Abstract
The integrongene cassette system confers on a bacterial cell the potential to accumulate diverse genes at a common locus. Integrons associated with plasmids or transposons have driven the evolution of multiple-antibiotic resistance in many Gram-negative pathogens due to their ability to capture, shuffle, express and disseminate antibiotic resistance genes. Recent observations indicate that integrons are frequently also associated with chromosomes in bacteria (Rowe-Magnus et al., 2001) and that the cassette pool available to these integrons is enormous (Holmes et al., 2003a). This raises questions as to the broader significance of integrons in bacterial evolution.
The Treponema denticola ATCC 35405T genome sequence contains a 65 kb region containing many ORFs hypothesized to have been acquired by lateral transfer (Seshadri et al., 2004). We have identified an unusual integron (termed InTde35405) covering 58 kb of this region (GenBank/EMBL/DDBJ accession no. NC_002967; 18170491874294). InTde35405 is the first example of an integron with a gene cassette array oriented in the same direction as the integrase gene, and we believe it to be the first example of a complete, intrinsically chromosomal integron outside the Proteobacteria.
The key functional components of an integron are a site-specific recombinase of the IntI family, its cognate recombination site (termed attI) and promoters for the expression of intI (Pint) and captured genes (PC). Collectively, these give an integron the potential to accumulate a gene cassette array and express the cassette-encoded genes (Hall & Collis, 1995). The Treponema gene Tde1844 has been previously identified as an intI homologue (Nield et al., 2001), with the closest relatives being integron integrases from Pseudomonas strains (Holmes et al., 2003b; Vaisvila et al., 2001) at 4749 % amino acid identity. The region between Tde1844 and Tde1843 includes a plausible attI/59-be (59-base element) junction (G^TT at 1873129 in GenBank/EMBL/DDBJ accession no. NC_002967) and two possible PC promoters: ttgcagcagtttagattgcaaattattggtttttatgctatagt (35 and 10 regions underlined).
We have found 45 gene cassettes (Tde1843 to Tde1773) associated with the Tde1844 integrase (Fig. 1). Unlike all previously identified integrons, the cassette array of InTde35405 is oriented in the same direction as the integrase. The defining feature of a gene cassette is a recombination site (59-be or attC) consisting of an imperfect inverted repeat containing integrase binding sites (Stokes et al., 1997). The Tde 59-bes conform to this general model (Fig. 2). In the majority (38/45) of the T. denticola 59-bes, the 1L and 1R ends of the inverted repeats (Fig. 2) match more closely in the predicted circular cassettes compared to the linear integrated cassettes. This feature is characteristic of IntI-assembled gene cassette arrays (Recchia & Hall, 1995), suggesting that InTde35405 is a functional integron. Integrons associated with chromosomes frequently have distinctive gene cassette arrays that share very similar 59-bes (Rowe-Magnus et al., 2001), and T. denticola follows this pattern, with 40 of the 45 gene cassettes containing 59-bes closely related to the example in Fig. 2. This group represents a possible Treponema denticola repeat family (Rowe-Magnus et al., 2001); however, we believe that multiple strains containing distinct arrays should be examined before attempting to define any such family.