Abstract
Studies investigating the molecular determinants of virulence in flaviviruses have, in the past, focused on the characterization of attenuated laboratory strains that were derived by cell-culture passage and/or neutralization-escape selection. More recent advances in this field have involved the use of infectious cDNA clones, i.e. bacterial plasmids containing viral cDNA, from which infectious RNA can be transcribed in vitro.
The first such flavivirus clone was produced by Rice et al. (1989) and involved the ligation in vitro of two cDNA fragments of YF virus. Infectious virus was derived from the clone by in vitro transcription of viral RNA and subsequent transfection into BHK-21 cells (Rice et al., 1989 ). Since this report, infectious clones of flaviviruses have been similarly constructed for JE (Sumiyoshi et al., 1992 ), various strains of DEN-2 (Kapoor et al., 1995 ; Kinney et al., 1997 ; Polo et al., 1997 ; Gualano et al., 1998 ), DEN-4 (Lai et al., 1991 ), KUN (Khromykh & Westaway, 1994 ) and TBE (Mandl et al., 1997 ). In some cases, genome-length cDNA was found to be unstable in a bacterial host (YF, JE and DEN-2 strain New Guinea C), whereas for others (DEN-2 strains 16681, New Guinea C and PUO-218, DEN-4, KUN and TBE), full-length cDNA was stably cloned into Escherichia coli or yeast. Success in these latter cases was often dependent on the use of different combinations of plasmid vector and/or bacterial host strain. To date, there has been no report of the construction of an infectious clone for MVE virus.
In this report, we describe the derivation of the 3'-terminal sequence of MVE virus prototype strain 1-51 and the construction of a stable genome-length cDNA clone. RNA transcribed from the clone was infectious when introduced into susceptible cells. Furthermore, clone-derived virus (CDV) was found to be indistinguishable from the parental strain with respect to plaque phenotype, antigenicity, replication kinetics in cell culture and neuroinvasiveness and neurovirulence in mice.
Cells and virus.Vero (ATCC CCL81 P130P145), BHK-21 (ATCC CCL10 P56P59) and Aedes albopictus C6/36 (ATCC CRL1660 P5P20) cells were grown in M199 medium supplemented with 2 mM l-glutamine and 10% foetal calf serum (FCS) and were incubated either at 37 °C in an atmosphere containing 5% CO2 (Vero, BHK-21) or at 28 °C under standard atmospheric conditions (C6/36). MVE-1-51, the prototype strain of MVE virus (Berge, 1975 ), had been passaged twice in embryonated eggs and 15 times in mouse brain (French, 1952 ). Working stocks were prepared as 10% (w/v) suspensions of infected suckling-mouse brain in Hanks balanced salt solution pH 8·0. Where required, virus derived from the infectious cDNA clone (CDV-1-51) was passaged on C6/36 cells to increase the titre for use in subsequent assays. Viral genomic RNA was extracted from infected mouse brain using the RNAzolB method (Tel-Test Inc.) according to the manufacturers instructions.
Plaque assays.
Monolayers of Vero cells in 12-well tissue culture trays were used for plaque assays. After incubation for 1 h, virus was removed and cells were overlaid with methyl cellulose containing 2% FCS in M199 medium. Cells were cultured for 46 days at 37 °C in 5% CO2 and stained with methylene blue to visualize plaques [1% (w/v) methylene blue, 10% formaldehyde].
Virus growth assays.
Monolayers of Vero cells in 60 mm2 tissue culture dishes were infected with either MVE-1-51 or CDV-1-51 at an m.o.i. of 2. Aliquots of cell culture supernatant (500 µl) were then collected at 12, 18, 24 and 30 h post-infection (p.i.) and replaced with equal volumes of fresh medium. The titre of virus in each sample was subsequently determined by plaque assay. All virus growth assays were performed in duplicate.
Cloning of the 3' UTR of MVE-1-51.
A cDNA clone encompassing the 3' terminus of the MVE-1-51 genome was derived by reverse transcription of poly(A)-tailed MVE RNA and subsequent amplification of MVE cDNA by PCR. Briefly, MVE RNA was isolated from purified virus as described previously (Rice et al., 1989 ) and polyadenylated at the 3' terminus by using E. coli poly(A) polymerase (Bresatec) according to the manufacturers instructions. First-strand cDNA was synthesized by oligo(dT)-primed reverse transcription of polyadenylated RNA with AMV reverse transcriptase (Gibco-BRL). After cDNA synthesis, the MVE virus 3' UTR was amplified by PCR with Vent DNA polymerase (New England Biolabs). Oligonucleotides used for PCR amplification were oligo(dT)1218 (New England Biolabs) and a primer corresponding to MVE virus nt 99409955 (Lee et al., 1990 ). The resultant PCR products were isolated from low-melting-point agarose, methylated with BamHI methylase and ligated to BamHI linkers (New England Biolabs). Ligation products were isolated on low-melting-point agarose, digested with BamHI and subcloned into BamHI-digested M13mp18. The sequence of the 3'-terminal 85 nucleotides (nt 1093011014) of MVE virus RNA was obtained by sequence analysis of single-stranded M13 DNA isolated from a total of ten separate recombinants, generated from two independent PCRs.
The predicted stemloop structure at the 3' terminus of MVE virus RNA (see Fig. 1c) was derived by using MFOLD and SQUIGGLES software, available on-line at WebANGIS GCG (http://www.angis.org.au/WebANGIS/WAG).
|
Construction of genome-length cDNA.
Clones from an MVE-1-51 cDNA library (Dalgarno et al., 1986 ) were used in the construction of a full-length cDNA clone. Superscript numbers represent the nucleotide positions in the full-length MVE virus sequence of 11014 nucleotides. Initially, cDNA of the 5' terminus (spanning nt 11943) was generated by PCR by using clone p1/1/12 (Dalgarno et al., 1986 ) as a template. The 5'-end primer (containing a SalI restriction enzyme site for cloning, a T7 RNA polymerase promoter and the first 22 bases of the 5' MVE virus sequence) was designed so that the first nucleotide of the MVE cDNA sequence would be adjacent to the T7 promoter with one extra base (G) added (see Fig. 1b; primer sequence 5' GAATTCGTCGACTTAATACGACTCACTATAGAGACGTTCATCTGCGTGAGCT 3'). The PCR product isolated (SalI→XbaI1943) was ligated to an XbaI1943→ClaI5407 fragment excised from clone p1/1/12 and subsequently cloned between the SalI and ClaI sites of pBR322 (designated pBR/5'MVE; see Fig. 1a.
A cDNA copy of the 3' terminus (spanning nt 995111014) was generated by RTPCR of viral RNA using a high-fidelity Pfu polymerase (Stratagene). The reverse primer contained a SalI site for cloning as well as the last 43 bases of the 3' MVE virus sequence. In addition, an XbaI11014 site was incorporated adjacent to the 3' terminus to enable linearization of the clone and subsequent run-off transcription of full-length RNA (see Fig. 1a, b; primer sequence 5' GCCGCGGTCGACTCTAGAGATCCTGTGGTCTTCTCCCCCATCAGTCACAGTGTCGGCGC 3'). The isolated RTPCR product (SphI9951→SalI) was ligated to a ClaI5407→SphI9951 fragment excised from clone p2/2/6 (Dalgarno et al., 1986 ) and subsequently cloned between the ClaI and SalI sites of pBR322 (designated pBR/3'MVE; see Fig. 1a).
Having constructed two sub-genomic clones spanning nt 15407 (pBR/5'MVE) and 540711014 (pBR/3'MVE) of the viral genome, a full-length clone was generated by ligating an excised SalI→ClaI5407 fragment from pBR/5'MVE to an excised ClaI5407→XbaI11014 fragment from pBR/3'MVE. This full-length cDNA was then cloned between the SalI and XbaI sites of pMC18 (for plasmid reference see Gualano et al., 1998 ) to give the full-length clone pMVE-1-51.
Competent E. coli DH5α cells, prepared by the calcium chloride method of Sambrook et al. (1989) , were used for the cloning and amplification of sub-genomic and full-length plasmids.
PCR mutagenesis of pBR/5'MVE.
To enable the use of the XbaI11014 site for linearization at the 3' terminus in a full-length clone, the XbaI1943 site of pBR/5'MVE was abolished by replacing a short region of pBR/5'MVE (SalI→PstI1950) with a new fragment derived by PCR. The reverse primer used to generate this fragment was designed with a single mismatch at nucleotide 1943, resulting in a T→A transition mutation that did not alter the encoded amino acid sequence (GTT and GTA both encode Val).
In vitro transcription.
Approximately 1 µg pMVE-1-51 containing full-length cDNA was linearized by digestion with XbaI and prepared for in vitro transcription by overnight incubation with proteinase K (200 µg/ml) and SDS (0·5%). DNA was subsequently purified by phenolchloroform extraction and ethanol precipitation and resuspended in 8 µl nuclease-free water. Transcription was carried out by using a MEGAscript T7 kit (Ambion) according to the manufacturers instructions. The reaction contained 7·5 mM each of dATP, dCTP and dUTP, 2·5 mM dGTP and the cap analogue m7G(5')ppp(5')GTP at 5 mM in a final volume of 20 µl. The reaction was incubated at 37 °C for 3 h and RNA products were precipitated by the addition of 2·5 M LiCl at -20 °C for 1 h. RNA was then pelleted by centrifugation in a bench-top microfuge for 10 min, washed with 70% ethanol and resuspended in 25 µl nuclease-free water. The efficiency of the reaction was determined by running 1 µl of the resuspended RNA on a denaturing formaldehydeagarose gel and staining with ethidium bromide.
RNA transfection.
RNA transfections were carried out by using a protocol slightly modified from that outlined by Mandl et al. (1997) . Briefly, sub-confluent BHK-21 cells were collected by trypsinization, washed with ice-cold PBS and resuspended at 6·25x106 cells/ml in ice-cold PBS. Aliquots of 800 µl were then transferred to pre-chilled, 0·4 cm gene pulser cuvettes containing 100 µl ice-cold PBS and 1·5 µg resuspended RNA from in vitro transcription. After incubation on ice for 5 min, cells were electroporated by two successive pulses (settings 1·5 kV, 25 µF, Ω), resulting in a time constant of approximately 0·8 ms. A 1 ml aliquot of M199 medium supplemented with 5 % FCS was added immediately and the cells were gently resuspended before being transferred to an 80 cm2 tissue culture flask containing 20 ml of the same medium. Cells were incubated at 37 °C in 5% CO2 and observed daily for signs of cytopathic effect (CPE).
Virus derived from the above transfection was passaged three times in C6/36 cells (72 h per passage) and designated CDV-1-51. This third-passage stock was subsequently used for phenotypic characterization of the virus.
Immunofluorescence assay.
Sub-confluent C6/36 cells were seeded onto glass coverslips in 24-well tissue culture trays (containing M199 supplemented with 10% FCS) and left overnight at 28 °C prior to infection with MVE-1-51 or CDV-1-51. At 60 h p.i., cells were washed twice with cold PBS and fixed in 80% acetone at -20 °C for 10 min. After air-drying, cells were rehydrated with cold PBS and incubated in a 1:100 dilution of primary antibody (anti-MVE virus hyperimmune ascites fluid; a gift from M. Kroeger, Department of Microbiology, University of Western Australia) at room temperature for 1 h. Cells were subsequently washed three times in cold PBS and further incubated for 1 h in a 1:100 dilution of secondary antibody (FITC-conjugated goat anti-mouse IgG). Cells were then washed again (three times) in cold PBS and the coverslips were mounted onto clean microscope slides with PBSglycerol. Immunofluorescence was visualized under UV light by using a Leitz Orthoplan microscope.
Sequence analysis.
Complete sequence analysis of pMVE-1-51 was performed by using an ABI-Perkin Elmer automated sequencing system that incorporates fluorescently labelled dideoxynucleotides. Multiple analyses were performed to confirm any differences observed between the published sequence of MVE-1-51 (Dalgarno et al., 1986 ; Lee et al., 1990 ) and the sequence of the full-length clone. All primers were supplied by Gibco-BRL as 20-mers and were used at a final concentration of 0·8 nM. Details of primer sequences are available from R.J.H. on request.
Labelling of polypeptides in infected cells.
Sub-confluent monolayers of Vero cells in 60 mm tissue culture dishes were infected with either MVE-1-51 or CDV-1-51 at an m.o.i. of approximately 10. At 24 h p.i., cells were washed twice in amino acid-deficient medium (diluted 1:10) and incubated in the same medium for 30 min at 37 °C. Amino acid-deficient medium was then removed and replaced with fresh medium supplemented with tritiated l-amino acids. Twenty-four hours later, cell monolayers were washed twice in cold PBS and lysed by the addition of 200 µl cold NTE buffer (50 mM TrisHCl, pH 7·5; 200 mM NaCl; 10 mM EDTA; 0·5% Triton X-100) on ice for 20 min. Nuclei were pelleted by centrifugation for 5 min at 4 °C in a bench-top microfuge and the supernatant was stored at -20 °C until required.
Immunoprecipitation of radiolabelled virus.
Immunoprecipitation of radiolabelled virus from cytoplasmic lysates was achieved by incubating the lysate at 4 °C for 1 h in the presence of pre-immune mouse ascitic fluid (1:100 dilution). Immune complexes were then removed by adding protein A-bearing Staphylococcus aureus cells (strain Cowan I, Gibco-BRL) and incubating on ice for 30 min prior to centrifugation at 4 °C for 5 min in a bench-top microfuge. The supernatant was then incubated in the presence of a 1:40 dilution of anti-MVE virus hyperimmune ascites fluid for 2 h at 4 °C and immune complexes were again removed by the addition of S. aureus cells as described above, except that the suspension was incubated on ice for 1 h. The suspension was then layered onto 1 ml of 10% sucrose solution in NTE buffer and centrifuged at 4000 r.p.m. for 10 min in a bench-top microfuge. Pellets were washed twice in NTE buffer containing 0·1% Triton X-100 and resuspended in 30 µl electrophoresis sample buffer (60 mM TrisHCl, pH 6·8; 2% SDS; 0·1% bromophenol blue; 10% glycerol). Samples were heated to 60 °C for 20 min and then centrifuged for 2 min in an Eppendorf tube to pellet S. aureus cells and the supernatant was transferred to a fresh Eppendorf tube for storage at -20 °C.
SDSPAGE of viral polypeptides.
Prior to electrophoresis, immunoprecipitated polypeptides were reduced by the addition of 100 mM DTT and 6% (v/v) 2-mercaptoethanol and incubated at 95 °C for 5 min. Samples were then loaded onto TrisHCl 1020% polyacrylamide gradient gels (Bio-Rad) and electrophoresed at 130 V for 1 h. Gels were fixed and stained in Coomassie blue, destained and treated for fluorography with Amplify reagent (Amersham) prior to drying under reduced pressure and exposing to X-ray film.
Virulence in mice.
Litters of 21-day-old ARC/Swiss mice (five per litter; obtained from the Animal Resources Centre, Murdoch, Western Australia) were injected intracranially (i.c.) or intraperitoneally (i.p.) with 10 µl or 50 µl, respectively, of a tenfold dilution of MVE-1-51 or CDV-1-51. Mice were counted daily and deaths were recorded. Humane end-points were employed to minimize distress to experimental animals, a method that does not significantly alter LD50 values in models of viral encephalitis (Wright & Phillpotts, 1998 ). The 50% humane end-point dose (HD50) was calculated for each group by the LD50 method of Reed & Muench (1938) .
Alternatively, mean time to death was determined by injecting mice (10 per group) i.c. or i.p. with 1000 p.f.u. MVE-1-51 or CDV-1-51 and recording survival of mice over a period of 21 days. Statistical significance was determined by using Students paired t-test.
Mouse experiments were undertaken by using protocols approved by the UWA Animal Experimentation Ethics Committee. Mice were kept on a clean litter of sawdust and given food and water ad libitum.
Derivation of the 3'-terminal sequence of MVE-1-51A cDNA copy of the 3' terminus of MVE-1-51 was derived by polyadenylation of viral RNA with E. coli poly(A) polymerase and subsequent RTPCR with an oligo(dT) primer. The resultant PCR products were successfully cloned into M13mp18 by using BamHI linkers and the nucleotide sequence of the terminal 85 nucleotides was obtained by sequence analysis of single-stranded M13 DNA. The accuracy of this sequence was confirmed by sequencing ten separate clones generated from two independent PCRs. The sequence obtained (GenBank accession no. AF161266) was further subjected to secondary RNA structure analyses by using the genetic algorithms implemented in the MFOLD and SQUIGGLES software programs (for reference see Zuker, 1989 ). The optimal secondary structure for the 3'-terminal 100 nucleotides of MVE virus is depicted in Fig. 1(c). As expected, the double stemloop structure predicted for MVE virus was similar to that predicted for flaviviruses in general (Brinton et al., 1986 ; Proutski et al., 1997 ). Furthermore, the derived sequence had conserved elements that have been shown to be important in the formation of putative pseudoknot structures in a range of different flaviviruses such as JE, West Nile virus (WNV) and YF (Shi et al., 1996 ).
Construction and sequencing of the full-length MVE virus cDNA clone
The full-length MVE-1-51 clone was assembled by using cDNA derived from an existing cDNA library (Dalgarno et al., 1986 ). The genome was cloned in two halves into the low-copy-number vector pBR322; the first half containing nt 15407 and the second half containing nt 540811014 (see Fig. 1a). The two halves were subsequently joined at a unique ClaI site (nt 5407) to form full-length cDNA, which was then inserted into the plasmid pMC18. This plasmid was designated pMVE-1-51.
The plasmid vector pMC18 was chosen because of its low copy number (approximately six per cell; Birnboim, 1983 ) and because full-length cDNA could not be cloned into the vector pBR322 (copy number greater than 25 per cell; Holmes & Quigley, 1981 ), a problem encountered during the construction of clones of other flaviviruses such as YF (Rice et al., 1989 ), JE (Sumiyoshi et al., 1992 ) and DEN-2 (Kapoor et al., 1995 ).
The sequences at both termini are depicted in Fig. 1(b). A T7 RNA polymerase promoter was positioned immediately upstream of the 5' terminus and an additional G residue was included to improve transcription efficiency (Milligan et al., 1987 ). An XbaI site was incorporated to form part of the 3' terminus and was utilized to generate RNA transcripts with authentic 3' termini (plus four non-viral nucleotides; see Fig. 1b).
The nucleotide sequence of pMVE-1-51 was analysed by complete sequence analysis and compared to both the published sequence of MVE-1-51 (GenBank accession no. M24220; Dalgarno et al., 1986 ; Lee et al., 1990 ) and the sequence of the 3' terminus derived in this laboratory. The differences between the two sequences are shown in Table 1. Nineteen differences were found and confirmed by second-round sequencing. Seven of these differences led to amino acid changes and three were located in the 3' UTR. None of the seven amino acid changes altered the charge or polarity of the encoded amino acid significantly. Furthermore, the three changes in the 3' UTR were located well upstream of known flavivirus consensus sequences and predicted stemloop structures (Hahn et al., 1987 ; Lee et al., 1990 ; Shi et al., 1996 ).
Table 1. Differences between the published sequence of MVE-1-51 and that of the infectious cDNA clone pMVE-1-51
The stability of pMVE-1-51 after propagation in E. coli was confirmed by comparing restriction enzyme profiles of the plasmid over three separate passages in E. coli strain DH5α. In each case, the restriction profile remained the same. Furthermore, RNA transcribed from pMVE-1-51 of different passages and transfected into BHK-21 cells generated CPE with equal efficiency.
In vitro synthesis of infectious RNA and recovery of recombinant virus
Capped RNA transcripts were transcribed from linearized pMVE-1-51 (XbaI digested) by using T7 RNA polymerase and an optimized 2:1 ratio of methylated cap analogue [m7G(5')ppp(5')GTP] to dGTP. Increasing the proportion of cap analogue in the reaction above this level resulted in a substantial decrease in the yield of RNA. Transcribed RNA was then precipitated in the presence of 2·5 M LiCl and washed with 70% ethanol prior to resuspension in nuclease-free water. An aliquot was electrophoresed on a 1% denaturing formaldehydeagarose gel to check for efficient transcription of full-length product and to estimate RNA concentration (data not shown). Approximately 1·5 µg full-length RNA was subsequently transfected into BHK-21 cells by electroporation. CPE indistinguishable from that of the parental virus MVE-1-51 was visible at 34 days p.i. The specific infectivity of the RNA was estimated to be between 105 and 106 p.f.u./µg based on the assumption that, at most, only two-thirds of the transfected RNA was capped due to the proportion of cap analogue in the reaction (as described above). A high-titre stock of this virus, designated CDV-1-51, was generated by passage on C6/36 cells and used for subsequent virulence studies.
Confirming the presence of clone-derived virus (CDV-1-51)
During virulence studies (outlined below), the presence of CDV-1-51 was confirmed by extracting viral RNA from the brains of encephalitic mice and performing a RTPCR/restriction enzyme analysis. Approximately 1·6 kb of the viral genome (spanning the abolished XbaI restriction enzyme site at nt 1943) was amplified and digested with XbaI. The results are shown in Fig. 2. When digested with this enzyme, MVE-1-51-derived cDNA (lane 3) is cleaved into two fragments, approximately 1·0 kb and 0·6 kb in length. CDV-1-51-derived cDNA (lane 2), however, is not cleaved due to the abolition of the XbaI site during construction of the full-length clone, as described in Methods.
|
Biological characterization of CDV-1-51
In order to confirm the antigenicity of CDV-1-51, monolayers of C6/36 cells were infected at an m.o.i. of 10 and compared to cells infected with MVE-1-51. All cells were found to show immunofluorescence at 60 h p.i. by using anti-MVE virus hyperimmune ascites fluid (see Fig. 3). The antigenic profile of CDV-1-51 was examined further by infecting Vero cells with the virus and labelling viral proteins 24 h later with tritiated amino acids. Cytoplasmic lysates and tissue culture supernatants were collected at 48 h p.i. and immunoprecipitated in the presence of anti-MVE virus hyperimmune ascites fluid. Immunoprecipitates were analysed by SDSPAGE and compared to those obtained for positive and negative controls. As shown in Fig. 4, a range of MVE virus-specific proteins was visible in both the cell lysates and cell culture supernatants of MVE-1-51- and CDV-1-51-infected cells. At least five viral proteins, including the E protein (~57 kDa), NS1 (~49 kDa) and prM (~26 kDa), were identified in cell lysates on the basis of their size (Lee et al., 1990 ), and the electrophoretic mobility of these proteins was identical for the two viruses. Two other virus-specific proteins (~42 and 15 kDa) were also identified; however, their identities are unknown. Mature E (and possibly NS1) proteins were also detected in the cell culture supernatants of both viruses. The antigenic profiles of MVE-1-51 and CDV-1-51 (intra- and extracellular virus) were therefore said to be identical.
|
|
In addition to the above observations, the plaque size and morphology of CDV-1-51 were compared to those of MVE-1-51 by standard plaque assay on Vero cells. The viruses generated indistinguishable plaque phenotypes at 34 days p.i., with mean plaque diameters of approximately 2·2 mm (Fig. 5). Furthermore, single-step growth curves of MVE-1-51 and CDV-1-51 in Vero cells (Fig. 6) showed that the replication kinetics of the two viruses were very similar.
|
|
Pathogenicity of CDV-1-51
The virulence of MVE-1-51 and CDV-1-51 were compared in the mouse model by injecting litters of ten 21-day-old mice i.p. or i.c. with tenfold dilutions of virus. Mice were observed daily for signs of encephalitis. The HD50 values by the i.p. route for MVE-1-51 and CDV-1-51 were 4 and 8 p.f.u., respectively, whilst by the i.c. route they were 1 and 9 p.f.u., respectively. The HD50 values were thus very similar for the two viruses by either route of administration.
In order to characterize the virulence of CDV-1-51 further, a mortality profile was determined by injecting groups of ten mice i.p. or i.c. with 1000 p.f.u. MVE-1-51 or CDV-1-51. Mean time to death (humane end-point) was calculated for each group. The differences in the profiles for each group (Fig. 7a) were not statistically significant by Students t-test, indicating that the neuroinvasiveness and neurovirulence profiles of CDV-1-51 were similar to those of MVE-1-51.
|
Finally, to determine whether the central nervous system growth kinetics of MVE-1-51 and CDV-1-51 were the same, groups of twenty 21-day-old mice were injected i.c. with 1000 p.f.u. of each virus. Three brains from each group were collected each day and assayed separately by plaque assay on Vero cells. The titres of the two viruses were found to be comparable throughout the course of the infection (days 25) and were therefore said to be identical (Fig. 7b). 100% mortality was evident in both groups by day 6 p.i. A stable full-length clone of MVE virus prototype strain 1-51 was constructed. Viral RNA transcribed from the clone gave rise to infectious virus and, in all respects, this virus (CDV-1-51) had an almost identical phenotype to wild-type virus. The specific infectivity of clone-derived RNA, estimated to be between 105 and 106 p.f.u./µg, was similar to that described for other flavivirus clones such as YF and TBE (Rice et al., 1989 ; Mandl et al., 1997 ). The presence of an introduced mutation in the clone was confirmed by RTPCR and restriction enzyme analysis of viral cDNA derived from the brains of encephalitic mice, showing that the virus was indeed clone derived.
Construction of the clone was made possible by determining the 3'-terminal sequence of the virus. In combination with the work of others, the full genomic sequence of MVE virus is now known (Dalgarno et al., 1986 ; Lee et al., 1990 ). It is our belief that the cDNA sequence of CDV-1-51 (reported in this paper) is more accurate than that reported by Lee et al. (1990) , due only to the improved accuracy of automated sequencing over the older Maxam and Gilbert method used in their study (Maxam & Gilbert, 1980 ). This is supported by the fact that five of the seven predicted amino acid changes in CDV-1-51 appear to resemble more closely the sequences of related flaviviruses than do those reported in the original published sequence. For example, the serine residue encoded by nt 95319533 of the original published sequence is an asparagine residue in JE virus, KUN, YF virus, DEN-2 and WNV (Lee et al., 1990 ) and is also an asparagine in CDV-1-51. The presence of cloning artifacts, introduced during the construction of the full-length clone, cannot be excluded, however, even though their presence appears to have little effect if any on the phenotype of the virus.
Molecular modelling of the 3'-terminal sequence of MVE virus suggests that it forms a stemloop structure similar to that found in other flaviviruses. Furthermore, it appears that the conserved elements for the putative pseudoknot structure, involving a tertiary interaction between the loop of the smaller 3' stemloop and the stem of the larger 5' stemloop, are also conserved (Shi et al., 1996 ). This supports the hypothesis that a conserved secondary structure at the extreme 3' terminus of viral RNA is important for the replication, transcription and/or translation of the flavivirus genome (Blackwell & Brinton, 1997 ; Zeng et al., 1998 ).
This is the first report of an infectious clone of MVE virus. It is likely that we were able to clone full-length cDNA into a low-copy-number plasmid vector as a result of our increased understanding of the difficulties involved in such cloning. In the past, the construction of flavivirus clones has been hampered by the instability of full-length cDNA in a bacterial host. This was probably due to the choice or combination of vector and host strain, a hypothesis used to explain difficulties encountered during the construction of clones of other flaviviruses such as YF and JE (Rice et al., 1989 ; Sumiyoshi et al., 1992 ). As a result, other groups opted for an in vitro ligation approach, where full-length cDNA was excised from two half-clones and ligated in vitro as a template for transcription. It is our belief that the choice of the low-copy-number vector pMC18, which has a copy number of approximately six per cell, was essential to our success in obtaining a full-length clone of MVE virus. In addition, the use of the E. coli DH5α host strain, which has the deoR genotype engineered to allow the uptake of large plasmids, may also have contributed to our success.
Attempts to clone full-length cDNA into the plasmid vector pBR322, which has a copy number of more than 25 per cell, were unsuccessful. In the hands of others, however, this vector has been used successfully in the construction of full-length clones (Khromykh & Westaway, 1994 ; Kapoor et al., 1995 ; Mandl et al., 1997 ). It is possible that the use of pBR322 represents the extreme limit of bacterial tolerance of full-length flaviviral cDNA. The use of higher-copy-number vectors such as pGEM may pose serious toxicity problems for the host, resulting in cell death or genomic instability. This may or may not be the result of the expression of flaviviral proteins in the bacterial host, a deleterious effect that would be minimized by the use of a lower-copy-number vector such as pMC18. In any event, the early difficulties faced during the construction of full-length flavivirus clones appear now to have been largely circumvented, making the generation of clone-derived RNA a much simpler process.
It is envisaged that the infectious cDNA clone of MVE virus will serve as a useful tool for elucidating the molecular determinants of virulence in flaviviruses. The mouse model of MVE virus infection is well established and is arguably one of the best working models for the encephalitic flaviviruses. The availability of such a model will allow the use of the infectious clone in the identification of molecular determinants of both neuroinvasiveness and neurovirulence. In particular, the clone is currently being used to confirm that a Ser→Ile change at position 277 in the envelope protein is responsible for the low neuroinvasiveness of the BHv1 strain. This change also inhibits the ability of the virus to haemagglutinate across the pH range 5·57·5 (McMinn et al., 1995a ). In separate experiments, the clone will also be used to examine more rigorously a mutation in the putative receptor-binding site (amino acid position 390 of the envelope protein) of a different strain of MVE virus. This mutation alters an RGD motif thought to be important in the interaction of the virus with host-cell integrins (Lobigs et al., 1990 ; Chen et al., 1997 ).
To date, no neurovirulence determinants have been identified for MVE virus. However, McMinn et al. (1995b ) identified a strain of the virus that appears to have one or more changes in the non-structural genes and/or 3' UTR of the genome. These changes appear to affect neuron-specific replication. The virus (C4P9) is only seven passages removed from the prototype strain 1-51 and is therefore unlikely to contain more than a few mutations. The mutation(s) is of interest because it seriously inhibits the ability of the virus to replicate in vivo in the brains of 21-day-old mice and in vitro in mouse neuroblastoma cells (McMinn et al., 1995b ). By constructing intratypic chimeras with the infectious cDNA clone, it may be possible to identify the precise location of this mutation(s) and confirm its role in the attenuation of neurovirulence. Such findings may have implications for future flavivirus vaccine design and could be used in combination with other molecular determinants of virulence to re-engineer current live-attenuated vaccines, reducing the risk of their reversion to wild-type. Recent work, involving the construction of a chimeric clone containing the prM and E genes of JE virus strain SA14-14-2 within the backbone of a YF virus 17D infectious clone (Chambers et al., 1999 ), has shown that mice inoculated subcutaneously with 103 p.f.u. of chimeric virus (ChimeriVax-JE) are solidly protected against i.p. challenge with a virulent strain of JE virus (Guirakhoo et al., 1999 ), as are rhesus monkeys immunized with a similar dose (Monath et al., 1999 ). Such studies provide good evidence that infectious clone technology can be applied successfully to the design and construction of safe and efficacious vaccines.
Sincere thanks to Dr Lee Sammels, Ms Angela Carrello and Mr Dan Andrews for technical assistance and to Dr A. Davidson for the kind gift of the low-copy-number plasmid vector pMC18. This investigation was supported by grants from the Raine Foundation of the University of Western Australia and the National Health and Medical Research Council of Australia. R.J.H. is supported by Baillieu and Jean Rogerson Postgraduate Research Scholarships from the University of Western Australia.Footnotes
The GenBank accession number of the sequence reported in this paper is AF161266.References
Birnboim, H. C. (1983). A rapid alkaline extraction method for the isolation of plasmid DNA. Methods in Enzymology 100, 243-255.[Medline]
Blackwell, J. L. & Brinton, M. A. (1997). Translation elongation factor-1 alpha interacts with the 3' stemloop region of West Nile virus genomic RNA. Journal of Virology 71, 6433-6444.[Abstract]
Brinton, M. A., Fernandez, A. V. & Dispoto, J. H. (1986). The 3'-nucleotides of flavivirus genomic RNA form a conserved secondary structure. Virology 153, 113-121.[Medline]
Chambers, T. J., Hahn, C. S., Galler, R. & Rice, C. M. (1990). Flavivirus genome organization, expression, and replication. Annual Review of Microbiology 44, 649-688.[Medline]
Chambers, T. J., Nestorowicz, A., Mason, P. W. & Rice, C. M. (1999). Yellow fever/Japanese encephalitis chimeric viruses: construction and biological properties. Journal of Virology 73, 3095-3101.
Chen, Y. P., Maguire, T., Hileman, R. E., Fromm, J. R., Esko, J. D., Linhardt, R. J. & Marks, R. M. (1997). Dengue virus infectivity depends on envelope protein binding to target cell heparan sulfate. Nature Medicine 3, 866-871.[Medline]
Dalgarno, L., Trent, D. W., Strauss, J. H. & Rice, C. M. (1986). Partial nucleotide sequence of the Murray Valley encephalitis virus genome. Comparison of the encoded polypeptides with yellow fever virus structural and non-structural proteins. Journal of Molecular Biology 187, 309-323.[Medline]
French, E. (1952). Murray Valley encephalitis: isolation and characterisation of the aetiological agent. Medical Journal of Australia 1, 100-103.[Medline]
Gualano, R. C., Pryor, M. J., Cauchi, M. R., Wright, P. J. & Davidson, A. D. (1998). Identification of a major determinant of mouse neurovirulence of dengue virus type 2 using stably cloned genomic-length cDNA. Journal of General Virology 79, 437-446.[Abstract]
Guirakhoo, F., Zhang, Z. X., Chambers, T. J., Delagrave, S., Arroyo, J., Barrett, A. D. T. & Monath, T. P. (1999). Immunogenicity, genetic stability, and protective efficacy of a recombinant, chimeric yellow fever-Japanese encephalitis virus (ChimeriVax-JE) as a live, attenuated vaccine candidate against Japanese encephalitis. Virology 257, 363-372.[Medline]
Hahn, C. S., Hahn, Y. S., Rice, C. M., Lee, E., Dalgarno, L., Strauss, E. G. & Strauss, J. H. (1987). Conserved elements in the 3' untranslated region of flavivirus RNAs and potential cyclization sequences. Journal of Molecular Biology 198, 33-41.[Medline]
Holmes, D. S. & Quigley, M. (1981). A rapid boiling method for the preparation of bacterial plasmids. Analytical Biochemistry 114, 193-197.[Medline]
Kapoor, M., Zhang, L., Mohan, P. M. & Padmanabhan, R. (1995). Synthesis and characterization of an infectious dengue virus type-2 RNA genome (New Guinea C strain). Gene 162, 175-180.[Medline]
Khromykh, A. A. & Westaway, E. G. (1994). Completion of Kunjin virus RNA sequence and recovery of an infectious RNA transcribed from stably cloned full-length cDNA. Journal of Virology 68, 4580-4588.
Kinney, R. M., Butrapet, S., Chang, G. J., Tsuchiya, K. R., Roehrig, J. T., Bhamarapravati, N. & Gubler, D. J. (1997). Construction of infectious cDNA clones for dengue 2 virus: strain 16681 and its attenuated vaccine derivative, strain PDK-53. Virology 230, 300-308.[Medline]
Lai, C. J., Zhao, B. T., Hori, H. & Bray, M. (1991). Infectious RNA transcribed from stably cloned full-length cDNA of dengue type 4 virus. Proceedings of the National Academy of Sciences, USA 88, 5139-5143.
Lee, E., Fernon, C., Simpson, R., Weir, R. C., Rice, C. M. & Dalgarno, L. (1990). Sequence of the 3' half of the Murray Valley encephalitis virus genome and mapping of the nonstructural proteins NS1, NS3, and NS5. Virus Genes 4, 197-213.[Medline]
Lobigs, M., Usha, R., Nestorowicz, A., Marshall, I. D., Weir, R. C. & Dalgarno, L. (1990). Host cell selection of Murray Valley encephalitis virus variants altered at an RGD sequence in the envelope protein and in mouse virulence. Virology 176, 587-595.[Medline]
McMinn, P. C., Lee, E., Hartley, S., Roehrig, J. T., Dalgarno, L. & Weir, R. C. (1995a). Murray valley encephalitis virus envelope protein antigenic variants with altered hemagglutination properties and reduced neuroinvasiveness in mice. Virology 211, 10-20.[Medline]
McMinn, P. C., Marshall, I. D. & Dalgarno, L. (1995b). Neurovirulence and neuroinvasiveness of Murray Valley encephalitis virus mutants selected by passage in a monkey kidney cell line. Journal of General Virology 76, 865-872.
Mandl, C. W., Ecker, M., Holzmann, H., Kunz, C. & Heinz, F. X. (1997). Infectious cDNA clones of tick-borne encephalitis virus European subtype prototypic strain Neudoerfl and high virulence strain Hypr. Journal of General Virology 78, 1049-1057.[Abstract]
Marshall, I. (1988). Murray Valley and Kunjin encephalitis. In The Arboviruses: Epidemiology and Ecology, pp. 152-186. Edited by T. Monath. Boca Raton, FL: CRC Press.
Maxam, A. M. & Gilbert, W. (1980). Sequencing end-labeled DNA with base-specific chemical cleavages. Methods in Enzymology 65, 499-560.[Medline]
Milligan, J. F., Groebe, D. R., Witherell, G. W. & Uhlenbeck, O. C. (1987). Oligoribonucleotide synthesis using T7 RNA polymerase and synthetic DNA templates. Nucleic Acids Research 15, 8783-8798.
Monath, T. P. & Heinz, F. X. (1996). Flaviviruses. In Fields Virology, pp. 961-1034. Edited by B. N. Fields, D. M. Knipe & P. M. Howley. Philadelphia: LippincottRaven.
Monath, T. P., Soike, K., Levenbook, I., Zhang, Z. X., Arroyo, J., Delagrave, S., Myers, G., Barrett, A. D. T., Shope, R. E., Ratterree, M., Chambers, T. J. & Guirakhoo, F. (1999). Recombinant, chimaeric live, attenuated vaccine (ChimeriVax) incorporating the envelope genes of Japanese encephalitis (SA14-14-2) virus and the capsid and nonstructural genes of yellow fever (17D) virus is safe, immunogenic and protective in non-human primates. Vaccine 17, 1869-1882.[Medline]
Polo, S., Ketner, G., Levis, R. & Falgout, B. (1997). Infectious RNA transcripts from full-length dengue virus type 2 cDNA clones made in yeast. Journal of Virology 71, 5366-5374.[Abstract]
Proutski, V., Gould, E. A. & Holmes, E. C. (1997). Secondary structure of the 3' untranslated region of flaviviruses: similarities and differences. Nucleic Acids Research 25, 1194-1202.
Reed, L. J. & Muench, H. (1938). A simple method of estimating fifty percent endpoints. American Journal of Hygiene 27, 493-497.
Rice, C. M. (1996). Flaviviridae: the viruses and their replication. In Fields Virology, pp. 931-959. Edited by B. N. Fields, D. M. Knipe & P. M. Howley. Philadelphia: LippincottRaven.
Rice, C. M., Grakoui, A., Galler, R. & Chambers, T. J. (1989). Transcription of infectious yellow fever RNA from full-length cDNA templates produced by in vitro ligation. New Biologist 1, 285-296.[Medline]
Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning: A Laboratory Manual, 2nd edn. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.
Shi, P. Y., Brinton, M. A., Veal, J. M., Zhong, Y. Y. & Wilson, W. D. (1996). Evidence for the existence of a pseudoknot structure at the 3' terminus of the flavivirus genomic RNA. Biochemistry 35, 4222-4230.[Medline]
Sumiyoshi, H., Hoke, C. H. & Trent, D. W. (1992). Infectious Japanese encephalitis virus RNA can be synthesized from in vitro-ligated cDNA templates. Journal of Virology 66, 5425-5431.
Wright, A. J. & Phillpotts, R. J. (1998). Humane endpoints are an objective measure of morbidity in Venezuelan encephalomyelitis virus infection of mice. Archives of Virology 143, 1155-1162.[Medline]
Zeng, L., Falgout, B. & Markoff, L. (1998). Identification of specific nucleotide sequences within the conserved 3'-SL in the dengue type 2 virus genome required for replication. Journal of Virology 72, 7510-7522.
Zuker, M. (1989). On finding all suboptimal foldings of an RNA molecule. Science 244, 48-52.
Received 15 April 1999; accepted 2 August 1999.