Research Article

Expression of the alternative reading frame protein of Hepatitis C virus induces cytokines involved in hepatic injuries

,

1 FRE 2736 CNRS-bioMérieux, IFR 128 Biosciences Lyon-Gerland, Lyon, France
2 Laboratoire Bioinformatique et RMN Structurales, Institut de Biologie et Chimie des Protéines, UMR 5086 CNRS-UCBL Lyon-I, IFR 128 Biosciences Lyon-Gerland, Lyon, France
3 MRC Virology Unit, Glasgow G11 5JR, UK
4 CNRS-Inserm U544, Institut de Virologie, Strasbourg, France
5 UMR 2714 CNRS-bioMérieux, IFR 128 Biosciences Lyon-Gerland, Lyon, France

Correspondence
Christine Bain
bain{at}transgene.fr

Journal of General Virology 2007; 88(4):1149 · https://doi.org/10.1099/vir.0.82575-0

View at publisher PubMed

With thanks to our partners for supporting this archive.

Abstract

Hepatitis C virus (HCV) Core has been implicated in immune-mediated mechanisms associated with the development of chronic hepatic diseases. Discovery of different alternative reading frame proteins (ARFPs) expressed from the HCV Core coding sequence challenges properties assigned to Core. This study was designed to evaluate the immunomodulatory functions of Core and ARFPs in monocytes, dendritic cells (DCs), macrophages (Mφ) and hepatocytes, cells that are all capable of supporting HCV replication. THP-1 cells, monocyte-derived Mφ and DCs, and Huh7 cells were infected by using adenoviruses (Ad) encoding Core, CE1E2 and a Core sequence modified so that the Core protein is wild type, but no ARFPs are expressed (CΔARFP). THP-1 cells and DCs infected with Ad encoding Core or CE1E2 produced significant levels of interleukin-6 (IL-6), IL-8, MCP-1 and MIP-1β, whereas production of these chemokines with AdCΔARFP was reduced or abolished. Similar effects on IL-8 production were observed in Huh7 cells and on IL-6 and MIP-1β in Mφ. Wild-type Core sequence, but not CΔARFP, could trans-activate the IL-8 promoter and this activation was not associated with activation of p38/p4244MAPK. This study illustrates, for the first time, the critical importance of ARFP expression in immunomodulatory functions attributed to Core expression and suggests a potential involvement of ARFP in mechanisms associated with HCV pathogenesis.
Whilst it was accepted until relatively recently that the hepatitis C virus (HCV) genome encodes one large polyprotein precursor of approximately 3000 aa (Penin et al., 2004), computer-based sequence analyses suggested that the viral genome contains an alternative reading frame (ARF) within the Core coding sequence (Walewski et al., 2001). Synthesis of Core-derived ARF proteins (ARFPs) was shown in cell-free extracts and/or Escherichia coli, but expression of an ARFP has yet to be demonstrated in mammalian cells. Furthermore, no consensus has yet been reached either on the mechanisms involved in initiation of ARFP synthesis or on the exact frameshifting position (Baril & Brakier-Gingras, 2005; Boulant et al., 2003; Vassilaki & Mavromara, 2003; Xu et al., 2001). The role of these proteins in the virus life cycle or in HCV-associated pathogenesis is unknown, but detection of ARFP-specific antibodies and T cell-mediated immune responses in HCV patients suggests that ARFPs are produced during natural infection (Bain et al., 2004).

HCV Core has been assigned a large array of functional, often contradictory, activities: pro- and anti-apoptotic effects, regulation of cell growth, transcriptional activities and immunosuppressive properties (Bergqvist et al., 2003; Ray et al., 1998). Earlier studies based on the use of transgenic mice expressing HCV proteins, including Core, have provided a set of evidence linking HCV protein expression and development of steatosis, oxidative stress, inflammation and, in some instances, hepatocellular carcinomas (Lerat et al., 2002; Okuda et al., 2002). More recently, expression of HCV Core has been linked, at least in vitro, to the induction of cytokine profiles associated with the development of fibrogenesis via a direct action on hepatic stellate cells (Bataller et al., 2004). The recent discovery of novel ARFPs certainly challenges various activities attributed to Core.

Experimental data strongly support infection by HCV during natural infection of different cell types. Beside the primary target cells, hepatocytes, HCV genomes (both positive- and negative-strand RNA) have been found within the population of peripheral blood mononuclear cells, in cells belonging to the monocyte/macrophage (Mφ) lineage, as well as in T- and B-cell lineages (Laskus et al., 2000; Sansonno et al., 1996). Dendritic cells (DCs) isolated from HCV chronic patients have also been described as harbouring HCV replicative intermediate. In vitro, cells supporting HCV replication include Mφ, monocyte-derived DCs, the hepatoma cell line Huh7 and the THP-1 monocytic cell line (Caussin-Schwemling et al., 2001; Lindenbach et al., 2005; Ponzetto et al., 2005; Radkowski et al., 2004; Wakita et al., 2005; Zhong et al., 2005).

By using adenoviral (Ad) constructs, we evaluated comparatively the effect of either wild-type (wt) Core coding sequence (AdCore or AdCE1E2) or a Core sequence modified so that the Core protein is wt, but no ARFP is expressed (AdCΔARFP), on the pattern of soluble factors released by different cell types known to be sites of replication of HCV during natural infection. A first screening on the THP-1 monocytic cell line, as a surrogate for primary monocytes, was further expanded on monocyte-derived DCs and Mφ, and Huh7 hepatoma cells.

Antibodies.
Anti-ARFP (15E7F1, bioMerieux; F. Komurian-Pradel, personal communication) and anti-Core (19D9D6, bioMérieux) monoclonal antibodies (mAbs) were produced as described elsewhere (Himoudi et al., 2002) and are specific, respectively, to the Core2545 and ARFP6793 domains.

Cell cultures.
Cells were cultured in complete Dulbecco's modified Eagle's medium (DMEM) (human Huh7 hepatoma cells) or complete RPMI medium (human THP-1 monocytic leukaemia cells, DCs or Mφ), consisting of DMEM or RPMI medium supplemented with 10 % fetal calf serum, 2 mM L-glutamine and 100 IU penicillin/streptomycin ml1 (Sigma).

DCs and Mφ were differentiated from monocytes obtained from healthy donors by elutriation or CD14-positive selection (Etablissement Français du Sang). Immature DCs (iDCs) were obtained after incubation of monocytes for 6 days in complete RPMI medium supplemented with 200 U interleukin-4 (IL-4) ml1 (Peprotech) and 200 ng granulocytemacrophage colony-stimulating factor (GM-CSF) ml1 (Peprotech). Mφ were obtained after incubation of monocytes for 8 days in complete RPMI medium supplemented with 100 ng Mφ colony-stimulating factor (M-CSF) ml1 (Peprotech) and 10 µg GM-CSF ml1.

Design of the CΔARFP gene.
A synthetic gene, named CΔARFP, encoding the Core protein derived from the HCV-J sequence (Kato et al., 1990) was synthesized by GeneArt () according to the following constraints: (i) the amino acid sequence of the Core protein is totally conserved; (ii) no ARFP, resulting from either a frameshift (Boulant et al., 2003; Xu et al., 2001) or internal initiation in the +1 or +2 open reading frames, can be expressed (Baril & Brakier-Gingras, 2005; Vassilaki & Mavromara, 2003); (iii) RNA secondary structures that could be involved in frameshifting events, such as ribosomal entry sites, AT- or GC-rich sequences or repeat sequences, are abolished. In order to fulfil these conditions, 13 and 26 stop codons were introduced, respectively, in the +1 and +2 reading frames (Fig. 3a). The absence of any ARF product was confirmed by using three plasmids containing the green fluorescent protein (GFP) coding sequence in the 0, +1 or +2 frame of the CΔARFP coding sequence: pQB1-CΔARFP-GFP(0) (GFP cloned after nt 420), pQB1-CΔARFP-GFP(+1) (GFP cloned after nt 421) or pQB1-CΔARFP-GFP(+2) (GFP cloned after nt 422). Seventy-two hours after transfection, GFP expression was analysed in Huh7 cells by flow cytometry. Transfection efficiency was normalized by using the pCMV DsRed-Express system (Clontech), using analysis of DsRed fluorescent protein expression by flow cytometry.



(47K):

Fig. 3. No ARFP is expressed from the synthetic CΔARFP sequence. (a) An alignment of wt Core nucleotide sequence derived from the HCV-J genotype 1b isolate and of synthetic CΔARFP is shown. In order to block any event that may lead to the synthesis of an ARFP, we introduced a total of 39 stop codons in both the +1 (boxed) and +2 (underlined) reading frames. (b) To confirm the absence of frameshifting or internal initiation in cells receiving the CΔARFP coding sequence, Huh7 cells were co-transfected with pQB empty plasmid (Mock), pQBCore-GFP(0), pQBCore-GFP(+1), pQBCΔARFP-GFP(+1) and pCMV DsRed-Express plasmid. Expression of GFP (y-axis) and DsRed (x-axis) was analysed by flow cytometry 72 h after transfection.

Plasmid constructs.
pTGHisCE1E2 and pTGHisCore plasmids were constructed by PCR by inserting a poly(histidine) sequence, CATCACCATCACCATCACCATCACGGTGGTGTG, downstream of the AUG initiator codon in Core- and CE1E2-expressing plasmids (Himoudi et al., 2002).

Plasmids pQBCore-GFP(0) and pQBCore-GFP(+1), expressing Core in fusion with the GFP reporter gene, were constructed as described elsewhere (Boulant et al., 2003).

pGWiz plasmids encoding Core and CE1E2 were described previously (Himoudi et al., 2002). A pGWiz plasmid encoding CΔARFP was constructed as follows: the CΔARFP sequence was amplified by PCR and inserted into the commercial pGWiz plasmid between SalI and NotI restriction sites. pGWiz-GFP, a control plasmid expressing GFP under the cytomegalovirus (CMV) promoter, was purchased from Gene Therapy Systems, Inc.

Recombinant Ad constructs.
Ad constructs encoding CE1E2, Core, GFP and β-galactosidase (β-Gal) were described previously (Himoudi et al., 2002). After amplification of the corresponding sequences by PCR, AdCΔARFP was constructed as described previously (Siavoshian et al., 2004). Ad preparations did not present endotoxin contamination, as assessed by Limulusamoebocyte assay (Marcel Mérieux Laboratory).

DNA transfection and Ad infection.
Huh7 cells were transfected with the different plasmids in the presence of Lipofectamine/Plus reagent (Invitrogen). Huh7 and THP-1 cells were infected with the appropriate recombinant Ad at an m.o.i. of respectively 100 and 200 infectious units (IU) per cell for 72 h before Western blot (WB) analysis or staining with appropriate mAb for immunofluorescence/flow-cytometry studies (Gerszten et al., 2001). For cytokine analysis, supernatants were collected either directly after 72 h infection or after washing and an additional 48 h incubation in medium alone.

iDCs and Mφ were infected with Ad at an m.o.i. of 500 for 2 h in complete medium. Under these conditions, up to 70 % of iDCs and Mφ were found to express GFP following infection with Ad encoding GFP (data not shown). Volume was then increased with complete RPMI medium and cells were incubated for 48 h before WB analysis or phenotype determination by flow cytometry.

His-tagged protein purification.
Seventy-two hours post-transfection, in the presence or absence of proteasome inhibitor (MG-132; Calbiochem) for the last 12 h, Huh7 cells were lysed and His-tagged proteins were purified as described elsewhere (Boulant et al., 2003). Briefly, His-tagged proteins were eluted with 100 µl Tris buffer containing 500 mM imidazole (eluate 1). After a second elution (eluate 2), both eluates were analysed by WB.

WB analysis.
Infected or transfected cells were incubated in lysis buffer containing 1 % Triton X-100 and WB was performed as described previously (Pinna et al., 2004). Membranes were incubated sequentially with anti-ARFP or anti-Core mAbs and horseradish peroxidase-conjugated goat anti-mouse IgG antibodies (Dako). Phosphoproteins were revealed with anti-phospho- and -total p38 and p42MAPK antibodies (Cell Signaling Technology).

Immunofluorescence detection of HCV proteins.
THP-1 cells were infected with different Ad for 72 h before fixation/permeabilization. Staining was carried out by incubation with anti-Core mAb, then tetramethylrhodamine isothiocyanate (TRITC)rabbit anti-mouse antibody (Dako).

Flow-cytometry analyses.
Infectivity of the different Ad constructs on THP-1 cells was assessed 48 h post-infection by staining with an anti-hexon antibody (AdenoX-rapid titre; BD Biosciences) for 1 h at 37 °C. After three washes, a phycoerythrin (PE)-conjugated anti-mouse antibody was added at room temperature for 1 h and analysed by flow cytometry.

Control IgG1fluorescein isothiocyanate (FITC), control IgG2aPE, CD1aFITC, HLA-DRFITC (BD Biosciences), CD40PE, CD83PE (Immunotech), CD86PE, CD80PE, CD11cPE (BD Biosciences) and CD14PE (Dako) were used to assess cell-surface phenotype of DCs and Mφ.

Semiquantitative RT-PCR.
Total RNA was extracted from THP-1 cells infected or not with the different recombinant Ad constructs by using an RNeasy extraction kit (Qiagen). Quality of the RNA was determined by using an RNA 6000 Nano Assay chip (Agilent Technologies) on an Agilent 2100 Bioanalyzer according to the manufacturer's instructions. cDNA was produced from 1 µg total RNA by reverse transcription (5 min at 65 °C followed by 1 h at 55 °C) using the oligo(dT)20 ThermoScript RT-PCR system plus Platinum Taq DNA polymerase (Invitrogen) in a volume of 20 µl. To exclude contamination of samples by genomic DNA, controls in which the reverse transcriptase was replaced by water during the cDNA synthesis step were included. PCR amplification was performed by using primers specific for Core: sense, 5'-GTGGAAGGCGACAACTATC-3', and antisense, 5'-GGCAGATTCCCTGTTGCATA-3'; and CΔARFP: sense, 5'-AGCCAGCCTAGAGGAAGGAG-3', and antisense, 5'-ATTTCCGGTTGCGTAATTCA-3'. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) amplification (primers: sense, 5'-CCACATCGCTCAGACACC-3', and antisense, 5'-GAGGTCCACCACCCTGTT-3') was used to demonstrate equal RNA load. PCR amplification was carried out over 10, 20, 30 or 40 cycles of denaturation (92 °C, 1 min), annealing (55 °C, 1 min) and extension (72 °C, 1 min) using a thermocycler (ABI PRISM; Applied Biosystems). PCR products were analysed by electrophoresis in a 3 % agarose gel. The expected sizes of amplified products are 334 bp for Core, 339 bp for CΔARFP and 992 bp for GAPDH.

Measurement of soluble factor production.
Soluble factors were screened on THP-1 cell supernatants by using both a Human Cytokine Array III (RayBiotech), allowing detection of 42 soluble factors (Fig. 2a), and a Bio-Plex Human Cytokine 17-Plex panel (Bio-Rad). Levels of IL-8, MCP-1 and MIP-1β produced by THP-1 cells were measured by ELISA (IL-8, MCP-1, BD Biosciences; MIP-1β, R&D Systems). Levels of IL-6, IL-8, MCP-1 and MIP-1β produced by DCs and Mφ were measured by using a custom 4-Plex panel (Bio-Rad).



(23K):

Fig. 2. Endogenous expression of HCV proteins induces IL-8, MCP-1 and MIP-1β chemokine secretion by THP-1 cells. THP-1 cells were infected with AdβGal, AdCE1E2 or AdCore for 72 h. Supernatants were collected either immediately (a) or after an additional 48 h incubation of infected cells in medium (b) and screened by use of either RayBio Human Cytokine Antibody Array III membranes (a) or the Bio-Plex Human Cytokine 17-Plex panel (b). In (b), only data for IL-8, MCP-1 and MIP-1β are shown; data for all other chemokines tested were not applicable (see text).

IL-8 promoter activity.
Huh7 cells were transfected with a total of 1.3 µg plasmid DNA consisting of 0.5 µg pIL-8-133 wt Luc (a gift from Dr Omata Masao, Department of Endoscopy, University of Tokyo, Japan), 0.4 µg pGWiz encoding or not Core, CE1E2, ARFP101 or CΔARFP and 0.4 µg pGWiz-GFP. Firefly luciferase luminometric activity was measured by use of a Dual Luciferase kit (Promega) 48 h after transfection.

Statistics.
Statistical analysis was performed by using a t-test and significant P values (P < 0.05) compared with controls.

ARFP is detected in the presence of a histidine tag
No studies have yet demonstrated formally that Core coding sequences can lead to the expression of an ARFP in mammalian cells. Preliminary experiments using THP-1 or Huh7 cells either infected by recombinant Ad constructs or transfected with plasmid DNA encoding Core or CE1E2 failed to show expression of ARFP. To overcome this problem, Huh7 cells were transfected with plasmids expressing histidine-tagged Core or CE1E2. We introduced the His-tag sequence at the N terminus downstream of the AUG initiation codon of the Core coding sequence. As illustrated in Fig. 1(a), this construct was designed such that ARFPs resulting from ribosomal frameshifting can be produced and purified (Boulant et al., 2003; Xu et al., 2001). However, this design does not allow purification of ARFPs that could be produced by internal initiation either at codon 26 or at codon 83 (Baril & Brakier-Gingras, 2005; Vassilaki & Mavromara, 2003). When His-tagged products from cell extracts were stained with an anti-ARFP mAb, a specific band was detected exclusively in eluate 1 at a molecular mass of 17 kDa (Fig. 1b). When this same membrane was stained, without prior stripping, with a highly diluted anti-Core mAb, a second band at 21 kDa was detected in both eluates (Fig. 1b, c), suggesting that, in cells transfected with plasmids expressing His-tagged Core or CE1E2, levels of Core are much higher than levels of ARFP.



(45K):

Fig. 1. Detection of ARFP following transient transfection. Huh7 cells were transfected with plasmids encoding an N-terminally His-tagged form of Core or CE1E2. His-tagged proteins were purified 72 h post-transfection and identified by WB using anti-ARFP and anti-Core mAbs. (a) Schematic representation of protein products that can be expressed from the 0 and +1 reading frames of the Core coding sequence in the context of wt Core sequence (left side) and His-tagged Core sequence (right side). (b) Simultaneous detection of Core (1/40 000) and ARFP (1/5000) in the presence of proteasome inhibitor (MG-132) or (c) separate detection of Core and ARFP in the presence or absence of MG-132. Data are representative of four independent experiments.

Interestingly, a band corresponding to HisARFP was detected whether or not the MG-132 proteasome inhibitor was added, suggesting that HisARFP is not sensitive to proteasome degradation (Fig. 1c).

These data illustrate that the genotype 1b sequence used in our study is capable of expressing an ARFP of approximately 17 kDa, albeit to undetectable levels unless His-tagged ARFP is enriched prior to WB detection.

AdCE1E2 and AdCore induce IL-8, MCP-1 and MIP-1β production by THP-1 cells
Immunomodulatory effects of Core were first screened in THP-1 cells. Supernatants of Ad-infected cells were first analysed by using Human Cytokine Array III membranes (RayBiotech), then by using Luminex Bead Array (LBA) technology, allowing qualitative or quantitative screening of 42 (Fig. 2a) and 17 soluble factors, respectively. As demonstrated by others (Fernandez et al., 2002), RANTES is produced at high levels by THP-1 cells infected with Ad vectors. This production, however, was not modulated by expression of HCV Core (Fig. 2a). Secretion of only three chemokines, namely IL-8 (CXCL-8), MCP-1 (CCL-2) and MIP-1β (CCL-4), was upregulated in cells infected with Ad constructs expressing Core (Fig. 2a, b). Surprisingly, neither IL-1β nor tumour necrosis factor alpha (TNF-α), known to be IL-8 inducers, was induced (Fig. 2a, b) (Chaly et al., 2000).

Construction of an Ad construct encoding Core and depleted of ARFP expression
As we have shown (Fig. 1) that an ARFP can be expressed naturally from Core-coding sequences, in order to clarify the relative contribution of Core and ARFPs to chemokine induction, the Core-coding sequence was modified so that wt Core protein is expressed, but expression of any protein resulting from frameshifting or internal initiation is precluded (referred to as CΔARFP; Fig. 3a).

To verify that the CΔARFP sequence functions as expected, plasmids containing the GFP sequence inserted downstream of wt Core or CΔARFP gene in either the 0 or +1 frame [Core-GFP(0), Core-GFP(+1), CΔARFP-GFP(0) or CΔARFP-GFP(+1)] were constructed and co-transfected with pCMV DsRed plasmid into Huh7 cells. Transfection efficiency, as assessed by flow cytometry (Fig. 3b,) was equivalent between cells transfected with the different constructs, with >95 % of cells expressing DsRed. As expected, GFP was expressed when cloned in frame 0 of wt Core (32 % GFP+ cells) and CΔARFP (29 % GFP+ cells) (Fig. 3b). When cells were transfected with Core-GFP(+1) plasmid, 1.84 % of cells stained positive for GFP, confirming that frame +1 of the Core coding sequence is an ARF. In contrast, when the GFP sequence was inserted in frame +1 of the CΔARFP sequence, no GFP+ cells were detected, thus demonstrating that this CΔARFP sequence cannot lead to the expression of an ARFP.

This sequence was inserted in a recombinant Ad construct and its infectivity was investigated in the THP-1 cell line. As expected, infectivity of AdCΔARFP, as assessed by quantifying cells expressing the Ad hexon protein, is equivalent to that of AdCE1E2 or AdCore on the THP-1 cell line (Fig. 4a). Patterns of Core expression following infection with AdCore, AdCE1E2 or AdCΔARFP were analysed by WB (Fig. 4b) and immunofluorescence (Fig. 4c). A specific band at 20 kDa, revealed with an anti-Core antibody, is present in cells infected with AdCΔARFP, similarly to cells infected with AdCore or AdCE1E2 (Fig. 4b). Levels of Core expressed in cells infected with AdCΔARFP, as estimated by WB, were equivalent to those expressed by cells infected with AdCore, but lower than those expressed by cells infected with AdCE1E2. This difference is not due to variations in stability of Core transcripts, as demonstrated by semiquantitative RT-PCR (Fig. 4d), but may rather involve stabilization of Core by E1 and E2 proteins, as proposed previously (Himoudi et al., 2002). Furthermore, Core expressed from the CΔARFP sequence shows ring-like and dot structures similar to those of Core expressed from AdCE1E2 or AdCore (Fig. 4c).



(41K):

Fig. 4. Detection of wt Core in cells infected with AdCΔARFP. To assess infectivity of the different Ad constructs, expression of Ad hexon protein was assessed by flow cytometry on THP-1 cells after infection (bold line) or not (dotted line) with the different viruses (a). Core expression was analysed in THP-1 cells 72 h after infection with the different Ad constructs by WB (b) and fluorescence microscopy (c) (original magnification, x100) after staining with an anti-Core mAb. Expression of mRNAs encoding Core or GAPDH after infection with the different Ad constructs was analysed by semiquantitative RT-PCR after 20 and 30 cycles of amplification (d). Size markers are shown on the left-hand side (in bp).

Overall, our results show that the CΔARFP sequence does allow expression of a Core protein displaying characteristics equivalent to those of Core expressed from unmodified, wt Core sequences, whilst ARFP expression is abolished.

Triggering of chemokine production decreases when Core is expressed in the absence of ARFP in THP-1 cells
As previously observed by using LBA (Fig. 2b), THP-1 cells infected with AdCore and AdCE1E2 release higher levels of IL-8, MCP-1 and MIP-1β compared with uninfected cells or cells infected with AdβGal as measured by ELISA (Fig. 5). IL-8 production by THP-1 cells infected with AdCΔARFP did not differ significantly from levels detected in cells infected with AdCore or AdCE1E2. Furthermore, levels of IL-8 were significantly higher in cells infected with AdCΔARFP than in cells infected with AdβGal (Fig. 5). Conversely, in cells infected with AdCΔARFP, secretion of MCP-1 and MIP-1β was not triggered, reaching levels equivalent to those produced by either uninfected or AdβGal-infected cells.



(15K):

Fig. 5. Induction of MIP-1β and MCP-1 by AdCE1E2 or AdCore is dependent on expression of ARFPs in THP-1 cells. THP-1 cells were infected or not with the different Ad constructs for 72 h. Cells were then washed and incubated for 48 h in complete medium. Secretion of IL-8, MCP-1 and MIP-1β was measured in supernatants by ELISA. Results (in pg ml1) are presented as mean values±SD from at least three independent experiments. *P < 0.05 compared with Adβ-Gal.

Overall, these results indicate that, whilst production of MCP-1 and MIP-1β by cells infected by AdCore or AdCE1E2 seems to require expression of ARFPs, Core expression may be sufficient to induce IL-8 secretion by THP-1 cells.

Effect of Core-encoding Ad constructs on monocyte-derived DCs and Mφ
In order to confirm these results on primary cells, human blood monocytes were differentiated into either DCs or Mφ by incubation in the presence of GM-CSF and respectively IL-4 or M-CSF (Fig. 6a). Effect of the different Ad constructs was evaluated based on the phenotype as well as the pattern of soluble factors secreted by iDCs and Mφ.



(57K):

Fig. 6. Core coding sequences do not induce phenotypic maturation of iDCs and Mφ. Human blood monocytes were differentiated into either iDCs or Mφ as observed by inverted microscopy (magnification, x40) (a). iDCs and Mφ were infected with the different Ad constructs for 48 h and expression of Core was analysed by WB (b). Expression of surface molecules on iDCs (c) and Mφ (d) was analysed by flow cytometry. On each histogram are indicated the percentage of positive cells detected and the mean fluorescence intensity of staining for each cell-surface marker (c, d). Histograms show data representative of five independent experiments for DCs and four experiments for Mφ.

Core coding sequences do not induce phenotypic maturation of iDCs and Mφ.
iDCs and Mφ were infected with the different Ad constructs for 48 h and expression of Core was analysed by WB. As expected, a specific band at 21 kDa is revealed with an anti-Core antibody in lysate of both cell types infected with AdCE1E2, AdCore and AdCΔARFP (Fig. 6b). In order to investigate whether expression of HCV Core/ARFPs or HCV Core alone leads to a modulation of morphological or phenotypic characteristics of DCs and Mφ, we analysed the expression of various cell-surface markers expressed by iDCs and Mφ infected or not by the different Ad constructs. Monocytes, cultured in the presence of GM-CSF and IL-4 or M-CSF, differentiated efficiently into respectively iDCs, as characterized by the dendrite-forming cells, and Mφ, displaying characteristic fried-egg morphology (Fig. 6a). Upregulation of CD1a and downregulation of CD14 expression confirmed differentiation of monocytes into iDCs, as illustrated by low levels of costimulatory molecules (CD80 and CD86) as well as the absence of CD83 expression. Mφ, differentiated from monocytes in the presence of M-CSF, had conserved CD14 expression (Fig. 6c, d). Neither infection with Ad nor expression of HCV antigens induced morphological or phenotypic changes of iDCs or Mφ (Fig. 6c, d). Overall, infection of Mφ and DCs by HCV-expressing Ad vectors did not induce morphological or phenotypic maturation of these cells.

Core coding sequences upregulate secretion of pro-inflammatory cytokines/chemokines by both iDCs and Mφ.
In parallel with phenotype, supernatants from iDCs and Mφ infected with the different Ad constructs were first screened for soluble factor content by use of the Bio-Plex Human Cytokine 17-Plex panel. No production of IL-1β, IL-2, IL-4, IL-5, IL-7, IL-10, IL-12p70, IL-13, IL-17, GM-CSF, gamma interferon (IFN-γ), TNF-α or granulocyte colony-stimulating factor (G-CSF) was detected in supernatant of cells infected or not with the different Ad constructs. In addition to soluble factors retrieved from THP-1 cells, Mφ, but not iDCs, released significant amounts of IL-6 at baseline. Although Ad infection by itself slightly increased production of IL-8, MCP-1 and MIP-1β and induced IL-6 secretion by iDCs, levels of these four cytokines/chemokines were enhanced significantly in iDCs infected with AdCore and AdCE1E2 (Fig. 7a, b). Such an effect was also shown on Mφ for IL-6 and MIP-1β secretion, whilst amounts of MCP-1 and IL-8 did not change upon infection with AdCore and AdCE1E2 (Fig. 7c, d).



(24K):

Fig. 7. Core coding sequences upregulate secretion of pro-inflammatory cytokines/chemokines by iDCs and Mφ. iDCs (a, b) and Mφ (c, d) were infected with the different Ad constructs for 48 h and supernatants were collected and screened by use of the Bio-Plex Human Cytokine 17-Plex panel. No production of IL-1β, IL-2, IL-4, IL-5, IL-7, IL-10, IL-12p70, IL-13, IL-17, GM-CSF, IFNγ, TNF-α or G-CSF was detected in supernatants of cells infected or not with the different Ad constructs. A representative experiment is shown in (a) for iDCs and in (c) for Mφ. Results (pg ml1) are shown as mean values±SD of duplicate wells. Results from four additional independent experiments, using a custom 4-Plex panel (as described in Methods) and normalized with respect to AdβGal condition (100 %), are shown in (b) for iDCs and (d) for Mφ. *Significant compared with Adβ-Gal (P < 0.05).

As observed in THP-1 cells, when Core is expressed in the absence of ARFP in iDCs and Mφ infected with AdCΔARFP, levels of MCP-1 and MIP-1β were comparable to levels determined in cells infected with AdβGal. Similar effects on both iDCs and Mφ are shown for IL-6 secretion. However, in contrast with data from THP-1 cells, infection of iDCs with AdCΔARFP did not upregulate IL-8 secretion in comparison with infection with AdβGal, and amounts of IL-8 were significantly lower than those produced after infection with AdCore or AdCE1E2 (Fig. 7a, b).

Altogether, these results indicate that modulation of the soluble factor profile by Core coding sequences in iDCs and Mφ is dependent on ARFP and not Core protein expression.

Expression of Core in the absence of ARFP does not trans-activate the IL-8 promoter in the HCV-susceptible Huh7 hepatoma cell line
Huh7 cells, described to support HCV replication (Wakita et al., 2005), were next infected with the different Ad constructs and IL-8 secretion was quantified. Although basal levels of IL-8 were 13 logs higher in Huh7 cells than in Mφ, iDCs and THP-1 cells, induction of IL-8 expression was nevertheless observed in Huh7 cells after infection with AdCore or AdCE1E2 (Fig. 8a). As previously observed in iDCs and, less dramatically, in THP-1 cells, expression of Core in the absence of ARFP in Huh7 cells did not trigger IL-8 secretion, in comparison with Huh7 cells infected with AdβGal (Fig. 8a). Production of MCP-1 and MIP-1β is typically not observed with Huh7 cells (data not shown).



(21K):

Fig. 8. Expression of Core in the absence of ARFPs does not trans-activate the IL-8 promoter in the HCV-susceptible Huh7 hepatoma cell line. (a) Huh7 cells were infected with the different Ad constructs at an m.o.i. of 100. After 48 h, IL-8 production was measured by ELISA. Results are presented as mean values±SD from two different experiments. (b) Huh7 cells were infected with the different Ad constructs at an m.o.i. of 100. After 48 h, a WB with an anti-pp38/p4244MAPK or p38/4244MAPK antibody (1/1000) was done. Data are representative of three independent experiments. (c) Huh7 cells were transfected with three different plasmids: one encoding or not HCV antigen (pGWizCE1E2, pGWizCore, pGWizCΔARFP or control pGWiz), one encoding firefly luciferase driven by the IL-8 promoter (pIL-8-133 wt Luc) and one encoding GFP (pGWizGFP). Firefly luciferase luminometric activity, as expressed in relative light units (RLU), was measured by use of a Dual Luciferase kit (Promega) 48 h after transfection and was normalized relative to GFP expression as measured by flow cytometry. Histogram bars show mean values±SD of luciferase activity measured in triplicate wells. Percentage of GFP-positive cells is indicated below the histogram. Results are representative of five independent experiments.

As induction of IL-8 by exogenous Core in monocytic cells has been shown to involve activation of p38MAPK and p4244MAPK (Dolganiuc et al., 2004; Moorman et al., 2005; M. Fiorucci, unpublished observations), we investigated the implication of these two kinases in the production of IL-8 by Huh7 cells infected with a Core-encoding Ad. As shown in Fig. 8(b), the pattern of phosphorylation of p38/p4244MAPK was not modified in cells infected with the Core-encoding Ad, suggesting that these two kinases are not involved in the IL-8 production pathway in Huh7 cells expressing endogenous Core. We next evaluated the effect of endogenous expression of HCV proteins on the IL-8 gene promoter. Huh7 cells were co-transfected with plasmids encoding Core, CE1E2 or CΔARFP together with a plasmid encoding firefly luciferase under the control of the IL-8 promoter. A third plasmid encoding GFP was used to standardize transfection efficiency. As illustrated in Fig. 8(c), the IL-8 promoter was transactivated by Core and CE1E2 constructs, as described previously (Hoshida et al., 2005). In contrast, whilst the transfection efficiency of Huh7 cells and expression levels of Core were equivalent between Core, CE1E2 and CΔARFP constructs (data not shown), trans-activation of the IL-8 promoter by CΔARFP was significantly lower than trans-activation by Core and CE1E2 (P < 0.05) and did not differ from control (P > 0.05). Thus Core, when expressed in the absence of ARFP, is not able to trans-activate the IL-8 promoter (Fig. 8c) or, consequently, to trigger IL-8 production by Huh7 cells (Fig. 8a). Core is certainly one of the most studied proteins of HCV. As a consequence, this is also the antigen for which a large array of sometimes contradictory functional activities has been assigned: these include pro- and anti-apoptotic effects, regulation of cell growth and transcriptional activities and immunosuppressive properties (Bergqvist & Rice, 2001; Ray et al., 1996a, b). The recent discovery of a novel HCV protein, issued from an ARF overlapping the Core coding sequence, certainly challenges various activities so far attributed to Core. We show, for the first time, that an ARFP is expressed in mammalian cells transfected with a prototype genotype 1b Core coding sequence. Although this protein is probably very unstable and/or expressed at very low levels, our data clearly indicate that: (i) various cell types that have been shown to support HCV infection and/or replication, including the human hepatoma Huh7 cell line and the THP-1 monocytic cell line, as well monocyte-derived primary DCs and Mφ, secrete pro-inflammatory cytokines and chemokines when infected with Ad constructs encoding wt Core-coding sequences; (ii) this secretion probably involves ARFP expression, as infection with an Ad encoding a Core protein modified so that wt Core, but no ARFP, is expressed is not capable of triggering secretion of such factors; (iii) in Huh7 cells, IL-8 induction by wt Core coding sequences involves trans-activation of the IL-8 promoter and requires expression of ARFP.

Expression of ARFPs from the Core coding sequence has been demonstrated so far by use of reporter genes inserted in the +1 frame of truncated Core coding sequences. By using a mAb generated from a genotype 1a ARFP (Komurian-Pradel et al., 2004), we were able to specifically detect a protein of 17 kDa in cells transfected with a genotype 1b Core coding sequence. This protein probably corresponds to the chimeric protein potentially ending at position 144 proposed by Boulant et al. (2003). This protein could only be visualized if tagged at its N terminus and purified on nickel beads. Indeed, HisARFP, in contrast to HisCore, could not be detected by WB without purification on nickel beads (data not shown). These results, together with the fact that the whole content of HisARFP is recovered in the first elution step, indicate that levels of expression of HisARFP remain quite low compared with those of HisCore.

Immunomodulatory effects of Core coding sequences were evaluated in different cell types known either to support HCV replication in vitro, such as the Huh7 human hepatoma cell line (Wakita et al., 2005), or to constitute extrahepatic targets of HCV infection in vivo, such as monocyte-derived DCs and Mφ or the THP-1 monocytic cell line as a surrogate of primary monocytes (Bain et al., 2001; Ducoulombier et al., 2004; Goutagny et al., 2003; Radkowski et al., 2004). An overall very limited pattern of soluble factors was found to be upregulated by Core coding sequences. In THP-1 cells, infection with AdCore or AdCE1E2 led to the secretion of chemokines such as MCP-1, MIP-1β and IL-8. As RANTES is typically produced at a high level by THP-1 cells infected with Ad (Fernandez et al., 2002), such secretion of RANTES may affect the profile of soluble factors induced by expression of HCV proteins. However, as discussed later in this section, both in vitro and in vivo data corroborate involvement of HCV Core, and probably ARFPs, in the induction of cytokines and chemokines such as IL-6, IL-8 and MCP-1. A similar pattern, although slightly different, was retrieved in primary cells derived from human blood monocytes. iDCs expressed IL-6 in addition to these chemokines, whilst a more restricted pattern, including only IL-6 and MIP-1β, was upregulated by expression of Core coding sequences in Mφ. Others have previously observed triggering of pro-inflammatory cytokines/chemokines by primary monocytes from chronically HCV-infected individuals (Dolganiuc et al., 2003), by primary Mφ infected in vitro with HCV (Radkowski et al., 2004) or by iDCs infected with AdCore (Li et al., 2006). As we have shown that not only the Core protein, but also an ARFP, are expressed from wt Core coding sequences, in order to discriminate effects due to Core from those due to ARFP expression, we constructed an Ad vector containing a Core coding sequence modified so that Core, but no ARFP, is expressed. Production of cytokines/chemokines detected in cells infected with AdCore or AdCE1E2 was not recovered in any cell type infected with AdCΔARFP. At the level of IL-8 production, we were able to show that, whilst the IL-8 promoter was trans-activated efficiently in Huh7 cells infected by AdCore or AdCE1E2, as reported by Hoshida et al. (2005), expression of Core in the absence of ARFP was not able to trans-activate the IL-8 promoter or, consequently, lead to IL-8 secretion. Whether expression of ARFP alone or co-expression of ARFP with Core is responsible for the observed cytokine profiles remains to be established, but clearly expression of Core alone is not sufficient.

Although slightly different patterns of soluble factors were induced by Core coding sequences depending on the hepatic or monocytic origin of the cells, all are cytokines or chemokines involved in inflammation and fibrosis processes. Indeed, MCP-1 and IL-8 are profibrogenic chemokines that have been associated with advanced liver diseases of various aetiologies, including HCV infection (Marra et al., 1993). Recent data describe an association in HCV-infected individuals between a polymorphism within the promoter region of the MCP-1 gene, elevated intrahepatic expression of MCP-1 and more severe hepatic inflammation and fibrosis (Muhlbauer et al., 2003). Similarly, elevated levels of IL-8 in the serum and liver of chronically HCV-infected patients correlated with hepatic inflammation, staging of fibrosis and non-response to antiviral treatment (al-Wabel et al., 1995; Mahmood et al., 2002). Serum levels of IL-6, also known as hepatic stimulating factor, as well as its soluble receptors, are correlated with liver function impairment, degree of liver fibrosis and evolution to hepatocellular carcinoma in patients with HCV-related chronic liver diseases (Migita et al., 2006; Soresi et al., 2006). Altogether, in spite of low levels of expression and/or stability of ARFP, our data indicate that production of these pro-inflammatory/profibrogenic factors by hepatic as well as extrahepatic cells that may become infected by HCV during natural infection is dependent on the expression of this protein. Whilst Ad-based expression systems lead to production of non-physiological levels of HCV antigens in a non-physiological site (nucleus), such systems have been, and are still, widely used to uncover potential functions of viral proteins, in particular when relevant infection assays are either lacking or tedious to implement (Joo et al., 2005; Li et al., 2006). Although an in vitro HCV replication assay has recently been developed (Wakita et al., 2005), its implementation is yet far from being widely adopted. It would nonetheless be important to confirm our observations in such a system.

Whilst fibrogenic effects of exogenous Core protein on hepatic stellate cells and monocytes have been clearly demonstrated in vitro (Bataller et al., 2004; Dolganiuc et al., 2004), our results show that production of IL-6, IL-8, MCP-1 and MIP-1β by cells bearing Core coding sequences may involve expression not only of Core protein, but also of the novel ARFPs. Our data, indicating that endogenous expression of ARFPs is essential for the production of fibrogenic chemokines, could provide a link between independent sets of clinical data: the observations that (i) IL-6, IL-8 and MCP-1 are produced at elevated levels in advanced liver disease during HCV infection (al-Wabel et al., 1995; Bataller et al., 2004; Mahmood et al., 2002; Migita et al., 2006; Muhlbauer et al., 2003; Polyak et al., 2001a; Soresi et al., 2006); (ii) IL-8 levels in the sera of chronic patients are correlated inversely with response to IFN-α therapy (Polyak et al., 2001b); and (iii) prevalence of anti-ARFP antibodies may be higher in HCV patients with advanced liver disease and cancer (Branch et al., 2005). These observations would suggest that fine interactions between Core and ARFP proteins may participate in determining disease outcome during HCV pathogenesis.

We thank A. Evlachev and P. Martin (Transgene SA, Lyon, France) for their useful comments through the course of this study, A. Winter (Transgene SA, Strasbourg, France) for his help in the construction and purification of the CΔARFP adenovirus, and bioMérieux SA, Transgene SA and the ANRS (Agence Nationale de Recherche sur SIDA) for financial support and grant fellowship for M. F.

Footnotes

,, Steeve Boulant2,3, Anne Fournillier1 ,, Jean Daniel Abraham4, Jean Pierre Lavergne2, Glaucia Paranhos-Baccala5, Geneviève Inchauspé1 , and Christine Bain1Present address: Transgene, AFSSA Lyon, 31 avenue Tony Garnier, 69364 Lyon Cedex 07, France.

References

al-Wabel, A., al-Knawy, B. & Raziuddin, S. (1995). Interleukin-8 and granulocyte-macrophage colony-stimulating factor secretion in hepatocellular carcinoma and viral chronic active hepatitis. Clin Immunol Immunopathol 74, 231235.[CrossRef][Medline]

Bain, C., Fatmi, A., Zoulim, F., Zarski, J. P., Trépo, C. & Inchauspé, G. (2001). Impaired allostimulatory function of dendritic cells in chronic hepatitis C infection. Gastroenterology 120, 512524.[CrossRef][Medline]

Bain, C., Parroche, P., Lavergne, J. P., Duverger, B., Vieux, C., Dubois, V., Komurian-Pradel, F., Trépo, C., Gebuhrer, L. & other authors (2004). Memory T-cell-mediated immune responses specific to an alternative Core protein in hepatitis C virus infection. J Virol 78, 1046010469.[Abstract/Free Full Text]

Baril, M. & Brakier-Gingras, L. (2005). Translation of the F protein of hepatitis C virus is initiated at a non-AUG codon in a +1 reading frame relative to the polyprotein. Nucleic Acids Res 33, 14741486.[Abstract/Free Full Text]

Bataller, R., Paik, Y. H., Lindquist, J. N., Lemasters, J. J. & Brenner, D. A. (2004). Hepatitis C virus core and nonstructural proteins induce fibrogenic effects in hepatic stellate cells. Gastroenterology 126, 529540.[CrossRef][Medline]

Bergqvist, A. & Rice, C. M. (2001). Transcriptional activation of the interleukin-2 promoter by hepatitis C virus core protein. J Virol 75, 772781.[Abstract/Free Full Text]

Bergqvist, A., Sundstrom, S., Dimberg, L. Y., Gylfe, E. & Masucci, M. G. (2003). The hepatitis C virus core protein modulates T cell responses by inducing spontaneous and altering T-cell receptor-triggered Ca2+ oscillations. J Biol Chem 278, 1887718883.[Abstract/Free Full Text]

Boulant, S., Becchi, M., Penin, F. & Lavergne, J. P. (2003). Unusual multiple recoding events leading to alternative forms of hepatitis C virus core protein from genotype 1b. J Biol Chem 278, 4578545792.[Abstract/Free Full Text]

Branch, A. D., Stump, D. D., Gutierrez, J. A., Eng, F. & Walewski, J. L. (2005). The hepatitis C virus alternate reading frame (ARF) and its family of novel products: the alternate reading frame protein/F-protein, the double-frameshift protein, and others. Semin Liver Dis 25, 105117.[CrossRef][Medline]

Caussin-Schwemling, C., Schmitt, C. & Stoll-Keller, F. (2001). Study of the infection of human blood derived monocyte/macrophages with hepatitis C virus in vitro. J Med Virol 65, 1422.[CrossRef][Medline]

Chaly, Y. V., Selvan, R. S., Fegeding, K. V., Kolesnikova, T. S. & Voitenok, N. N. (2000). Expression of IL-8 gene in human monocytes and lymphocytes: differential regulation by TNF and IL-1. Cytokine 12, 636643.[CrossRef][Medline]

Dolganiuc, A., Kodys, K., Kopasz, A., Marshall, C., Do, T., Romics, L., Jr, Mandrekar, P., Zapp, M. & Szabo, G. (2003). Hepatitis C virus core and nonstructural protein 3 proteins induce pro- and anti-inflammatory cytokines and inhibit dendritic cell differentiation. J Immunol 170, 56155624.[Abstract/Free Full Text]

Dolganiuc, A., Oak, S., Kodys, K., Golenbock, D. T., Finberg, R. W., Kurt-Jones, E. & Szabo, G. (2004). Hepatitis C core and nonstructural 3 proteins trigger toll-like receptor 2-mediated pathways and inflammatory activation. Gastroenterology 127, 15131524.[CrossRef][Medline]

Ducoulombier, D., Roque-Afonso, A. M., Di Liberto, G., Penin, F., Kara, R., Richard, Y., Dussaix, E. & Feray, C. (2004). Frequent compartmentalization of hepatitis C virus variants in circulating B cells and monocytes. Hepatology 39, 817825.[CrossRef][Medline]

Fernandez, N., Renedo, M., Garcia-Rodriguez, C. & Sanchez Crespo, M. (2002). Activation of monocytic cells through Fc gamma receptors induces the expression of macrophage-inflammatory protein (MIP)-1 alpha, MIP-1 beta, and RANTES. J Immunol 169, 33213328.[Abstract/Free Full Text]

Gerszten, R. E., Friedrich, E. B., Matsui, T., Hung, R. R., Li, L., Force, T. & Rosenzweig, A. (2001). Role of phosphoinositide 3-kinase in monocyte recruitment under flow conditions. J Biol Chem 276, 2684626851.[Abstract/Free Full Text]

Goutagny, N., Fatmi, A., De Ledinghen, V., Penin, F., Couzigou, P., Inchauspé, G. & Bain, C. (2003). Evidence of viral replication in circulating dendritic cells during hepatitis C virus infection. J Infect Dis 187, 19511958.[CrossRef][Medline]

Himoudi, N., Abraham, J. D., Fournillier, A., Lone, Y. C., Joubert, A., Op De Beeck, A., Freida, D., Lemonnier, F., Kieny, M. P. & Inchauspé, G. (2002). Comparative vaccine studies in HLA-A2.1-transgenic mice reveal a clustered organization of epitopes presented in hepatitis C virus natural infection. J Virol 76, 1273512746.[Abstract/Free Full Text]

Hoshida, Y., Kato, N., Yoshida, H., Wang, Y., Tanaka, M., Goto, T., Otsuka, M., Taniguchi, H., Moriyama, M. & other authors (2005). Hepatitis C virus core protein and hepatitis activity are associated through transactivation of interleukin-8. J Infect Dis 192, 266275.[CrossRef][Medline]

Joo, M., Hahn, Y. S., Kwon, M., Sadikot, R. T., Blackwell, T. S. & Christman, J. W. (2005). Hepatitis C virus core protein suppresses NF-kappaB activation and cyclooxygenase-2 expression by direct interaction with IkappaB kinase beta. J Virol 79, 76487657.[Abstract/Free Full Text]

Kato, N., Hijikata, M., Ootsuyama, Y., Nakagawa, M., Ohkoshi, S., Sugimura, T. & Shimotohno, K. (1990). Molecular cloning of the human hepatitis C virus genome from Japanese patients with non-A, non-B hepatitis. Proc Natl Acad Sci U S A 87, 95249528.[Abstract/Free Full Text]

Komurian-Pradel, F., Rajoharison, A., Berland, J. L., Khouri, V., Perret, M., Van Roosmalen, M., Pol, S., Negro, F. & Paranhos-Baccala, G. (2004). Antigenic relevance of F protein in chronic hepatitis C virus infection. Hepatology 40, 900909.[CrossRef][Medline]

Laskus, T., Radkowski, M., Piasek, A., Nowicki, M., Horban, A., Cianciara, J. & Rakela, J. (2000). Hepatitis C virus in lymphoid cells of patients coinfected with human immunodeficiency virus type 1: evidence of active replication in monocytes/macrophages and lymphocytes. J Infect Dis 181, 442448.[CrossRef][Medline]

Lerat, H., Honda, M., Beard, M. R., Loesch, K., Sun, J., Yang, Y., Okuda, M., Gosert, R., Xiao, S. Y. & other authors (2002). Steatosis and liver cancer in transgenic mice expressing the structural and nonstructural proteins of hepatitis C virus. Gastroenterology 122, 352365.[CrossRef][Medline]

Li, W., Li, J., Tyrrell, D. L. & Agrawal, B. (2006). Expression of hepatitis C virus-derived core or NS3 antigens in human dendritic cells leads to induction of pro-inflammatory cytokines and normal T-cell stimulation capabilities. J Gen Virol 87, 6172.[Abstract/Free Full Text]

Lindenbach, B. D., Evans, M. J., Syder, A. J., Wolk, B., Tellinghuisen, T. L., Liu, C. C., Maruyama, T., Hynes, R. O., Burton, D. R. & other authors (2005). Complete replication of hepatitis C virus in cell culture. Science 309, 623626.[Abstract/Free Full Text]

Mahmood, S., Niiyama, G., Kawanaka, M., Nakata, K., Sho, M., Yasuhara, Y., Ito, T. & Yamada, G. (2002). Long term follow-up of a group of chronic hepatitis C patients treated with anti-inflammatory drugs following initial interferon therapy. Hepatol Res 24, 213[CrossRef][Medline]

Marra, F., Valente, A. J., Pinzani, M. & Abboud, H. E. (1993). Cultured human liver fat-storing cells produce monocyte chemotactic protein-1. Regulation by proinflammatory cytokines. J Clin Invest 92, 16741680.[Medline]

Migita, K., Abiru, S., Maeda, Y., Daikoku, M., Ohata, K., Nakamura, M., Komori, A., Yano, K., Yatsuhashi, H. & other authors (2006). Serum levels of interleukin-6 and its soluble receptors in patients with hepatitis C virus infection. Hum Immunol 67, 2732.[CrossRef][Medline]

Moorman, J. P., Fitzgerald, S. M., Prayther, D. C., Lee, S. A., Chi, D. S. & Krishnaswamy, G. (2005). Induction of p38- and gC1qR-dependent IL-8 expression in pulmonary fibroblasts by soluble hepatitis C core protein. Respir Res 6, 105[CrossRef][Medline]

Muhlbauer, M., Bosserhoff, A. K., Hartmann, A., Thasler, W. E., Weiss, T. S., Herfarth, H., Lock, G., Scholmerich, J. & Hellerbrand, C. (2003). A novel MCP-1 gene polymorphism is associated with hepatic MCP-1 expression and severity of HCV-related liver disease. Gastroenterology 125, 10851093.[CrossRef][Medline]

Okuda, M., Li, K., Beard, M. R., Showalter, L. A., Scholle, F., Lemon, S. M. & Weinman, S. A. (2002). Mitochondrial injury, oxidative stress, and antioxidant gene expression are induced by hepatitis C virus core protein. Gastroenterology 122, 366375.[CrossRef][Medline]

Penin, F., Dubuisson, J., Rey, F. A., Moradpour, D. & Pawlotsky, J. M. (2004). Structural biology of hepatitis C virus. Hepatology 39, 519.[CrossRef][Medline]

Pinna, G. F., Fiorucci, M., Reimund, J. M., Taquet, N., Arondel, Y. & Muller, C. D. (2004). Celastrol inhibits pro-inflammatory cytokine secretion in Crohn's disease biopsies. Biochem Biophys Res Commun 322, 778786.[CrossRef][Medline]

Polyak, S. J., Khabar, K. S., Paschal, D. M., Ezelle, H. J., Duverlie, G., Barber, G. N., Levy, D. E., Mukaida, N. & Gretch, D. R. (2001a). Hepatitis C virus nonstructural 5A protein induces interleukin-8, leading to partial inhibition of the interferon-induced antiviral response. J Virol 75, 60956106.[Abstract/Free Full Text]

Polyak, S. J., Khabar, K. S., Rezeiq, M. & Gretch, D. R. (2001b). Elevated levels of interleukin-8 in serum are associated with hepatitis C virus infection and resistance to interferon therapy. J Virol 75, 62096211.[Abstract/Free Full Text]

Ponzetto, A., Gennero, L., Cutufia, M., Beltramo, T., Enrietto, M., Pescarmona, P. & Pugliese, A. (2005). Effect of HCV infection on THP-1 monocytoid cells. Cell Biochem Funct 23, 347352.[CrossRef][Medline]

Radkowski, M., Bednarska, A., Horban, A., Stanczak, J., Wilkinson, J., Adair, D. M., Nowicki, M., Rakela, J. & Laskus, T. (2004). Infection of primary human macrophages with hepatitis C virus in vitro: induction of tumour necrosis factor-alpha and interleukin 8. J Gen Virol 85, 4759.[Abstract/Free Full Text]

Ray, R. B., Lagging, L. M., Meyer, K. & Ray, R. (1996a). Hepatitis C virus core protein cooperates with ras and transforms primary rat embryo fibroblasts to tumorigenic phenotype. J Virol 70, 44384443.[Abstract]

Ray, R. B., Meyer, K. & Ray, R. (1996b). Suppression of apoptotic cell death by hepatitis C virus core protein. Virology 226, 176182.[CrossRef][Medline]

Ray, R. B., Steele, R., Meyer, K. & Ray, R. (1998). Hepatitis C virus core protein represses p21WAF1/Cip1/Sid1 promoter activity. Gene 208, 331336.[CrossRef][Medline]

Sansonno, D., Iacobelli, A. R., Cornacchiulo, V., Iodice, G. & Dammacco, F. (1996). Detection of hepatitis C virus (HCV) proteins by immunofluorescence and HCV RNA genomic sequences by non-isotopic in situ hybridization in bone marrow and peripheral blood mononuclear cells of chronically HCV-infected patients. Clin Exp Immunol 103, 414421.[Medline]

Siavoshian, S., Abraham, J. D., Kieny, M. P. & Schuster, C. (2004). HCV core, NS3, NS5A and NS5B proteins modulate cell proliferation independently from p53 expression in hepatocarcinoma cell lines. Arch Virol 149, 323336.[CrossRef][Medline]

Soresi, M., Giannitrapani, L., D'Antona, F., Florena, A. M., La Spada, E., Terranova, A., Cervello, M., D'Alessandro, N. & Montalto, G. (2006). Interleukin-6 and its soluble receptor in patients with liver cirrhosis and hepatocellular carcinoma. World J Gastroenterol 12, 25632568.[Medline]

Vassilaki, N. & Mavromara, P. (2003). Two alternative translation mechanisms are responsible for the expression of the HCV ARFP/F/core+1 coding open reading frame. J Biol Chem 278, 4050340513.[Abstract/Free Full Text]

Wakita, T., Pietschmann, T., Kato, T., Date, T., Miyamoto, M., Zhao, Z., Murthy, K., Habermann, A., Krausslich, H. G. & other authors (2005). Production of infectious hepatitis C virus in tissue culture from a cloned viral genome. Nat Med 11, 791796.[CrossRef][Medline]

Walewski, J. L., Keller, T. R., Stump, D. D. & Branch, A. D. (2001). Evidence for a new hepatitis C virus antigen encoded in an overlapping reading frame. RNA 7, 710721.[Abstract]

Xu, Z., Choi, J., Yen, T. S., Lu, W., Strohecker, A., Govindarajan, S., Chien, D., Selby, M. J. & Ou, J. (2001). Synthesis of a novel hepatitis C virus protein by ribosomal frameshift. EMBO J 20, 38403848.[CrossRef][Medline]

Zhong, J., Gastaminza, P., Cheng, G., Kapadia, S., Kato, T., Burton, D. R., Wieland, S. F., Uprichard, S. L., Wakita, T. & Chisari, F. V. (2005). Robust hepatitis C virus infection in vitro. Proc Natl Acad Sci U S A 102, 92949299.[Abstract/Free Full Text]

Received 18 September 2006; accepted 14 December 2006.