Research Article

Changes in membrane lipid composition in ethanol- and acid-adapted Oenococcus oeni cells: characterization of the cfa gene by heterologous complementation

Microbiology 2008; 154(9):2611 · https://doi.org/10.1099/mic.0.2007/016238-0

View at publisher PubMed

With thanks to our partners for supporting this archive.

Abstract

Cyclopropane fatty acid (CFA) synthesis was investigated in Oenococcus oeni. The data obtained demonstrated that acid-grown cells or cells harvested in the stationary growth phase showed changes in fatty acid composition similar to those of ethanol-grown cells. An increase of the CFA content and a decrease of the oleic acid content were observed. The biosynthesis of CFAs from unsaturated fatty acid phospholipids is catalysed by CFA synthases. Quantitative real-time-PCR experiments were performed on the cfa gene of O. oeni, which encodes a putative CFA synthase. The level of cfa transcripts increased when cells were harvested in stationary phase and when cells were grown in the presence of ethanol or at low pH, suggesting transcriptional regulation of the cfa gene under different stress conditions. In contrast to Escherichia coli, only one functional promoter was identified upstream of the cfa gene of O. oeni. The function of the cfa gene was confirmed by complementation of a cfa-deficient E. coli strain. Nevertheless, the complementation remained partial because the conversion percentage of unsaturated fatty acids into CFA of the complemented strain was much lower than that of the wild-type strain. Moreover, a prevalence of cycC19 : 0 was observed in the membrane of the complemented strain. This could be due to a specific affinity of the CFA synthase from O. oeni. In spite of this partial complementation, the complemented strain of E. coli totally recovered its viability after ethanol shock (10 %, v/v) whereas its viability was only partly recovered after an acid shock at pH 3.0.
Abbreviations: CFA, cyclopropane fatty acid; QRT-PCR, quantitative reverse transcriptase PCR
Most prokaryotes are able to adapt to and survive fluctuations of environmental conditions by using multiple strategies that can operate simultaneously. To survive and function in wine, Oenococcus oeni requires the activation of a proton-extruding ATPase (Drici-Cachon et al., 1996; Salema et al., 1996) and the proton-motive force generated by malolactic fermentation. Nevertheless, two main strategies are also required and these seem to be conserved in most bacteria. The first one involves the induction of the expression of specific genes called heat-shock genes (hsp). The second strategy leads to membrane fluidity adjustments by modifications in membrane composition, generally affecting phospholipids and their fatty acid composition. Indeed, the cell membrane constitutes one of the first barriers against environmental stresses and consequently plays a major role in homeostasis and in adaptation to stress conditions (Jones, 1989; Sajbidor, 1997; Weber & de Bont, 1996). Bacteria can modify their fatty acid composition in response to atypical conditions (Cronan, 2002). The lipid structure and the portion of saturated, unsaturated, branched or cyclic fatty acids in individual phospholipids influences the fluidity of biological membranes.

Many studies have focused on the deleterious effect of ethanol on membrane modifications in micro-organisms (Dombek & Ingram, 1984; Guzzo et al., 2000; Svobodova & Svoboda, 1988; Swan & Watson, 1997). In Escherichia coli, one of the changes that occur in membrane lipid composition in response to ethanol is an increase in the amount of unsaturated fatty acid (Ingram, 1976). During acetone-butanol fermentation, modifications in the unsaturated/saturated fatty acid ratio were found in Clostridium acetobutylicum cell membranes (Lepage et al., 1987). The unsaturated fatty acid acyl chains of bacterial membrane phospholipids have a major influence on membrane properties. In cistrans isomerization, catalysed by a cis–trans isomerase, the double bond is reconfigured. The cis unsaturated chain contains a bend which increases membrane fluidity, whereas the trans isomer increases membrane rigidity. Loffeld & Keweloh (1996) suggested that the isomerization of cis into trans unsaturated fatty acids is an emergency action of cells of Pseudomonas putida to adapt membrane fluidity to drastic changes in environmental conditions.

An opposite effect in response to ethanol is observed in other micro-organisms (Rigomier et al., 1980; Teixeira et al., 2002). An increase in the content of saturated fatty acids is observed in Bacillus subtilis (Rigomier et al., 1980). A mechanism involved in the increase of saturated fatty acids is the conversion of monounsaturated fatty acids to cyclopropane fatty acids (CFAs). CFAs have been detected in membrane phospholipids of a variety of eubacteria (Grogan & Cronan, 1997). These CFAs are synthesized in situ by the transfer of a methylene group from S-adenosyl-L-methionine to a double bond of unsaturated fatty acid chains of membrane phospholipids by CFA synthase. Conversion of monounsaturated fatty acids to CFAs has been reported in many Gram-negative bacteria when the growth rate of cultures is markedly slowed, i.e. during the stationary phase of growth. In E. coli, the synthesis of CFAs is generally regarded as a means to reduce membrane fluidity and prevent the penetration of undesirable molecules in order to adapt the cells to adverse conditions (Chang & Cronan, 1999; Grogan & Cronan, 1997). The positive roles of CFAs have also been demonstrated in bacterial cells adapted to high acidity (Brown et al., 1997; Teixeira et al., 2002). cfa-deficient cells of E. coli and Salmonella enterica serovar Typhimurium (S. typhimurium) are highly sensitive to acid stress (Chang & Cronan, 1999; Kim et al., 2005). In the Gram-positive bacterium C. acetobutylicum, the CFA content detected in early-exponential-phase cells enhanced acid and solvent resistance (Zhao et al., 2003). In O. oeni, cells respond to culture in the presence of ethanol by increasing their CFA content (Teixeira et al., 2002). The presence of CFAs in the membrane could reduce proton permeability (da Silveira et al., 2002) and increase membrane rigidity (da Silveira et al., 2003). Nevertheless, the mechanisms involved in membrane fluidity adjustments in this bacterium remain unclear.

In E. coli, the onset of CFA synthesis as cultures enter stationary phase is due to increased transcription of cfa from the RpoS-dependent promoter, whereas a standard RpoD-dependent promoter is responsible for the low level of CFA synthesis in exponentially growing cultures (Chang & Cronan, 1999). In Lactococcus lactis, transcriptional fusion experiments have demonstrated high induction of cfa gene expression by acidity as well as during entry into the stationary phase of growth (Budin-Verneuil et al., 2005). The cfa gene of C. acetobutylicum appears to form an independent operon with a marR-homologous gene. The MarR-like gene product may act to reduce expression of the cfa gene directly or indirectly, based on the observation that the overexpression of marR resulted in decreased CFA accumulation (Zhao et al., 2003).

In this work, we analysed the membrane fatty acid composition of O. oeni in three conditions of stress: entry into the stationary phase of growth, and growth in the presence of ethanol or in acidic conditions. In all three conditions, we observed a decrease of the ratio of unsaturated to saturated fatty acids and an increase of CFA content. These results led us to study the level of transcription of the cfa gene of O. oeni in stress conditions. By complementation of an E. coli cfa mutant, we investigated the functionality of the cfa gene of O. oeni.

Bacterial strains and media.
O. oeni ATCC BAA-1163 (formerly O. oeni IOB 8413) was cultured at 30 °C in modified FT80 (mFT80) medium (Cavin et al., 1989) at pH 5.3. The E. coli strains used were derivatives of E. coli K-12. E. coli ER2738 [F' proA+B+ lacIq ΔlacZM15 zzf : : Tn10(TetR)/fhuA2 glnV thi-1 Δ(lac–proAB) Δ(hsdS–mcrB)5] (New England Biolabs) was used for cloning procedures. E. coli MG1655 (F λ ilvG rfb-50 rph-1) and E. coli YYC1273 (MG1655 cfa : : kan) were used to confirm the function of the O. oeni cfa gene (Chang & Cronan, 1999; Jensen, 1993). E. coli strains were grown aerobically at 37 °C in Luria–Bertani (LB) medium or in Tryptone Soya Broth medium (TSB, Biokar) (Bertani, 1951). For recombinant strains, the medium was appropriately supplemented with ampicillin (100 µg ml–1) or kanamycin (25 µg ml–1).

Growth in sublethal stress conditions, and acid and ethanol shocks.
Precultures of O. oeni were used to inoculate mFT80 medium at an initial OD600 of 0.1. To obtain control cells, exponential-phase cells were harvested when an OD600 of 0.7 was reached at pH 5.3. Stationary-phase cells were harvested after 36 h incubation in the same medium. For ethanol- and acid-grown cells, O. oeni was inoculated at the same OD600 of 0.1 in mFT80 with 8 % (v/v) ethanol and at pH 3.5, respectively. Stress-grown cells were harvested from their exponential growth phase after 36 and 31 h of growth with 8 % ethanol and at pH 3.5, respectively.

To test resistance to ethanol and acidity, E. coli strains were cultivated in TSB medium to late-stationary phase (15 h) and 1 ml samples of cultures were harvested by centrifugation at room temperature. The cells were then washed with TSB medium and resuspended in 1 ml TSB medium at pH 3 (adjusted with HCl) or TSB supplemented with ethanol 10 % (v/v) for challenge. The cell suspensions were shaken at 37 °C and aliquots were collected at timed intervals (1, 2 and 3 h), and viable counts were measured by serial dilution and plating on LB agar supplemented with ampicillin. Survival is defined as the ratio of colonies (c.f.u.) formed on LB agar medium after challenges to the initial number of viable colonies.

Lipid analysis.
Bacterial cells were taken from exponential-phase cultures under optimal conditions, in the presence of 8 % ethanol, and at pH 3.5. Total lipids were extracted with chloroform/methanol according to the method described by Bligh & Dyer (1959). Phospholipids were purified by TLC on silica gel plates (Merck) with hexane/diethyl ether/methanol/acetic acid (90/20/3/2, by vol.) for development. The phospholipid band was scraped off and extracted from the silica gel with chloroform/methanol/water (45/45/10, by vol.). The fatty acids of total lipids and phospholipids were directly transesterified with methanol/H2SO4 (95/5, v/v) at 80 °C for 2 h. Total fatty acids were quantified by adding C17 : 0 (heptadecanoic acid) as an internal standard. The fatty acid methyl esters (FAMEs) were analysed by GLC using a Chrompack CP 9002 chromatograph equipped with a Varian Factor Four capillary column (30 mx0.32 mm). The oven temperature increased after 1 min from 60 °C to 150 °C at 30 °C min–1 for 3 min then to 220 °C at 2 °C min–1. The FAMEs were identified by comparing retention times with those of authentic standards (Nu Chek Prep., Elysian, MN, USA).

RNA extraction and analysis.
RNA extraction was performed using Tri Reagent (Sigma) according to the manufacturer's instructions and 0.4 g of glass beads (70–100 µm) to disrupt cells with a FastPrep cell disintegrator (Bio 101). Samples were then treated as recommended by the manufacturer and used for Northern blotting, primer extension analysis, reverse transcriptase PCR (RT-PCR) or quantitative RT-PCR (QRT-PCR) experiments. Northern blotting was carried out as described by Sambrook et al. (1989). A DNA fragment corresponding to the O. oeni cfa gene was amplified by PCR using oligonucleotides L1 (TGGTATTACATTGAGCGAGGAG) and R1 (GGATTATCGTGATCTCAAAGACG) and used as a probe in Northern hybridization experiments. PCR was performed in a final volume of 50 µl containing O. oeni genomic DNA (1 µg ml–1), dNTPs (0.2 mM each), oligonucleotides (1 mM each), 10 U ml–1 of Taq DNA polymerase (Bioline), and the buffer supplied with the enzyme. Amplification was performed for 35 cycles consisting of 30 s denaturation at 92 °C, 30 s annealing at 60 °C, and 30 s elongation at 72 °C. The PCR products were purified by using the Qiaquick PCR purification kit (Qiagen) and probe was radiolabelled with [α-32P]dATP using a random primers DNA labelling kit (Invitrogen). Primer extensions were performed as previously described (Grandvalet et al., 2005) with oligonucleotides cfa2C (TTTTGGCTTACCAGTCCCATAA) and cfa4C (CGGTCTTACCATCCCAATAAG). The corresponding DNA-sequencing reactions were carried out by using the same oligonucleotides and PCR-amplified DNA fragments with oligonucleotides cfa1C (CTTGTTTTAATTTTCACTTTTATTG) and cfa2C, carrying the cfa promoter region. Nucleotide sequences were determined by the dideoxy chain-termination method using the DNA sequencing cycle Reader kit (MBI Fermentas). RT-PCR and QRT-PCR were performed as previously described (Grandvalet et al., 2005) using the primer pair L1 and R1. The specificity of QRT-PCR products was determined with a melting curve. The efficiency of real-time amplification is calculated by the formula E=[10(1/–s)–1]x100, where s is the slope of standard curve. Three independent experiments were performed and the results were calculated by the comparative critical threshold (ΔΔCT) method, in which the amount of target RNA is adjusted to a reference relative to an internal calibrated target RNA. The ldhD gene of O. oeni was chosen as an internal control for these experiments (Desroche et al., 2005).

DNA isolation, manipulation and transformation
Cloning of the cfa gene from O. oeni.
The cfa gene was cloned by PCR amplification from O. oeni ATCC BAA-1163 chromosomal DNA using oligonucleotides cfa4M (CCCGGATCCTTCATTTTAATTAAAAAAAATAAAATTTT) and cfa5M (GGGGAATTCTCTTGTTTCCTTTTTTTAGAAAATT). BamHI and EcoRI sites (italic) were included to aid subsequent manipulations. The PCR was performed by using Taq ADN polymerase high-fidelity Platinum (Invitrogen) as recommended by the manufacturer in order to minimize errors during polymerization. The resulting fragment carrying the whole cfa gene, including the promoter region and the terminator, was ligated to the corresponding cloning sites of pUC18 (Invitrogen) after digestion with BamHI and EcoRI, to form pMT1. This construct put the O. oeni cfa gene under control of its own promoter region. The sequence of the cloned PCR amplification product was confirmed by DNA sequencing (GENOME express). Plasmid pMT1 was used to transform the cfa-deficient E. coli strain YYC1273 and the wild-type E. coli strain MG1655. Transformation of E. coli was conducted by electroporation.

Sequence and statistical analysis.
Sequence alignments were performed with CLUSTAL W (Kohli & Bachhawat, 2003). The significance of the difference between cell viability percentages and total fatty acid amounts was determined by a two-tailed Student's t test. The confidence interval for a difference in the means was set at 95 % (P≤0.05) for all comparisons.

Changes in membrane fatty acid composition in stationary-phase and in stress-grown O. oeni
Two sublethal stress conditions were chosen to obtain stress-grown O. oeni cells: cultures in the presence of 8 % (v/v) ethanol and at pH 3.5. The concentration of 8 % ethanol was chosen as a hinge value: the main changes observed normally occurred in cells grown in the presence of at least 8 % ethanol in the medium (Teixeira et al., 2002). The control cells were harvested in the exponential phase of growth, when an OD600 of 0.7 was reached after 12 h of incubation. Stationary-phase cells were harvested after 36 h of incubation (maximal OD600 of 1.6). Stress-grown cells were harvested from their exponential growth phase (OD600 of 0.7) after 36 and 31 h of growth with 8 % ethanol and at pH 3.5, respectively. The maximal OD600 values reached by cultures in the presence of ethanol or at pH 3.5 were 1.0 and 1.2, respectively. The Neperian specific growth rate (µ) of cells cultured under optimal conditions was 0.16 h–1 whereas that of cells cultured in the presence of 8 % ethanol and at pH 3.5 significantly decreased to the same value of 0.05 h–1. Nevertheless, the final biomass obtained by growth in sublethal stress conditions represented approximately 75 % of the final biomass obtained in optimal conditions (data not shown).

We determined the fatty acid composition of the total lipids and the phospholipid fraction extracted from O. oeni cells grown under optimal conditions. The fatty acid profile of phospholipids was similar to that of total fatty acids and accounted for nearly 94 % (w/w) of the total fatty acids. From then on, fatty acid analyses were carried out only on the total lipid extract. In O. oeni control cells (mid-exponential growth phase), eight main fatty acids were identified (Fig. 1); these represented 90 mol% of total fatty acids. The higher amount of oleic (C18 : 1 n-9) and dihydrosterculic (cycC19 : 0 n-9) acids compared to that of cis-vaccenic (C18 : 1 n-7) and lactobacillic (cycC19 : 0 n-7) acids was in accordance with the presence of Tween 80 in the O. oeni culture medium (Guerrini et al., 2002; Lonvaud-Funel & Desens, 1990).



(24K):

Fig. 1. Fatty acid composition of O. oeni cells during growth in mFT80 medium under optimal conditions (exponential-phase cells, stationary-phase cells), in the presence of 8 % (v/v) ethanol (ethanol-grown cells) or in medium at pH 3.5 (acid-grown cells). Stress-grown cells were harvested for analyses from their exponential growth phase. Means±SD are presented (n=3).

In the stationary phase of growth, the levels of major saturated fatty acids [myristic (C14 : 0) and palmitic (C16 : 0)] remained constant. In contrast, we observed a decrease in unsaturated fatty acids, particularly oleic acid, which is the main unsaturated fatty acid present in the medium. Moreover, the main effect on the fatty acid profile was an increase in the molar percentage of dihydrosterculic acid.

In cells grown in the presence of 8 % ethanol, the membrane fatty acid profile dramatically altered compared to that of control cells. There was an increase in the molar percentage of the saturated palmitic (C16 : 0) and cyclopropane dihydrosterculic (cycC19 : 0 n-9) acids, and a decrease in that of the monounsaturated palmitoleic (C16 : 1) and oleic acids (Fig. 1). The amount of total fatty acids dropped by twofold in comparison with that of control cells (Table 1).


Table 1. Analysis of fatty acid profiles of O. oeni cells grown under different conditions Cells were cultured in mFT80 medium under optimal conditions (exponential-phase cells, stationary-phase cells), or under stress conditions (8 %, v/v, ethanol or pH 3.5).


In cells grown under acid conditions (pH 3.5), we observed similar changes in membrane fatty acid profile as those observed in ethanol-grown cells but of smaller amplitude (Fig. 1). The ratio of unsaturated to saturated fatty acids dropped by fivefold compared to that of control cells. The total fatty acid content was only one-third of that of control cells (Table 1).

Expression of the O. oeni cfa gene increases at the onset of stationary phase and in stress growth conditions
The biosynthesis of CFAs from unsaturated fatty acid phospholipids is catalysed by CFA synthases (Grogan & Cronan, 1997). The genome sequence of O. oeni ATCC BAA-1163, (accession no. NZ_AAUV00000000) revealed an ORF (locus_tag: OENOO_64048) encoding a 45 kDa protein sharing 45 % amino acid sequence identity with CFA synthase from Clostridium acetobutylicum (Zhao et al., 2003) and 29 % identity with CFA synthase from E. coli (Grogan & Cronan, 1984) and S. typhimurium (Kim et al., 2005). This putative O. oeni cfa gene is flanked by two genes (locus_tag OENOO_64049 and OENOO_64046) transcribed in the same orientation as cfa (Fig. 2b). The gene upstream of cfa (OENOO_64049) encodes a putative permease protein of an ABC transporter system, whereas the downstream gene (OENOO_64046 annotated ubiD) encodes a 3-octaprenyl-4-hydroxybenzoate carboxy-lyase. We noted that the genome sequence of O. oeni PSU-1 (accession no. NC_008528.1) contains an ORF (OEOE_1175) between cfa and ubiD, transcribed divergently. This putative gene encodes a 304 aa protein similar to a transcriptional regulator of the LysR family. This ORF is also present in the O. oeni ATCC BAA-1163 genome (OENOO_64047), but it has not been annotated because of the presence of a frameshift which is due to a sequencing error (data not shown). Using the software application Mfold web server () (Mathews et al., 1999; Zuker, 2003), we identified a putative rho-independent transcription terminator downstream of cfa (Tcfa, ΔG0=11.2 kcal mol–1; –46.9 kJ mol–1) and another one downstream of OENOO_64049 (T64049, ΔG0=–15.6 kcal mol–1; –65.3 kJ mol–1), suggesting monocistronic expression of cfa (Fig. 2b). The expression of the cfa gene was investigated by Northern blotting. A 1.2 kb transcript was detected, corresponding to the size expected for monocistronic expression of cfa (data not shown). The 5'-end mRNA of cfa was mapped by primer extension analysis (Fig. 2a). The transcriptional start site was identified at nucleotide position –22, with reference to the presumed ATG translational start codon. This transcriptional start site was preceded by a putative –10 (TACGAT) hexamer, which showed similarity to the consensus of –10 sequences usually described for O. oeni promoters. No putative –35 hexamer was identified at an appropriate distance from this putative –10 box. Nevertheless, a supplementary sequence element, 5'-TG-3', is located one base upstream of the –10 hexamer (Fig. 2b). To examine whether expression of cfa is induced during growth in stress conditions, a QRT-PCR was set up. Total RNA was extracted from exponential- (control) and stationary-phase O. oeni cells grown under optimal growth conditions and from exponential-phase cells grown in the presence of 8 % (v/v) ethanol (ethanol-grown cells) and at pH 3.5 (acid-grown cells). By using the comparative critical threshold (ΔΔCT) method with the ldhD gene of O. oeni as an internal control (Desroche et al., 2005), we found that the cfa mRNA levels increased by three-, six- and twofold in stationary-phase, ethanol- and acid-grown cells, respectively, in comparison with that of control cells.



(32K):

Fig. 2. Determination of the transcription initiation site of the cfa gene by primer extension analysis. Total RNA was extracted from O. oeni cells harvested in the exponential phase. (a) Primer extension product corresponding to the cfa gene (lane ext) is shown alongside DNA-sequencing reaction products (lanes T, G, C and A). The corresponding nucleotide sequence is shown on the left. (b) Map of the cfa genomic region. The transcriptional start site is indicated by an asterisk, the –10 sequence is boxed, the TG sequence element is underlined, the presumed ATG translational start codon is shaded and the putative rho-independent transcription terminators of cfa and OENOO_64049 genes are labelled Tcfa and T64049, respectively.

Expression of the O. oeni cfa gene restores the synthesis of CFA in an E. coli cfa mutant
Because no genetic tool adapted to carry out gene inactivation in O. oeni is yet available, the function of the O. oeni cfa gene was explored in the cfa-deficient mutant strain E. coli YYC1273 (Chang & Cronan, 1999). The O. oeni cfa gene, its promoter region included, was cloned into the pUC18 vector to generate pMT1, which was introduced into strain YYC1273 (YYC1273/pMT1). Before analysing the phenotype of the complemented strain, the heterologous expression of the O. oeni cfa gene in E. coli was verified. cfa transcripts were detected in E. coli YYC1273/pMT1 (data not shown) by RT-PCR analysis. Moreover, primer extension analysis confirmed that the cfa promoter of O. oeni was recognized by the E. coli transcriptional machinery (data not shown).

The viabilities of late-stationary-phase cultures of E. coli strains exposed to ethanol shock (10 %, v/v) and acid shock (pH 3.0) were measured. As previously described (Chang & Cronan, 1999; Grogan & Cronan, 1986), the E. coli cfa-deficient strain poorly survived ethanol or acid shock (Table 2). The control strains MG1655/pMT1 and YYC1273/pUC18 were also examined and no significant differences in percentage survival were noticed after ethanol and acid shocks in comparison with strains MG1655 and YYC1273, respectively (data not shown). As shown in Table 2, pMT1 could complement the cfa-deficient strain of E. coli when cells were exposed to ethanol. However, the presence of pMT1 only partially restored the acid resistance observed in the wild-type strain.


Table 2. Ethanol and acid survival of E. coli strains


Previous studies showed that E. coli strains carrying the cfa : : kan mutation lacked detectable CFA synthase activity and made no CFA detectable by gas chromatography (Cronan et al., 1974; Grogan & Cronan, 1986). So, to explore the capacity of the O. oeni CFA synthase to promote the cyclopropanation of double bonds of E. coli unsaturated fatty acids, the composition of membrane fatty acids of E. coli strains was analysed (Table 3). The analysis of fatty acid composition of the wild-type strain E. coli (MG1655) revealed the presence of myristic acid (C14 : 0), palmitic acid (C16 : 0), palmitoleic acid (C16 : 1) and cis-vaccenic acid (C18 : 1, n-7). We also noted the presence of CFAs such as cycC17 : 0 and lactobacillic acid (cycC19 : 0 n-7). Palmitic acid (C16 : 0) accounted for 58 % of the total fatty acids identified whereas the monounsaturated fatty acid proportion was low (about 1 %). The CFAs accounted for 31 % of the total fatty acids identified; cycC17 : 0 alone accounted for more than 24 % of the total. Consistent with previous reports, no CFA was detected in the E. coli cfa-deficient strain YYC1273 and the proportion of monounsaturated precursors was higher (41 %) than in the wild-type strain (1 %). Fatty acid analysis of the complemented strain YYC1273/pMT1 revealed a shift in the fatty acid composition of the cell membrane compared to the mutant strain. This result confirmed the capacity of the O. oeni CFA synthase to convert unsaturated fatty acids to CFAs in E. coli. However, the CFA level in the complemented strain (7 %) was lower than that of the wild-type strain (31 %). Thus, the incomplete restoration of acid resistance may be due to the deficiency of CFA in membranes of cells or to the modification of the unsaturated/saturated fatty acids ratio. Moreover, in contrast to the wild-type strain, the membrane of the complemented strain contained more cycC19 : 0 (n-7) than cycC17 : 0.


Table 3. Effect of cfa-bearing plasmid pMT1 on E. coli fatty acid composition

In this study, we found that, like other bacteria, O. oeni produces CFAs at the beginning of the stationary phase. Moreover, we showed that environmental factors such as ethanol- and acid-growth conditions induce CFA synthesis. Biomembranes are the site of the primary contact of cells with their environment: the flexibility and the adaptation capability of the cells thus determine their survival ability. Membrane lipid and protein compositions are recognized as some of the main factors involved in stress tolerance (da Silveira et al., 2003, 2004; Jones, 1989). Membrane lipid composition changes are induced in response to temperature, pH, solvents and other forms of stress (Dombek & Ingram, 1984; Gennis, 1989; Jones, 1989). In the present work, we observed significant increases in palmitic and dihydrosterculic acids in both ethanol- and acid-grown cells. According to the mechanisms for cyclopropane ring formation in membrane lipids proposed by Grogan & Cronan (1997), we can suggest that oleic and vaccenic acids would be converted into cyclopropane dihydrosterculic and lactobacillic acids, respectively. In E. coli, strains with high levels of CFAs survived acid shock much better than those with low CFA levels (Brown et al., 1997). The cyclization of fatty acyl chains is generally considered a means of reducing membrane fluidity, thereby reducing proton permeability and preventing the penetration of undesirable molecules in order to adapt the cells to adverse conditions (Chang & Cronan, 1999; Cronan, 2002; Grogan & Cronan, 1997). Teixeira et al. (2002) observed an increase in the proportion of lactobacillic acid at the expense of cis-vaccenic acid in O. oeni. This increase protected O. oeni against the toxic effect of ethanol, balancing the increase in membrane fluidity normally attributed to ethanol. In our study, the increases in palmitic and dihydrosterculic acids led to an increased degree of fatty acid saturation in both ethanol- and acid-grown cells. It should be noted that da Silveira et al. (2003) observed an increase in the degree of unsaturation in cells grown with ethanol. However, in that work, CFAs were not detected. This discrepancy could reflect the variability among O. oeni strains, with other resistance mechanisms to the presence of ethanol as previously observed in E. coli (Ingram, 1976) and Saccharomyces cerevisiae (Swan & Watson, 1997).

We cloned a cfa gene, predicted to encode a CFA synthase, from O. oeni. To understand the mechanisms involved in the conversion of monounsaturated fatty acids to CFAs in stationary-phase or in stress-grown cells, we quantified the mRNA of the cfa gene in O. oeni at two phases of growth in optimal conditions (exponential and stationary phases) and in cells grown in the presence of ethanol (8 %, v/v) and at low pH (pH 3.5). The increased amounts of cfa mRNA transcripts correlated with the increased amount of CFA in the membrane and suggest that the expression of this gene could be regulated at the transcriptional level as previously described in E. coli (Chang & Cronan, 1999). The E. coli cfa gene is controlled by the σS factor, which governs the general stress response to a number of environmental stimuli, including starvation, acid shock or osmotic stress. In L. lactis, the expression of cfa is induced by acidity as well as during entry into the stationary phase of growth (Budin-Verneuil et al., 2005). The mechanism involved in the control of cfa expression has not yet been elucidated. In C. acetobutylicum, Zhao et al. (2003) identified a marR-homologous gene preceding cfa whose overexpression resulted in reduced CFA accumulation in cell membranes. The majority of MarR protein family members are transcriptional repressors. So, the cfa gene of C. acetobutylicum could be controlled by the product of the marR-like gene. Analysis of the O. oeni cfa promoter did not identify a putative –35 hexamer at an appropriate distance from the putative –10 hexamer that was identified. Nevertheless, a supplementary sequence element, 5'-TG-3', is located one base upstream of the –10 hexamer. A number of activator-independent promoters have been reported where specific –35 hexamer contacts are not required for transcription initiation (Barne et al., 1997). Transcription initiation at these promoters is dependent on an extended –10 element, 5'-TGnTATAAT-3', which appears to create alternative contact points for the σ subunit of RNA polymerase. In O. oeni ATCC BAA-1163, the ORF downstream of cfa (locus tag OENOO_64047 vs OEOE_1175 in O. oeni PSU-1), transcribed divergently, encodes a putative transcriptional regulator similar to LysR family members. This ORF could constitute a potential transcriptional regulator of cfa. Future studies will focus on the characterization of this gene.

No genetic tool adapted to carry out gene inactivation in O. oeni is yet available. In order to confirm the functionality of the O. oeni cfa gene, complementation experiments with an E. coli cfa-deficient mutant were conducted. The presence of CFAs significantly increased stress tolerance of the complemented strain in comparison to the cfa-deficient strain. The complemented strain totally recovered its viability after ethanol shock, whereas its viability was only partly recovered for acid shock. These results suggest that the stabilizing effect of CFAs on cell membranes could differ depending on the nature of the shock. Kim et al. (2005) suggested that the incomplete restoration of acid resistance they observed in S. typhimurium might have been due to a deficiency of unsaturated fatty acids (UFAs) in the cell membrane due to the overexpression of CFA synthase. We considered this hypothesis for O. oeni. Nevertheless, our results suggest that the complementation in our experiments remained partial because the percentage conversion of UFAs into CFAs of the complemented strain was much lower than that of the wild-type strain. This could be explained by several factors. (i) The CFA synthase level was too low for a total conversion of UFAs into CFAs. The reduced level of CFA synthase could be caused by the expression of a heterologous gene in E. coli cells. (ii) Another explanation could be linked to substrate specificity. In the E. coli mutant strain complemented with the O. oeni cfa gene, the major CFA of the membrane was lactobacillic acid (cycC19 : 0 n-7) whereas the major membrane CFA of the wild-type E. coli strain was cycC17 : 0. We did not detect the presence of cycC17 : 0 in the O. oeni membrane. Its unsaturated fatty acid precursor (C16 : 1) was converted preferentially into the corresponding saturated fatty acid (C16 : 0), most probably by a saturase enzyme. It is noteworthy that cycC19 : 0 was the major CFA in the O. oeni membrane; it could account for 25 % of membrane fatty acids of O. oeni cells cultured under stress conditions. In contrast, cycC17 : 0 was the major CFA in E. coli: most palmitoleic acid (C16 : 1) was cyclized into cycC17 : 0 (Brown et al., 1997). We detected two CFAs in O. oeni (cycC19 : 0 and cycC17 : 0), of which cycC19 : 0 accounted for the major part. In spite of the high proportion of C16 : 1, only a low amount of cycC17 : 0 was produced by the O. oeni CFA synthase. The prevalence of cycC19 : 0 in the membrane of the complemented strain could be due to a higher affinity of the O. oeni enzyme for its natural substrate.

This study demonstrates clearly the functionality of the cfa gene and suggests that it is regulated at the transcriptional level. Further investigation is needed in order to identify the regulators involved. The substrate specificity of the CFA synthase in O. oeni also needs to be elucidated.

We thank Dr Dominique Garmyn for his critical reading of the manuscript and Dr Mary Bouley for her reading of the English text. This work was supported by the Ministère de l'Education nationale, de l'Enseignement supérieur et de la Recherche (France), the Conseil Régional de Bourgogne and the Vietnamese Ministry of Education and Training.

Edited by: D. A. Mills

References

Barne, K. A., Bown, J. A., Busby, S. J. & Minchin, S. D. (1997). Region 2.5 of the Escherichia coli RNA polymerase σ70 subunit is responsible for the recognition of the extended –10 motif at promoters. EMBO J 16, 4034–4040.[CrossRef][Medline]

Bertani, G. (1951). Studies on lysogenesis. I. The mode of phage liberation by lysogenic Escherichia coli. J Bacteriol 62, 293–300.[Free Full Text]

Bligh, E. G. & Dyer, W. J. (1959). A rapid method of total lipid extraction and purification. Can J Biochem Physiol 37, 911–917.[Medline]

Brown, J. L., Ross, T., McMeekin, T. A. & Nichols, P. D. (1997). Acid habituation of Escherichia coli and the potential role of cyclopropane fatty acids in low pH tolerance. Int J Food Microbiol 37, 163–173.[CrossRef][Medline]

Budin-Verneuil, A., Maguin, E., Auffray, Y., Ehrlich, S. D. & Pichereau, V. (2005). Transcriptional analysis of the cyclopropane fatty acid synthase gene of Lactococcus lactis MG1363 at low pH. FEMS Microbiol Lett 250, 189–194.[CrossRef][Medline]

Cavin, J. F., Prevost, H., Lin, J., Schmitt, P. & Divies, C. (1989). Medium for screening Leuconostoc oenos strains defective in malolactic fermentation. Appl Environ Microbiol 55, 751–753.[Abstract/Free Full Text]

Chang, Y. Y. & Cronan, J. E., Jr (1999). Membrane cyclopropane fatty acid content is a major factor in acid resistance of Escherichia coli. Mol Microbiol 33, 249–259.[CrossRef][Medline]

Cronan, J. E., Jr (2002). Phospholipid modifications in bacteria. Curr Opin Microbiol 5, 202–205.[CrossRef][Medline]

Cronan, J. E., Jr, Nunn, W. D. & Batchelor, J. G. (1974). Studies on the biosynthesis of cyclopropane fatty acids in Escherichia coli. Biochim Biophys Acta 348, 63–75.[Medline]

da Silveira, M. G., Vitoria San Romao, M., Loureiro-Dias, M. C., Rombouts, F. M. & Abee, T. (2002). Flow cytometric assessment of membrane integrity of ethanol-stressed Oenococcus oeni cells. Appl Environ Microbiol 68, 6087–6093.[Abstract/Free Full Text]

da Silveira, M. G., Golovina, E. A., Hoekstra, F. A., Rombouts, F. M. & Abee, T. (2003). Membrane fluidity adjustments in ethanol-stressed Oenococcus oeni cells. Appl Environ Microbiol 69, 5826–5832.[Abstract/Free Full Text]

da Silveira, M. G., Baumgartner, M., Rombouts, F. M. & Abee, T. (2004). Effect of adaptation to ethanol on cytoplasmic and membrane protein profiles of Oenococcus oeni. Appl Environ Microbiol 70, 2748–2755.[Abstract/Free Full Text]

Desroche, N., Beltramo, C. & Guzzo, J. (2005). Determination of an internal control to apply reverse transcription quantitative PCR to study stress response in the lactic acid bacterium Oenococcus oeni. J Microbiol Methods 60, 325–333.[CrossRef][Medline]

Dombek, K. M. & Ingram, L. O. (1984). Effects of ethanol on the Escherichia coli plasma membrane. J Bacteriol 157, 233–239.[Abstract/Free Full Text]

Drici-Cachon, Z., Cavin, J. F. & Diviès, C. (1996). Effect of pH and age of culture on cellular fatty acid composition of Leuconostoc oenos. Lett Appl Microbiol 22, 331–334.[CrossRef]

Gennis, R. B. (1989). Membrane dynamics and protein–lipid interactions. In Biomembranes: Molecular Structure and Function, pp. 166–198. Edited by C. R. Cantor. New York: Springer-Verlag.

Grandvalet, C., Coucheney, F., Beltramo, C. & Guzzo, J. (2005). CtsR is the master regulator of stress response gene expression in Oenococcus oeni. J Bacteriol 187, 5614–5623.[Abstract/Free Full Text]

Grogan, D. W. & Cronan, J. E., Jr (1984). Cloning and manipulation of the Escherichia coli cyclopropane fatty acid synthase gene: physiological aspects of enzyme overproduction. J Bacteriol 158, 286–295.[Abstract/Free Full Text]

Grogan, D. W. & Cronan, J. E., Jr (1986). Characterization of Escherichia coli mutants completely defective in synthesis of cyclopropane fatty acids. J Bacteriol 166, 872–877.[Abstract/Free Full Text]

Grogan, D. W. & Cronan, J. E., Jr (1997). Cyclopropane ring formation in membrane lipids of bacteria. Microbiol Mol Biol Rev 61, 429–441.[Abstract/Free Full Text]

Guerrini, S., Bastianini, A., Granchi, L. & Vincenzini, M. (2002). Effect of oleic acid on Oenococcus oeni strains and malolactic fermentation in wine. Curr Microbiol 44, 5–9.[CrossRef][Medline]

Guzzo, J., Jobin, M. P., Delmas, F., Fortier, L. C., Garmyn, D., Tourdot-Marechal, R., Lee, B. & Divies, C. (2000). Regulation of stress response in Oenococcus oeni as a function of environmental changes and growth phase. Int J Food Microbiol 55, 27–31.[CrossRef][Medline]

Ingram, L. O. (1976). Adaptation of membrane lipids to alcohols. J Bacteriol 125, 670–678.[Abstract/Free Full Text]

Jensen, K. F. (1993). The Escherichia coli K-12 "wild types" W3110 and MG1655 have an rph frameshift mutation that leads to pyrimidine starvation due to low pyrE expression levels. J Bacteriol 175, 3401–3407.[Abstract/Free Full Text]

Jones, R. P. (1989). Biological principles for the effects of ethanol. Enzyme Microb Technol 11, 130–153.[CrossRef]

Kim, B. H., Kim, S., Kim, H. G., Lee, J., Lee, I. S. & Park, Y. K. (2005). The formation of cyclopropane fatty acids in Salmonella enterica serovar Typhimurium. Microbiology 151, 209–218.[Abstract/Free Full Text]

Kohli, D. K. & Bachhawat, A. K. (2003). CLOURE: CLUSTAL Output Reformatter, a program for reformatting CLUSTAL_X/CLUSTAL W outputs for SNP analysis and molecular systematics. Nucleic Acids Res 31, 3501–3502.[Abstract/Free Full Text]

Lepage, C., Fayolle, F., Hermann, M. & Vandecasteele, J.-P. (1987). Changes in membrane lipid composition of Clostridium acetobutylicum during acetone-butanol fermentation: effects of solvents, growth temperature and pH. J Gen Microbiol 133, 103–110.[Abstract/Free Full Text]

Loffeld, B. & Keweloh, H. (1996). cis/trans isomerization of unsaturated fatty acids as possible control mechanism of membrane fluidity in Pseudomonas putida P8. Lipids 31, 811–815.[Medline]

Lonvaud-Funel, A. & Desens, C. (1990). Constitution en acides gras des membranes des bactéries lactiques du vin. Incidences des conditions de culture. Sci Aliments 10, 817–829.

Mathews, D. H., Sabina, J., Zuker, M. & Turner, D. H. (1999). Expanded sequence dependence of thermodynamic parameters improves prediction of RNA secondary structure. J Mol Biol 288, 911–940.[CrossRef][Medline]

Rigomier, D., Bohin, J. P. & Lubochinsky, B. (1980). Effects of ethanol and methanol on lipid metabolism in Bacillus subtilis. J Gen Microbiol 121, 139–149.[Abstract/Free Full Text]

Sajbidor, J. (1997). Effect of some environmental factors on the content and composition of microbial membrane lipids. Crit Rev Biotechnol 17, 87–103.[Medline]

Salema, M., Capucho, I., Poolman, B., San Romao, M. V. & Dias, M. C. (1996). In vitro reassembly of the malolactic fermentation pathway of Leuconostoc oenos (Oenococcus oeni). J Bacteriol 178, 5537–5539.[Abstract/Free Full Text]

Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning: a Laboratory Manual, 2nd edn. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.

Svobodova, J. & Svoboda, P. (1988). Membrane fluidity in Bacillus subtilis. Physical change and biological adaptation. Folia Microbiol (Praha) 33, 161–169.[CrossRef][Medline]

Swan, T. M. & Watson, K. (1997). Membrane fatty acid composition and membrane fluidity as parameters of stress tolerance in yeast. Can J Microbiol 43, 70–77.[Medline]

Teixeira, H., Goncalves, M. G., Rozes, N., Ramos, A. & San Romao, M. V. (2002). Lactobacillic acid accumulation in the plasma membrane of Oenococcus oeni: a response to ethanol stress? Microb Ecol 43, 146–153.[CrossRef][Medline]

Weber, F. J. & de Bont, J. A. (1996). Adaptation mechanisms of microorganisms to the toxic effects of organic solvents on membranes. Biochim Biophys Acta 1286, 225–245.[Medline]

Zhao, Y., Hindorff, L. A., Chuang, A., Monroe-Augustus, M., Lyristis, M., Harrison, M. L., Rudolph, F. B. & Bennett, G. N. (2003). Expression of a cloned cyclopropane fatty acid synthase gene reduces solvent formation in Clostridium acetobutylicum ATCC 824. Appl Environ Microbiol 69, 2831–2841.[Abstract/Free Full Text]

Zuker, M. (2003). Mfold web server for nucleic acid folding and hybridization prediction. Nucleic Acids Res 31, 3406–3415.[Abstract/Free Full Text]

Received 21 December 2007; revised 13 May 2008; accepted 21 May 2008.



HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
INT J SYST EVOL MICROBIOL MICROBIOLOGY J GEN VIROL
J MED MICROBIOL ALL SGM JOURNALS
Copyright © 2008 Society for General Microbiology.