al., 1999) and the reduced diversity of the cultivated crops, there is a risk that resistance-breaking variants may emerge and spread [Reviewed by Scholten et al. (1999); Asher et al. (2002)].
In the Pithiviers area of France, in other European countries and in the USA, severe symptoms have been observed since 2001, particularly on cultivars harbouring resistance genes, suggesting either the emergence of new BNYVV variants or possible synergistic effects of mixed infection with other pathogens. Therefore, in 2003, surveys and molecular analyses were started in sugar-beet-growing areas where severe rhizomania was reported, in order to seek correlations between molecular properties and the geographic origin of BNYVV isolates. Evidence for a synergistic effect of RNA-5 upon the RNA-3-encoded p25 protein was reported (Tamada et al., 1996). The RNA-5-encoded p26 protein has been characterized and is a nucleo-cytoplasmic protein that induces necrosis on infected lesions of Chenopodium quinoa and activates transcription in a yeast one-hybrid system (Link et al., 2005; Schmidlin et al., 2005). Furthermore, the p25 nucleo-cytoplasmic shuttle protein (Vetter et al., 2004) is responsible for systemic movement of the virus in sugar beet and in Beta macrocarpa (Koenig et al., 1991; Lauber et al., 1998; Tamada et al., 1999). p25 expression influences the expression of root (Tamada et al., 1999) and leaf symptoms (Jupin et al., 1992). For these reasons, we have focused our variability analyses on RNA-3- and RNA-5-encoded proteins. To characterize further the diversity of the isolates collected, we also analysed the RNA-2-encoded CP protein, as the nature of the amino acid residues 62, 103 and 172 permitted us to distinguish between A-type (T62, S103, L172) and B-type (S62, N103, F172) isolates (Kruse et al., 1994; Koenig et al., 1995).
Identifying sequences which are subjected to negative, neutral or positive selection can help to assess the major constraints exerted on virus evolution (Yang & Bielawski, 2000), such as the vector and/or the host-plant genetic background (Chare & Holmes, 2004; Moury, 2004). Accordingly, sequence variability analysis of 55 RNA-2-encoded CP, 68 RNA-3-encoded p25 and 11 RNA-5-encoded p26 sequences was performed after high-fidelity RT-PCR followed by direct sequencing of the amplicons. Twenty three CP, 12 p25 and 31 p26 sequences collected from databases were added to our analyses. After multiple sequence alignments (MSA), the selective pressure exerted on the three open reading frames (ORFs) was estimated by non-synonymous/synonymous substitution rate ratios (ω). This paper reports large-scale molecular-variability, sequence-diversity and selection-constraint analyses conducted on BNYVV CP, p25 and p26 proteins. Significant sequence variations were found in p25 and p26 sequences that correlate to the isolate origins.
BNYVV sources and virus isolation from contaminated soils.Sugar beet samples were collected worldwide where severe rhizomania occurred (Table 1), on the basis of leaf and root symptoms. In the absence of infected crops, soil samples were obtained to characterize the inhabiting BNYVV variants after natural transmission to the susceptible sugar beet cultivar Roberta. It should be cautioned, however, that the variants thus selected might not represent the total viral population of the infested field. A sampling of infected sugar beets was performed within a larger perimeter (30 km) around Pithiviers to assess the spread of the three types of BNYVV present in this region. When available, the variety of beets collected is indicated (Table 1).
Table 1. Geographical origin of BNYVV isolates and accession numbers of the RNA-2-, RNA-3- and RNA-5-encoded proteins Sequences downloaded from the databases are in italics. Sugar beet cultivar is indicated when available. NA, not available; PA, Pithiviers area; +, presence of the specified RNA; , absence of RNA-5; A, A-type CP; B, B-type CP; P, Pithiviers-type p26 protein; J, Asian-type p26 protein.
Total RNA isolation and multiplex RT-PCR for selection of infected samples.
Total RNA isolation was performed on rootlets or taproots with an RNeasy plant mini-kit (Qiagen). The single-tube RT-PCR multiplex protocol (Ready-to-go RT-PCR Beads, Amersham) was used to detect both infected samples and the presence of RNA-5, as described by Hauser et al. (2000).
High-fidelity RT-PCR and sequencing.
Infected samples were selected and total RNAs were reverse-transcribed. cDNAs were obtained using MMLV Reverse Transcriptase (Promega) and specific reverse primers BN2/R3, BN3/R2 and BN5/R1 complementary to RNA-2, -3 and -5, respectively (see below). Three independent PCR reactions were carried out using either a high-fidelity DNA polymerase (Expand High Fidelity PCR system, Roche) or two distinct PCR reactions using REDTaq DNA polymerase (Sigma) and Hot GoldStar (Eurogentec). Primers encompassing the start and stop codons were as follows (5'3'): BN2/F1, ATGTCGAGTGAAGGTAGATATATG and BN2/R3, ATTGTCCGGGTGGACTGGTTC for RNA-2; BN3/F2, GTTGTTGTGTTTTCTGATCATCATT and BN3/R2, GTGTTGTTGAAATTGTGATAACTC for RNA-3; and BN5/F1, GTTTTTCCGCTCGCACAAGCG and BN5/R1, CGAGCCCGTAAACACCGCATA for RNA-5. Amplicons corresponding to the RNA-2-encoded CP (567 bp), to the RNA-3-encoded p25 (719 bp) and, when present, RNA-5-encoded p26 sequence (885 bp) were purified (QIAquick PCR purification kit, Qiagen) before sequencing with a Hitachi 3100 Genetic Analyser (Applied Biosystems) using a BigDye Terminator Sequencing kit (Applied Biosystems) and the primers described above.
MSA, phylogenetic trees and non-synonymous/synonymous substitution rate ratio estimation.
Within each single-infected sample, six independent sequencing reactions (three forward and three reverse) produced viral RNA consensus sequences using Vector NTI version 7.1 and ContigExpress software (InforMax, USA). Consensus sequences were established by choosing the most-represented nucleotide when polymorphism was detected. The fusion of CP sequences to the p25 sequences permitted us to obtain CPp25 concatemers that were named according to the original isolate supplemented by p26 when RNA-5 was present. Therefore, concatemers had the same size.
The CLUSTALX algorithm using the Kimura correction (Thompson et al., 1997) was used to perform multiple nucleotide and amino acid sequence alignments that allowed construction of phylogenic trees using the FitchMargoliash and least-squares distance method (Felsenstein, 1997) of the PHYLIP 3.63 package (Felsenstein, 2004). The trees were drawn using TreeDyn software (). The branch order significance was estimated by 100 bootstrap replicates. Amino acid sequences were compared to those retrieved from databases, and phylogenic trees were deduced for RNA-2, -3 and -5 and their respective encoded proteins.
To further identify regions submitted to positive selection in the BNYVV-encoded proteins, we employed the PAML version 3.0c package (Yang, 1997; Yang & Bielawski, 2000). Using the codeml program and the tree structures obtained above, we compared evolutionary models which assume that the ω ratio is constant across all the lineages but varies across the codons. Different models were tested, as previously described (Yang, 1997; Yang et al., 2000; Moury et al., 2004). When ω>1 for some codons, the likelihood ratio of the two nested models to be compared (M3 versus M0, M3 versus M1 or M8 versus M7) permits testing of whether the positive selection model fits the data significantly better than the null hypothesis corresponding to neutral and/or deleterious substitutions only (Yang, 1997; Yang et al., 2000). Then, an empirical Bayesian approach was used to infer to which category (neutral, deleterious or advantageous) each amino acid most likely belongs. Codons with posterior probabilities above 90 % were considered significant. The distribution of synonymous and non-synonymous substitution rates along the coding regions (Nei & Gojobori, 1986) was also analysed and visualized by using the SNAP program (Ota & Nei, 1994).
Worldwide molecular variability study of BNYVVOut of 136 beet samples analysed, 103 tested positive for BNYVV sequences using the single-tube RT-PCR beads system. All positive samples were further subjected to three independent RNA-2, RNA-3 and RNA-5 high-fidelity RT-PCR reactions, and nucleotide sequences of the amplicons were determined using reverse and direct primers, and subsequently published in GenBank. Accession numbers are summarized together with the previously published sequences in Table 1, as well as the geographic origin of the BNYVV isolate, when available.
Phylogenetic study of BNYVV CP
The CP sequences (Table 1) gave rise to MSA that revealed only minor amino acid changes and allowed us to assign isolates to either the A type (T62S103L172) or B type (S62N103F172) (Kruse et al., 1994; Miyanishi et al., 1999). The phylogenetic tree reconstructed from the MSA displayed three main groupings: two of them were associated to the A-type (Groups I and II) and one (Group III) to the B-type isolates (Fig. 1). CP sequences within Group I shared 100 % identity, whatever the geographical origin, except for Belgium-AJ634733 (Meunier et al., 2003), which diverged from the others due to a S3I substitution. Some of the isolates in Group I were found associated with RNA-5 (e.g. Japan-AB018622; Fig. 1) but others were not (e.g. France-AY696086; Fig. 1 and Table 1). Similarly, all the CP sequences within Group II were identical, except for France-AF197547, which differed by an L41S substitution. RNA-5 was associated with all Group II isolates (see below). In contrast, Group III was more diverse and included all B-type isolates from Europe and Asia. No RNA-5 was found in the European isolates which clustered in Group IIIa, but RNA-5 was found associated to Asian isolates in Group IIIb (Fig. 1). Finally, the sequence France-X04197 was distinct from Group IIIa and -b (Fig. 1) as a consequence of the N64S substitution (Fig. 1).
|
Phylogenetic study of BNYVV p25
Full-length p25 sequences allowed MSA (not shown) that revealed high variability, in particular within a four-amino-acid sequence (residues 6770, referred to as the tetrad) downstream of the nuclear localization signal (NLS) motif (Vetter et al., 2004) and upstream of the zinc finger motif (Jupin et al., 1992). Eleven different tetrads were found. The phylogenetic tree displayed three main groups (Fig. 2); two of these were associated with the A-type (Group p25-I and -II) and one (Group p25-III) with the B-type isolates.
|
Group p25-I contained mainly A-type isolates. Eight out of 11 observed tetrad motifs were found within this group (Table 1). Only four isolates harbouring a fifth component were detected within this group (F76, France-AF197549; F72, France-AF197545 and Kas2, Kazakhstan-AF197553 with an ALHG tetrad). Within group p25-I, isolate C18-1 (France-AY734499, tetrad AHHG; Fig. 2) was found associated with a B-type CP. Further analysis of the sample led to the detection of the isolate C18-2 (France-AY734500, tetrad AYHR), with an A-type CP identical to the B1 isolate (Belgium-AY734497). This situation corresponded to a mixed infection of A- and B-type isolates with the possible appearance of a recombinant RNA-3-encoded p25 (France-AY734500, tetrad AYHR) found in Group I and not in the Group III cluster.
Group II was separated into two subgroups. Group p25-IIb contained only A-type isolates that expressed p25 with the unique SYHG tetrad motif and a fifth RNA component. Group p25-IIa contained A-type Japanese isolates mostly with AYRV, except for one with an AFHG p25 tetrad motif (O11). Japan-T101, -R83 and -S (Japan-D84412) contained a fifth component (Fig. 2). Japanese isolates S113 and O11 did not contain RNA-5; however, many isolates belonging to the same clusters as O11 and S113 contained RNA-5 (Tetsuo Tamada, personal communication). B-type isolate NM (China-AJ239200, tetrad AYHG) and A-type isolate Japon (Japan-Y696163, tetrad AYHG) were found in the p25-IIa cluster (Fig. 2). As mentioned above and discussed later, these outlier isolates may result from mixed infections, particularly isolate Japon, which came from a soil sample.
The p25-III group was remarkably homogeneous (97·3 % identity) and presented a single tetrad motif (AYHR). A mixed infection with two distinct isolates, one carrying RNA-5, led to the isolation of EP37B-(1) (France-AY734501; Fig. 2 and Table 1), harbouring a fifth RNA and an A-type CP sequence, and of EP37B-(2) (France-AY734502; Fig. 2 and Table 1) clustered in group p25-II. Based on the symptoms reported for the collected beets (not shown) and previous pathogenicity studies (Heijbroek et al., 1999), the most-pathogenic isolates belonged to Groups p25-I and -II, the isolates of which displayed the most variable p25 sequences and RNA composition.
Phylogenetic study of BNYVV p26
In Europe, RNA-5 is restricted to the Pithiviers and Hanches regions of France and a confined location of East Anglia (UK), but in China and Japan, RNA-5 is commonly found (Miyanishi et al., 1999). MSA of most representative p26 sequences have shown two deletions (positions 77 and 227229) that allow the European P-type p26 protein (Koenig & Lennefors, 2000) and the Asian-type p26 protein to be distinguished. The later p26 sequences will be refered to as J type. These data have been added to phylogenetic representations by a symbol code (Figs 1 and 2) and are summarized in Table 1. A phylogenetic tree reconstructed from MSA using 42 sequences revealed the three distinct clusters (Fig. 3) previously observed (Miyanishi et al., 1999). Within Groups JI and JII, only the J-type p26 sequences were detected. We did not retrieve the three small A, B and C clusters previously described (Miyanishi et al., 1999). A large majority of J-type BNYVV isolates harboured an A-type CP, except for two Japanese isolates (S44, AB018612[GenBank] and S12, AB018606[GenBank] ) and two Chinese isolates (CH2, AB018614[GenBank] and CY3, AB018617[GenBank] ).
|
All the European p26 sequences clustered in Group PIII, which was highly conserved over time and space (97·4 % identity). Indeed, 100 % identity was found between isolate F-pith.85 (France-AY734506) and isolate EP39B (France-AY700055), which were collected in 1985 and 2003, respectively, at the same location.
Phylogenetic study of BNYVV CPp25 concatemers
CP and p25 sequences of isolates were concatenated in silico to create artificial sequences that were named according to the isolate identifier (Table 1) preceded by p26 if RNA-5 was present. Such sequences were used to produce a phylogenetic tree (Fig. 4). Using this approach, isolates clustered in four groups: one B-type and three A-type clusters. The B-type isolates all grouped together and harboured a p25 AYHR tetrad sequence while lacking RNA-5 (Fig. 4, Group B-AYHR), with an NM outlier isolate (B-AYHG) as a branch. A-type isolates that contained RNA-5 were clustered in a distinct group (RNA-5+), whereas A-type isolates lacking RNA-5 were clustered into two groups: Group A-VxHG and Group A-AzHG, which contained p25 harbouring either VCHG and VLHG or AzHG (with z corresponding to L, C, H, F or Y), AFHR and AYHR tetrad motifs, respectively.
|
Estimation of synonymous and non-synonymous substitution rates
The two gaps detected in the p26 MSA were removed from the collection of P-type p26 sequences, and when several sequences were identical at the nucleotide level, only one sequence was retained. As a consequence, the analysis of the selective pressure of BNYVV was performed using 21, 39 and 28 sequences for CP, p25 and p26, respectively. The three ORFs showed very different evolutionary patterns. The CP gene (Table 2) was most constrained, with mean ω values varying from 0·12 to 0·15, depending on the PAML model. Models M2, M3 and M8, including free ω values for categories of codons, identified a large proportion (around 80 %) of invariable amino acids and around 20 % of slowly evolving amino acids (ω=0·57), but no codons subjected to positive selection (Table 2, CP).
Table 2. Estimates of parameters and likelihood values for selection models implemented in the CODEML program of the PAML package for the coding regions corresponding to the RNA-2-encoded CP, RNA-3-encoded p25 and RNA5-encoded p26 proteins of BNYVV
The p25 protein (Table 2, p25) showed heterogeneous mean ω values (0·361·10), depending on the model. The models with lower mean ω (M0, M1 and M7) did not fit well with the data when compared with other models. Mean ω values of models M2, M3 and M8 were more homogeneous (0·661·10). Models M2, M3 and M8 revealed the occurrence of strong positive selection on some of the codons (Table 2, p25). Models M2 and M8 identified 1 % of codons with ω of 25·1 and 22·3, respectively. Amino acid sites 68 and 198 of protein p25 belonged to this category of codons with a confidence of P>99 %. Model M3 fitted the data significantly better than the nested model M2 and identified two categories of positively selected codons, 12·5 % of codons with ω=4·7 and 0·5 % of codons with ω=54·7. Thirteen amino acid sites belonged to the ω=4·7 category of positively selected codons with P>90 %, and one amino acid site (position 68) belonged to the ω=54·7 category of positively selected codons with P>99·9 % (Table 2, p25).
The p26 protein (Table 2, p26) showed an intermediate degree of selective pressure, with mean ω values varying from 0·20 to 0·33, depending on the model. Occurrence of codon sites submitted to positive selection was shown for models M3 and M8 (2 % of sites with ω∼5·0). These models fit the data significantly better than nested models which did not include positively selected sites (M0, M1 and M7). Model M2 did not reveal positive selection. However, M2 was rejected when compared with M3 in a likelihood ratio test, which strengthened the significance of positive selection (Table 2, p26). In models M3 and M8, amino acid sites 9, 81 and 143 of p26 had a posterior probability greater than 90 % of belonging to the positive-selection category.
When carrying out phylogenetic analysis of multipartite plant viruses, the first step of molecular characterization consists of a sampling and host-tissue homogenization procedure prior to nucleic acid purification. This step may result in the mixing of two quasi-identical viruses that will then be analysed as artifactual pseudo-recombinant viruses carrying RNA components from both isolates. Conversely, true pseudo-recombinants may be interpreted as a consequence of the mixture of two isolates. We demonstrate such a situation with sample EP37B (Table 1), which was first characterized as an A-type BNYVV containing a fifth RNA and expressing a p25 that harboured an AYHR tetrad sequence. In a second RT-PCR experiment, the isolate was found to contain a p25 with a SYHG tetrad sequence (Fig. 2, AY734501[GenBank] and AY734502[GenBank] ). The same situation was found using soil sample C18 (Table 1). The latter reveals the presence of both A-type and B-type viruses within the same infected plant. In the case of BNYVV, it is not known if two isolates that infect the same plant can co-exist within the same infected cells or tissues, although there is evidence that two closely related cucumbermosaic virus (CMV) isolates or potyvirus populations can exclude one another from infected tissues (Valkonen et al., 2002; Dietrich & Maiss, 2003; Takeshita et al., 2004).BNYVV has a multipartite RNA genome, a limited host range, a single vector species and a worldwide geographical distribution. The main objective of this work was to measure the variability of both a BNYVV structural protein (CP) and two non-structural proteins (p25 and p26) out of a total of eleven viral proteins. Analysis of the 78 sequences of CP from 11 sugar-beet-producing countries (Table 1) was carried out, and no major changes were identified concerning the geographic distribution of the BNYVV A and B types in the major beet-growing areas in comparison with previous studies (Kruse et al., 1994; Koenig et al., 1995; Miyanishi et al., 1999; Suarez et al., 1999; Koenig & Lennefors, 2000). BNYVV isolates collected in naturally infected sugar-beet root systems are always composed of the four full-length RNAs which encode non-structural (RNA-1, 3' half of RNA-2, RNA-3 and -4) and multi-functional structural (5' half of RNA-2) proteins. RNA-5, found frequently in Asia and in some specific locations in Europe, varies in length and sequence according to geographic origin, and encodes a p26 protein that acts in a synergistic fashion with the RNA-3-encoded p25 (Tamada et al., 1996). p26 is a nucleo-cytoplasmic viral protein and its viral expression leads to the production of necrotic symptoms on inoculated leaves of C. quinoa (Link et al., 2005; Schmidlin et al., 2005). Identical properties were found for an Asian type p26 (D. Gilmer, unpublished results).
Comparison of phylogenetic relationships estimated with RNA-2-, -3- and -5-encoded proteins
To better understand relationships among BNYVV isolates, we analysed the phylogenetic distribution of BNYVV CP, p25 and p26. Analysis of CP sequences confirmed the existence of the three groups (namely Groups I, II and III; Fig. 1) previously described (Kruse et al., 1994; Miyanishi et al., 1999). An identical approach with the RNA-3-encoded p25 protein sequence allowed the characterization of the three major clusters p25-I, p25-II and p25-III (Fig. 2). Cluster p25-I contained highly variable p25 variants with an A-type CP sequence, whereas cluster p25-II mainly contained A-type isolates harbouring a fifth component. On the other hand, cluster p25-III contained only B-type isolates that were free of RNA-5. Phylogenetic analysis of p26 supported the existence of the three RNA-5 groups identified previously (Miyanishi et al., 1999), which we have renamed respectively Groups JI, JII and PIII (Fig. 3).
An attempt was made to find a correlation between the origin of CP, the nature of p25 and the presence of p26 by analysis of CPp25 concatenated sequences. Such an approach permitted the characterization of four major groups of BNYVV isolates (Fig. 4), which are summarized in Table 1 (column Type summary), where we present the relationship between RNA-2 (CP, A or B type), RNA-3 (p25, tetrad) and RNA-5 (p26, P or J type). Results are displayed according to the following convention: for example, A-SYHG-P represents isolates with an A-type CP, a SYHG p25 tetrad and a P-type p26. Segregation of this type would suggest that a specific relationship exists between p25 and p26 in the pathogenesis process of the rhizomania disease. This hypothesis is partially supported by the characterization of plants infected by at least two viral strains and the absence of stable pseudo-recombinants (i.e. B-SYHG), in particular within the Pithiviers area of France, where many viral strains are present. Genetic bottlenecks are suggested to occur frequently during the natural life cycle of RNA viruses, where systemic infection (French & Stenger, 2003; Sacristan et al., 2003; Li & Roossinck, 2004) and vector transmission limit sequence variation (Eigen, 1993). The prevalence and the sequence of RNA-5 were roughly the same as previously described. The complete sequence identity over an 18 year period for RNA-5-encoded p26 (France-AY734506, France-AY700055), and the specific association with RNA-3-encoded p25 tetrad SYHG and an A-type CP suggested that the stability of this isolate may be controlled by viral gene products, hosts and/or the vector. In Asia, the viral population differed by the presence of shortened, variable RNA-5-encoded J-type p26 genes.
P25-encoded RNA-3 variability may overcome sugar beet resistance
For the p26 and p25 genes, comparisons of evolutionary models which include codons subjected to positive selection to models without such codons rejected the latter models. Thus, genetic drift models for the evolution of BNYVV (where amino acid changes would not evolve significantly faster than neutrality) were rejected in favour of models including positive, diversifying selection. The analyses of the selective pressure exerted on three ORFs of BNYVV showed contrasting evolutionary patterns. CP was the most constrained, with about 20 % slowly evolving amino acids and no codons subjected to positive selection. This is consistent with the multiple functions of CP in genomic RNA protection, plant systemic movement (Quillet et al., 1989) and vector transmission (Tamada, 1999). The p26 protein exhibited a positive selection probability greater than 90 % at amino acid positions 9, 81 and 143, together with more variable p25 proteins (AYHG/AYRV/AFHG; Table 1). The p25 proteins showed the highest mean ω values, and certain amino acids were subjected to strong positive selection. The relative speed of amino acid replacement was ω=4·7 for 12·5 % of the codons and ω=54·7 for one codon. The latter ω value is the highest detected among plant viruses and is in the range of selective ratios detected during the evolution of animal viruses strongly selected by the immune system, such as Measles virus (Woelk et al., 2002) or foot-and-mouth disease virus (Fares et al., 2001). Such intense positive selection might represent a consequence of the strong selective pressure conferred by resistant sugar beet crops routinely used in the field. Out of the two p25 amino acids that are subjected to high positive selection (68 present in the tetrad motif and 198; Table 2, p25), we observed that residue Ala198 is always present in RNA-5-containing isolates, whereas other isolates possess either a Thr or an Ala residue. This observation argues for possible interactions between the N- and C-terminal parts of the p25 protein.
Relatively stable populations of BNYVV (B-AYHR; Fig. 4 and Table 1) are present in France, Belgium and Germany, whereas USA and Spanish A-type isolates present more variable p25 sequences within the same soils (Table 1 and Fig. 4, Groups A-VxHG and A-AzHG). Interestingly, sugar beet companies in the USA and Spain have reported instances of the breaking of rhizomania resistance that were not linked to RNA-1 and -2 sequence variations or the presence of RNA-5 [Liu et al., 2005; Marc-Richard Molard, Institut Technique de la Betterave (ITB), personal communication]. Only the use of infectious transcripts that reproduce the p25 sequences of such emerging isolates will confirm the implication of p25 in such pathogenicity.
The PAML analysis demonstrates that evolutionary constraints during the viral cycle vary between the CP, p25 and P26 proteins. The relative functions and/or interactions with host and vector factors must be taken into account to explain these variations. B-AYHR- and A-SYHG-P-type isolates show highly conserved CP, p25 and p26 sequences, whereas A-type isolates lacking the fifth component seem to be subject to more sequence variation. A possible functional association between p25 (SYHG) and p26 may explain such stability. Loss of the fifth RNA (and the encoded p26) may have forced the p25 sequence to function on its own. Asian isolates may represent an alternative situation, in which RNA-3 and -5 evolved together, with both genes compensating the sequence/function modulation of the other. This latter situation may therefore explain the variable J-type p26 sequences obtained, together with the three identified p25 motifs (A-AYRV, A-AFHG and A-AYHG; Table 1, Figs 3 and 4). This is still consistent with the hypothesis of Saito et al. (1996), which argues that Japanese A and B types originated from Europe. However, we cannot rule out the existence either of the co-evolution of two distinct isolates (i.e. A-SYHG-P and B-AYHR) or of the evolution of a B-AYHR-type isolate towards an A-SYHG-P isolate with the gain of RNA-5, although the latter appears to be less probable than a loss of RNA-5.
This study has not answered the initial question concerning the origin of emerging isolates that overcome resistance genes. However, p25 variability could reflect the past action of strong selective forces for overcoming resistance genes used to control rhizomania. The breaking of resistance could be the result of the selected RNA-3 mutations observed in our study, including those at amino acids 6770 and 198. Further experiments will be needed to confirm that p25 contributes to the virulence of BNYVV towards sugar beet that contain resistance genes.
This work was supported by the ITB (France), INRA and CNRS. A. S. was supported by Florimond-Desprez (France), D. L. by a Bourse Régionale convention between ITB and Region Alsace. We are grateful to Professor T. Tamada and to S. Chiba for providing R83, T101, S113 and O11 sequences and unpublished data, to Dr K. E. Richards for critical reading of the manuscript, to M.-R. Molard for helpful information on field symptoms, to C. Weber for initiating sequencing work, to M. Alioua and P. Hammann for the entire sequencing work, and to the people involved in the field sampling: P. Houdmon, ITB, Loiret, France; T. Dumont, Florimond-Desprez, Hanches, France; J. Ayala, Asociacion Para La Mejora Del Cultivo De La Remolacha Azucarera (AIMCRA), Valladolid, Spain; H. Rossner, Zuckerforschung Tulln (ZFT), Tulln, Austria; A. Wauters, Institut Royal Belge pour l'Amélioration de la Betterave (IRBAB), Belgium; H. Schneider, Instituut voor Rationele Suikerproduktie (IRS), The Netherlands; Dr J. Petersen and G. Büttner, Institut für Zuckerrübenforschung (IFZ), Göttingen, Germany; Dr H.-Y. Liu, US Department of Agriculture (USDA), Salinas, USA.References
Biancardi, E., Lewellen, R. T., Biaggi, M. D., Erichsen, A. W. & Stevanato, P. (2002). The origin of rhizomania resistance in sugarbeet. Euphytica 127, 383397.[CrossRef]
Canova, A. (1959). On the pathology of sugarbeet. Informatore Fitopatologico 9, 390396.
Chare, E. R. & Holmes, E. C. (2004). Selection pressures in the capsid genes of plant RNA viruses reflect mode of transmission. J Gen Virol 85, 31493157.
Dietrich, C. & Maiss, E. (2003). Fluorescent labelling reveals spatial separation of potyvirus populations in mixed infected Nicotiana benthamiana plants. J Gen Virol 84, 28712876.
Drake, J. W. & Holland, J. (1999). Mutation rates among RNA viruses. Proc Natl Acad Sci U S A 96, 1391013913.
Eigen, M. (1993). Viral quasispecies. Sci Am 269, 4249.[Medline]
Elena, S. F. (2002). Restrictions to RNA virus adaptation: an experimental approach. Antonie Van Leeuwenhoek 81, 135142.[CrossRef][Medline]
Fares, M. A., Moya, A., Escarmis, C., Baranowski, E., Domingo, E. & Barrio, E. (2001). Evidence for positive selection in the capsid protein-coding region of the foot-and-mouth disease virus (FMDV) subjected to experimental passage regimens. Mol Biol Evol 18, 1021.
Felsenstein, J. (1997). An alternating least squares approach to inferring phylogenies from pairwise distances. Syst Biol 46, 101111.[CrossRef][Medline]
Felsenstein, J. (2004). PHYLIP, Phylogeny Inference Package version 3.6, 3.6 edn. Seattle: Department of Genome Sciences, University of Washington.
French, R. & Stenger, D. C. (2003). Evolution of wheat streak mosaic virus: dynamics of population growth within plants may explain limited variation. Annu Rev Phytopathol 41, 199214.[CrossRef][Medline]
Garcia-Arenal, F., Fraile, A. & Malpica, J. M. (2003). Variation and evolution of plant virus populations. Int Microbiol 6, 225232.[CrossRef][Medline]
Harju, V. A., Mumford, R. A., Bockley, A., Boonham, N., Clover, G. R. G., Weekes, R. & Henry, C. M. (2002). Occurence in the United Kingdom of beet necrotic yellow vein virus isolates which contain RNA 5. Plant Pathol 51, 811.[CrossRef]
Hauser, S., Weber, C., Vetter, G., Stevens, M., Beuve, M. & Lemaire, O. (2000). Improved detection and differentiation of poleroviruses infecting beet or rape by multiplex RT-PCR. J Virol Methods 89, 1121.[Medline]
Heijbroek, W., Musters, P. M. S. & Schoone, A. H. L. (1999). Variation in pathenogenicity and multiplication of Beet necrotic yellow vein virus (BNYVV) in relation to the resistance of sugarbeet cultivars. Eur J Plant Pathol 105, 397405.[CrossRef]
Jupin, I., Guilley, H., Richards, K. E. & Jonard, G. (1992). Two proteins encoded by beet necrotic yellow vein virus RNA 3 influence symptom phenotype on leaves. EMBO J 11, 479488.[Medline]
Koenig, R. & Lennefors, B. L. (2000). Molecular analyses of European A, B and P type sources of beet necrotic yellow vein virus and detection of the rare P type in Kazakhstan. Arch Virol 145, 15611570.[Medline]
Koenig, R., Jarausch, W., Li, Y., Commandeur, U., Burgermeister, W., Gehrke, M. & Luddecke, P. (1991). Effect of recombinant beet necrotic yellow vein virus with different RNA compositions on mechanically inoculated sugarbeets. J Gen Virol 72, 22432246.
Koenig, R., Luddecke, P. & Haeberle, A. M. (1995). Detection of beet necrotic yellow vein virus strains, variants and mixed infections by examining single-strand conformation polymorphisms of immunocapture RT-PCR products. J Gen Virol 76, 20512055.
Koenig, R., Haeberle, A. M. & Commandeur, U. (1997). Detection and characterization of a distinct type of beet necrotic yellow vein virus RNA 5 in a sugarbeet growing area in Europe. Arch Virol 142, 14991504.[Medline]
Kruse, M., Koenig, R., Hoffmann, A., Kaufmann, A., Commandeur, U., Solovyev, A. G., Savenkov, I. & Burgermeister, W. (1994). Restriction fragment length polymorphism analysis of reverse transcription-PCR products reveals the existence of two major strain groups of beet necrotic yellow vein virus. J Gen Virol 75, 18351842.
Lauber, E., Guilley, H., Tamada, T., Richards, K. E. & Jonard, G. (1998). Vascular movement of beet necrotic yellow vein virus in Beta macrocarpa is probably dependent on an RNA 3 sequence domain rather than a gene product. J Gen Virol 79, 385393.[Abstract]
Lennefors, B. L., Lindsten, K. & Koenig, R. (2000). First record of A and B type beet necrotic yellow vein virus in sugar beets in Sweden. Eur J Plant Pathol 106, 199201.[CrossRef]
Li, H. & Roossinck, M. J. (2004). Genetic bottlenecks reduce population variation in an experimental RNA virus population. J Virol 78, 1058210587.
Link, D., Schmidlin, L., Schirmer, A., Klein, E., Erhardt, M., Geldreich, A., Lemaire, & Gilmer, D. (2005). Functional characterization of the beet necrotic yellow vein virus RNA-5-encoded p26 protein: evidence for structural pathogenicity determinants. J Gen Virol 86, 21152125.
Liu, H. Y., Sears, J. L. & Lewellen, R. T. (2005). Occurence of resistance-breaking beet necrotic yellow vein virus of sugar beet. Plant Dis 89, 464468.[CrossRef]
Meunier, A., Schmit, J. F., Stas, A., Kutluk, N. & Bragard, C. (2003). Multiplex reverse transcription-PCR for simultaneous detection of beet necrotic yellow vein virus, beet soilborne virus, and beet virus Q and their vector polymyxa betae KESKIN on sugar beet. Appl Environ Microbiol 69, 23562360.
Miyanishi, M., Kusume, T., Saito, M. & Tamada, T. (1999). Evidence for three groups of sequence variants of beet necrotic yellow vein virus RNA 5. Arch Virol 144, 879892.[CrossRef][Medline]
Moury, B. (2004). Differential selection of genes of Cucumber mosaic virus subgroups. Mol Biol Evol 21, 16021611.
Moury, B., Morel, C., Johansen, E., Guilbaud, L., Souche, S., Ayme, V., Caranta, C., Palloix, A. & Jacquemond, M. (2004). Mutations in Potato virus Y genome-linked protein determine virulence toward recessive resistances in Capsicum annuum and Lycopersicon hirsutum. Mol Plant Microbe Interact 17, 322329.[Medline]
Nei, M. & Gojobori, T. (1986). Simple methods for estimating the numbers of synonymous and nonsynonymous nucleotide substitutions. Mol Biol Evol 3, 418426.[Abstract]
Ota, T. & Nei, M. (1994). Variance and covariances of the numbers of synonymous and nonsynonymous substitutions per site. Mol Biol Evol 11, 613619.[Abstract]
Quillet, L., Guilley, H., Jonard, G. & Richards, K. (1989). In vitro synthesis of biologically active beet necrotic yellow vein virus RNA. Virology 172, 293301.[CrossRef][Medline]
Rush, C. M. (2003). Ecology and epidemiology of benyviruses and plasmodiophorid vectors. Annu Rev Phytopathol 41, 567592.[CrossRef][Medline]
Sacristan, S., Malpica, J. M., Fraile, A. & Garcia-Arenal, F. (2003). Estimation of population bottlenecks during systemic movement of tobacco mosaic virus in tobacco plants. J Virol 77, 99069911.
Saito, M., Kiguchi, T., Kusume, T. & Tamada, T. (1996). Complete nucleotide sequence of the Japanese isolate S of beet necrotic yellow vein virus RNA and comparison with European isolates. Arch Virol 141, 21632175.[CrossRef][Medline]
Sanjuan, R., Moya, A. & Elena, S. F. (2004a). The contribution of epistasis to the architecture of fitness in an RNA virus. Proc Natl Acad Sci U S A 101, 1537615379.
Sanjuan, R., Moya, A. & Elena, S. F. (2004b). The distribution of fitness effects caused by single-nucleotide substitutions in an RNA virus. Proc Natl Acad Sci U S A 101, 83968401.
Schmidlin, L., Link, D., Mutterer, J., Guilley, H. & Gilmer, D. (2005). Use of a Beet necrotic yellow vein virus RNA-5-derived replicon as a new tool for gene expression. J Gen Virol 86, 463467.
Scholten, O. E., Bock, T. S. M. D., Klein-Lankhorst, R. M. & Lange, W. (1999). Inheritance of resistance to Beet necrotic yellow vein virus in Beta vulgaris conferred by a second gene for resistance. Theor Appl Genet 99, 740746.[CrossRef]
Sohi, H. & Maleki, M. (2004). Evidence for presence of types A and B of beet necrotic yellow vein virus (BNYVV) in Iran. Virus Genes 29, 353358.[Medline]
Suarez, M. B., Grondona, I., Garcia-Benavides, P., Monte, E. & Garcia-Acha, I. (1999). Characterization of beet necrotic yellow vein furovirus from Spanish sugar beets. Int Microbiol 2, 8792.[Medline]
Takeshita, M., Shigemune, N., Kikuhara, K., Furuya, N. & Takanami, Y. (2004). Spatial analysis for exclusive interactions between subgroups I and II of cucumber mosaic virus in cowpea. Virology 328, 4551.[CrossRef][Medline]
Tamada, T. (1999). Benyviruses. In Encyclopedia of Virology, 2nd edn, pp. 154160. London: Academic Press.
Tamada, T. & Baba, T. (1973). Beet necrotic yellow vein virus from rhizomania-affected sugar beet in Japan. Ann Phytopathol Soc Japan 39, 325332.
Tamada, T., Shirako, Y., Abe, H., Saito, M., Kigushi, T. & Harada, T. (1989). Production and pathogenicity of isolates of beet necrotic yellow vein virus with different numbers of RNA components. J Gen Virol 70, 33993409.
Tamada, T., Kusume, T., Uchino, H., Kigushi, T. & Saito, M. (1996). Evidence that beet necrotic yellow vein virus RNA-5 is involved in symptom development of sugarbeet roots. In Proceedings of the 3rd Symposium of the International Working Group on Plant Viruses with Fungal Vectors, American Society of Sugar Beet Technologists, Denver, 49.
Tamada, T., Uchino, H., Kusume, T. & Saito, M. (1999). RNA 3 deletion mutants of beet necrotic yellow vein virus do not cause rhizomania disease in sugar beets. Phytopathology 89, 10001006.[Medline]
Thompson, J. D., Gibson, T. J., Plewniak, F., Jeanmougin, F. & Higgins, D. G. (1997). The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res 25, 48764882.
Valkonen, J. P., Rajamaki, M. L. & Kekarainen, T. (2002). Mapping of viral genomic regions important in cross-protection between strains of a potyvirus. Mol Plant Microbe Interact 15, 683692.[Medline]
Vetter, G., Hily, J. M., Klein, E., Schmidlin, L., Haas, M., Merkle, T. & Gilmer, D. (2004). Nucleo-cytoplasmic shuttling of the beet necrotic yellow vein virus RNA-3-encoded p25 protein. J Gen Virol 85, 24592469.
Woelk, C. H., Pybus, O. G., Jin, L., Brown, D. W. & Holmes, E. C. (2002). Increased positive selection pressure in persistent (SSPE) versus acute measles virus infections. J Gen Virol 83, 14191430.
Yang, Z. (1997). PAML: a program package for phylogenetic analysis by maximum likelihood. Comput Appl Biosci 13, 555556.
Yang, Z. & Bielawski, (2000). Statistical methods for detecting molecular adaptation. Trends Ecol Evol 15, 496503.[CrossRef][Medline]
Yang, Z., Nielsen, R., Goldman, N. & Krabbe Pedersen, A.-M. (2000). Codon-substitution models for heterogeneous selection pressure at amino-acid sites. Genetics 155, 431449.
Received 6 May 2005; accepted 16 June 2005.