Abstract
The goal of the present study was to characterize the genomes of the PLHVs further and to base their phylogenetic relationship and classification on analyses of complete genes. Furthermore, feral pigs (Sus scrofa) were analysed for the presence of PLHVs to find a natural reservoir.
Collection of porcine blood and organ samples and preparation of DNA.Blood and spleen samples were collected from commercial pig herds in Brandenburg, Germany. Bone marrow samples of feral pigs were collected from hunted animals in Germany. Total DNA was prepared by the QIAamp Blood and Tissue kits (Qiagen).
Genome walking and cloning procedures.
PLHV sequences extending from the published PLHV sequences (Ehlers et al., 1999b ) into unknown flanking regions were amplified by Genexpress GmbH (Berlin) on the basis of the Universal GenomeWalker kit from Clontech (Siebert et al., 1995 ). Briefly, separate aliquots of PLHV-1- and PLHV-2-infected pig samples as well as two samples of non-infected pigs were digested with six restriction enzymes. Each batch of digested genomic DNA was then ligated separately to an adaptor. With these adaptor-ligated libraries, nested PCR was performed by using an outer adaptor primer (AP1) and an outer gene-specific primer (GSP1) in first-round PCR and the inner primers AP2 and GSP2 in second-round PCR. The amplicons obtained were ligated into the plasmid pCR-Script Amp SK(+) (Stratagene) and transformed into Epicurian Coli XL10-Gold Kan ultracompetent cells (Stratagene). Specific clones were identified by PCR with the primers AP2 and GSP2.
PCR applications and nucleotide sequence determination.
In PCR analyses of PLHV-containing feral pig samples, both PLHVs were amplified with the primer pair 170-S/170-AS. PLHV-1 was amplified selectively with the primer pairs 170-S/160-AS or 213-S/215-AS and PLHV-2 with the primer pair 208-S/212-AS. All amplified regions are located inside the DPOL gene (Ehlers et al., 1999b ). Primer pair 278-S/276-AS amplified a region of both PLHVs outside the DPOL gene (483 bp), with primer 278-S (5' GGAAATGATGCCCTTTAGGGTTTTG 3') binding to the intergenic region between DPOL and ORF A5 and primer 276-AS (5' ATGGGGCCATTCCACCTCTACTT 3') binding to the 5' part of ORF A5. The locations of all amplified regions are depicted in Fig. 2(a).
|
For the PCR analyses of PLHV-containing domestic pig samples shown in Fig. 1, the PLHV-1-specific primer pair 170-S/160-AS and the PLHV-2-specific primer pair 280-S (5' CTCTATCATCCTACCATATGATGGC 3') and 280-AS (5' GGCTATGTTGTATCCCGTAATAATC 3') were used.
|
For amplification of porcine cytomegalovirus (PCMV) sequences, the primers 199-S (5' ACGAGAAAGATATTCTGACGGTGCA 3') and 199-AS (5' TCTAGACGAAAGGACATTGTTGATA 3') were selected on the basis of the unpublished partial DPOL sequence of PCMV, strain B6, deposited in GenBank by F. B. Widen, M. Banks & P. J. Lowings (accession number AJ222640). With these primers, an amplicon of 340 bp was obtained from PCMV strain B6 (kindly provided by M. Banks, Addlestone, UK). Amplicons of identical size were obtained from several German spleen samples. Their sequences were 99% identical to the B6 sequence and the data were deposited in GenBank (accession no. AF191044).
The absence of PCR inhibitors in samples was tested by PCR with specificity for a conserved region of the vertebrate cytochrome B gene (Kocher et al., 1989 ).
The reactions were set up as described previously (Ehlers et al., 1999b ). Amplifications were performed after complete activation of the DNA polymerase AmpliTaq Gold (Moretti et al., 1998 ) for 12 min at 95 °C and then cycled 40 times through 30 s denaturation at 95 °C, 30 s annealing at 55 °C (primers 170, 170/160, 190, 213/215, 278/276 and 280) or 58 °C (primers 208/212) and 30 s extension at 72 °C, followed by a final extension step at 72 °C for 10 min. PCR products were sequenced directly as described previously (Ehlers et al., 1999b ).
Nucleotide and protein sequence analysis.
Multiple sequence alignments were performed with the clustalW module of MacVector (version 6.01, Oxford Molecular Group). Protein pair distances were calculated with the MegAlign module of DNA* (version 3.17, DNASTAR). Phylogenetic analysis was based on a multiple amino acid alignment from which gaps or insertions unique to a particular species had been removed. The remaining conserved regions were concatenated (McGeoch et al., 1995 ) and subjected to phylogenetic tree construction by using the programs Protpars or Protdist and Neighbor from the PHYLIP program package (Felsenstein, 1985 , 1993 ). The trees were evaluated statistically by using 1000 bootstrap samples.
Nucleotide sequence accession numbers.
The sequences from PLHV-1 (4643 bp), PLHV-2 (4642 bp) and PCMV (290 bp) determined in this study were deposited in the GenBank nucleotide sequence database under accession numbers AF191042 (PLHV-1), AF191043 (PLHV-2) and AF191044 (PCMV).
Selection of PLHV-infected pig organs for PCR-based genome walking
To select the template material for the walking approach, we tested 27 spleen and 95 blood samples for the presence of PLHV-1 and PLHV-2 with the primer pairs 213-S/215-AS and 208-S/212-AS, respectively. Samples with strong PCR reactions for one of the PLHV species were re-examined by template dilution and subsequent PCR to estimate the PLHV copy number per ng total DNA. Additionally, we attempted to exclude samples containing PCMV by the use of the PCMV-specific primer pair 199-S/199-AS. Since we had previously found PCMV [but not pseudorabies virus (PRV)] in porcine spleen samples with degenerate primers (Ehlers et al., 1999b ), we wanted to avoid a possible mixing of PLHV sequences with PCMV sequences generated in the genome walking process.
In this screening, no samples with a sufficient copy number of either PLHV-1 or PLHV-2 but negative for PCMV could be found. The reason for this was primarily the high prevalence of PCMV in the spleen samples (~90%). Blood samples had a low prevalence of PCMV (~15%) but also mostly had insufficient copy numbers of the two PLHVs. Therefore, a PLHV-1-positive spleen sample (#56) was selected that contained <100 PLHV-1 genomes per ng total DNA (<1 genome per cell) and was negative for PLHV-2. Likewise, a PLHV-2-positive spleen sample (#489) was selected that contained <10 PLHV-2 genomes per ng total DNA (<0·1 genomes per cell) and was negative for PLHV-1.
PLHV genome walking with adaptor-ligated restriction fragment libraries
The genome walking was based on a nested PCR approach, with adaptor-ligated genomic DNA fragments from the selected pig spleens #56 and #489, as described in Methods. Overlapping amplicons of 0·42 kbp were obtained, spanning a total of 5·5 kbp of PLHV-1 and 2·8 kbp of PLHV-2. The amplicons were cloned in E. coli by using the vector pCR-Script and then sequenced. Cloning and sequencing were repeated once or twice for identification of polymerase errors in individual clones. PCR was performed on the spleen samples #56 and #489 with specific primers derived from these sequences. The resulting amplicons were sequenced and compared with the walking-derived sequences. Upstream of the walking-derived region of PLHV-2, the walking process failed. Therefore, additional sequences of PLHV-2 were amplified by PCR only, by using sense primers derived from the PLHV-1 sequence and antisense primers from the PLHV-2 sequence. This approach was successful with some of the PLHV-1 primers because of the similarity of PLHV-1 and -2, shown in detail below. Consensus sequences of 4643 and 4642 bp, with 4- to 10-fold redundancy, were determined for PLHV-1 and PLHV-2, respectively, and used for further analyses. In a first step, the sequences were compared with the complete DPOL gene and adjacent downstream sequences of PCMV, since samples #56 and #489 contained not only PLHV but also PCMV. No significant stretches of identity were found in comparison with the PCMV sequences obtained from sample #489 and from the British PCMV strain B6 (M. Goltz & B. Ehlers, unpublished data) (not shown). Secondly, we analysed several regions of the DPOL genes of PLHV-1 and -2 in additional blood and spleen samples. Identical amplicons and sequences were obtained for each PLHV species, which revealed the absence of PLHV sequence variation in samples of different origin. This is demonstrated by PCR results obtained with primer pairs that detect PLHV-1 or PLHV-2 differentially (Fig. 1).
PLHV open reading frame (ORF) and nucleotide composition analyses
In an ORF analysis, the 4643 bp PLHV-1 sequence was found to span the 3' end of the glycoprotein B gene (184 bp), the complete ORF of DPOL (3012 bp) and an additional ORF (975 bp). The 4642 bp PLHV-2 sequence contained 184 bp of the 3' end of the glycoprotein B gene, the complete DPOL ORF (3003 bp) and an additional ORF of 912 bp (Fig. 2a). Both sequences exhibited very low G+C contents of 37 mol% and a marked suppression of the CpG dinucleotide frequency with a concomitant increase of TpG and CpA (Fig. 2b). These characteristic dinucleotide frequencies have been found in several A+T-rich lymphotropic herpesviruses (Albrecht et al., 1992 ; Ensser et al., 1997 ; Virgin et al., 1997 ).
Analysis of the DPOL genes
The DPOL ORFs of PLHV-1 and PLHV-2 (3012 and 3003 bp, respectively) differed at 194 nucleotide positions, corresponding to an identity of 93%. The deduced amino acid sequences showed 50 amino acid differences, corresponding to an identity of 95% (Fig. 3). These differences confirmed our previous suggestion (Ehlers et al., 1999b ) that the PLHVs are distinct, closely related species rather than strains of the same species. The PLHV-1 and PLHV-2 DPOLs (1004 and 1001 amino acids, respectively) were found to be the shortest herpesvirus DPOLs described so far, compared with those of other herpesviruses (10091246 amino acids). Both polymerases contained the conserved exonuclease (EXO IIII) and polymerization (motifs AC) domains of DNA-dependent DNA polymerases of eukaryotic viruses (Knopf, 1998 ; Blanco et al., 1991 ) (Fig. 3).
|
Both PLHV DPOLs were closely related to the DNA polymerases of other gammaherpesviruses, in particular that of alcelaphine herpesvirus 1 (AlHV-1; Ensser et al., 1997 ). The PLHV DPOL genes were 60% identical to AlHV-1 DPOL. This identity is 8% lower than that reported previously (Ehlers et al., 1999b ), since we analysed only a short, highly conserved region of DPOL in that study. Phylogenetic analysis was used to confirm the relationships observed. In the resulting phylogenetic tree, the herpesvirus subfamilies were separated with high bootstrap scores. In the cluster of the Gammaherpesvirinae, the PLHVs showed the shortest genetic distance to AlHV-1 (Fig. 4). The use of parsimony analysis gave a similar result (not shown).
|
Analysis of the ORFs downstream of the DPOL genes
The PLHV-1 and -2 proteins encoded by the ORFs downstream of the DPOL gene spanned 325 and 304 amino acids, respectively, and exhibited 87% similarity (83% identity). Both ORFs appeared to be homologues of the positional equivalent in the AlHV-1 genome (ORF A5, 302 amino acids), since the deduced proteins exhibited similarities of 50% (PLHV-1) and 53% (PLHV-2) to A5. Less similarity was found to the E6 protein of equine herpesvirus 2 (EHV-2) and the BILF1 protein of EpsteinBarr virus (EBV). Like A5, E6 and BILF1, the two PLHV proteins contained seven distinct hydrophobic regions representing putative transmembrane domains (not shown). They may function as G protein-coupled receptors, as discussed previously for A5 of AlHV-1 (Ensser et al., 1997 ).
Analysis of feral pigs for the presence of PLHV sequences
We next investigated whether a natural reservoir for the PLHVs exists in feral pigs. For this purpose, bone marrow samples from 19 feral pigs were analysed with different PCR assays (Table 1). All bone marrow samples gave positive reactions after PCR with primers specific for both PLHVs (pair 170). Differential PCR was performed with the primer pairs 213-S/215-AS or 170-S/160-AS (PLHV-1-specific) and 208-S/212-AS (PLHV-2-specific). PLHV-2 PCR was strongly positive in 18 of 19 animals. However, PLHV-1 PCR was only positive with both primer pairs in the case of the PLHV-2-negative animal (#555). In addition, one of the PLHV-2-containing samples (#562) reacted weakly with the primer pair 170/160 (but not with the probably less-sensitive pair 213/215). Therefore, sample #562 appeared to be doubly infected (Table 1). These results were confirmed by sequence analysis. The sequences obtained from the 18 PLHV-2- and the two PLHV-1-containing samples showed 100% identity to the DPOL genes of PLHV-2 and PLHV-1, respectively, from domestic pigs. These data suggest that the same virus species infect domestic as well as feral pigs.
Table 1. PCR analysis of feral pigs for the presence of PLHV-1 and -2
To provide more evidence for this hypothesis, we also compared the feral and the domestic PLHVs in a region of lower conservation outside the DPOL gene, by using the primer pair 278-S/276-AS (Fig. 2a). All bone marrow samples gave positive reactions (Table 1). Sequence analysis confirmed the presence of PLHV-2 in 18/19 samples and of PLHV-1 in sample #555, without any differences from the PLHV sequences found in domestic pigs. Only the PLHV-2 sequence was obtained from the doubly infected sample #562, indicating the particular presence of PLHV-2.
From the sequence analysis of >>700 bp of all feral PLHV isolates, we concluded that the PLHVs are infectious for domestic as well as feral pigs, with a particularly high prevalence of PLHV-2 in feral pigs.
The genetic data reported in this study provided compelling evidence for the existence of the novel porcine lymphotropic gammaherpesviruses PLHV-1 and PLHV-2. Contiguous sequences spanning approximately 4·6 kbp of each genome could be successfully amplified by genome walking from spleen samples that contained less than one viral genome per cell. The sequences were shown to contain the 3' end of the glycoprotein B gene, the complete DPOL gene and an ORF with homology to the A5 gene of AlHV-1. Comparison of the PLHV DPOLs with those of other herpesviruses confirmed our previous observation (Ehlers et al., 1999b ) that the PLHVs are closely related to gammaherpesviruses, in particular to AlHV-1. Furthermore, counterparts of the PLHV homologue of AlHV-1 A5 could be found in only two other gammaherpesviruses, EHV-2 and EBV. Therefore, PLHV-1 and PLHV-2 can be classified as members of the subfamily Gammaherpesvirinae. In addition, the low G+C content and the markedly reduced CpG frequency of the PLHV genomes group the PLHVs with several members of the genus Rhadinovirus such as herpesvirus saimiri (HVS or SaHV-2), murine gammaherpesvisus-68 (MHV-68) and AlHV-1, which exhibit low G+C contents of 35 (HVS) and 46 mol% (AlHV-1, MHV-68) as well as global CpG suppression (Albrecht et al., 1992 ; Ensser et al., 1997 ; Virgin et al., 1997 ). This characteristic dinucleotide frequency was suggested to be an indicator of the state of latency of A+T-rich lymphotropic herpesviruses (Honess et al., 1989 ).As proposed previously (Ehlers et al., 1999b ), PLHV-1 and PLHV-2 are different species rather than merely strains of the same species, since the two viruses exhibited 50 amino acid differences in the DPOL genes. In contrast, strains of the same gammaherpesvirus species appear to contain no mutations or only a few, mostly silent, mutations in their DPOL genes, as shown for the complete DPOL genes of different strains of human herpesvirus-8 (HHV-8) (Neipel et al., 1998 ), Tupaia herpesvirus (Springfeld et al., 1998 ) and the recently discovered rhesus monkey rhadinovirus (RRV) (Searles et al., 1999 ). The same observation was made with partial DPOL sequences of strains of several other herpesvirus species from different subfamilies (VanDevanter et al., 1996 ; Ehlers et al., 1999a ). We therefore propose the taxonomic names suid herpesvirus-3 (SuHV-3) and suid herpesvirus-4 (SuHV-4) for PLHV-1 and PLHV-2.
Both PLHVs were found in organs of 19 feral pigs, with an exceptionally high prevalence of PLHV-2. No differences were found between the domestic and feral pig sequences, suggesting the presence of the same virus species in domestic and feral pigs. Therefore, transfer of these viruses between feral and domestic pig populations might be possible, as has been reported for PRV (Capua et al., 1997 ) and classical swine fever virus (Stadejek et al., 1997 ). This underlines the need for the isolated breeding of pigs intended for use as organ donors in xenotransplantation.
The discovery of the porcine lymphotropic gammaherpesviruses PLHV-1 and PLHV-2 was the result of a search for unknown herpesviruses in order to unravel risk factors in xenotransplantation. Therefore, the possible pathogenic potential of the PLHVs, not only for pigs but especially for immunocompromised humans, is of concern and should be analysed further. An initial step in this direction was the comparative analysis of the genetic data acquired so far. It revealed a close relationship of the PLHVs to the ruminant gammaherpesviruses AlHV-1, on the basis of analysis of the complete DPOL gene and the A5 ORF (this study), and ovine herpesvirus-2 (OvHV-2) and bovine lymphotropic herpesvirus (BLHV), on the basis of analysis of partial DPOL sequences (Ehlers et al., 1999b ). AlHV-1 and OvHV-2 cause malignant catarrhal fever, a lymphoproliferative disease of cattle with high mortality (Reid & Buxton, 1989 ), and BLHV has been discussed as a cofactor in bovine leukaemia (Rovnak et al., 1998 ). This suggests possible pathogenicity of the PLHVs. However, no link has yet been discovered between the PLHVs and lymphoproliferative or neoplastic diseases. Growth of the PLHVs in cell culture is a prerequisite for such studies, and such culture experiments are currently in progress.
A common feature of gammaherpesviruses is the presence of homologues of cellular genes. They have been found or predicted to modulate the cell cycle, to regulate apoptosis, to interfere with immune functions or to function in cytokine signal transduction. These genes are probably part of the virus defence mechanisms against elimination by the host and therefore are likely to contribute to virus virulence (reviewed by Neipel et al., 1997 ; Simas & Efstathiou, 1998 ). For this reason, walking on the PLHV-1 genome is continuing to find such virus virulence genes that may contribute to the pathogenicity of the PLHVs for human organ recipients in xenotransplantation.
We thank T. Franz and S. Pociuli for excellent technical assistance, U. Erikli for help with the manuscript and H. Ellerbrok, Robert Koch-Institut, and G. Letchworth, University of Wisconsin-Madison, for critical reading. Organ samples of feral pigs were kindly provided by S. Burckhard (Institut für Lebensmittel, Arzneimittel und Tierseuchen, Berlin). The provision of the PCMV strain B6 by M. Banks (Addlestone, UK) is gratefully acknowledged.Footnotes
The GenBank accession numbers of the sequences determined in this study are AF191042 (PLHV-1), AF191043 (PLHV-2) and AF191044 (PCMV).References
Allan, J. S., Broussard, S. R., Michaels, M. G., Starzl, T. E., Leighton, K. L., Whitehead, E. M., Comuzzie, A. G., Lanford, R. E., Leland, M. M., Switzer, W. M. & Heneine, W. (1998). Amplification of simian retroviral sequences from human recipients of baboon liver transplants. AIDS Research and Human Retroviruses 14, 821-824.[Medline]
Blanco, L., Bernad, A., Blasco, M. A. & Salas, M. (1991). A general structure for DNA-dependent DNA polymerases. Gene 100, 27-38.[Medline]
Breman, J. G., Kalisa-Ruti, Steniowski, M. V., Zanotto, E., Gromyko, A. I. & Arita, I. (1980). Human monkeypox, 197079. Bulletin of the World Health Organization 58, 165182.[Medline]
Britt, W. J. & Alford, C. A. (1996). Cytomegalovirus. In Fields Virology, pp. 2493-2523. Edited by B. N. Fields, D. M. Knipe & P. M. Howley. Philadelphia: LippincottRaven.
Capua, I., Casaccia, C., Calzetta, G. & Caporale, V. (1997). Characterization of Aujeszkys disease viruses isolated from domestic animals and from a wild boar (Sus scrofa) in Italy between 1972 and 1995. Veterinary Microbiology 57, 143-149.[Medline]
Ehlers, B., Borchers, K., Grund, C., Frölich, K., Ludwig, H. & Buhk, H.-J. (1999a). Detection of new DNA polymerase genes of known and potentially novel herpesviruses by PCR with degenerate and deoxyinosine-substituted primers. Virus Genes 18, 211-220.[Medline]
Ehlers, B., Ulrich, S. & Goltz, M. (1999b). Detection of two novel porcine herpesviruses with high similarity to gammaherpesviruses. Journal of General Virology 80, 971-978.[Abstract]
Enserink, M. (1999). New virus fingered in Malaysian epidemic. Science 284, 407-410.
Ensser, A., Pflanz, R. & Fleckenstein, B. (1997). Primary structure of the alcelaphine herpesvirus 1 genome. Journal of Virology 71, 6517-6525.[Abstract]
Felsenstein, J. (1985). Confidence limits on phylogenies: an approach using the bootstrap. Evolution 39, 783-791.
Felsenstein, J. (1993). PHYLIP (phylogeny inference package) version 3.5c. Distributed by the author. Department of Genetics, University of Washington, Seattle, WA, USA.
Feranchak, A. P., Tyson, R. W., Narkewicz, M. R., Karrer, F. M. & Sokol, R. J. (1998). Fulminant EpsteinBarr viral hepatitis: orthotopic liver transplantation and review of the literature. Liver Transplantation and Surgery 4, 469-476.[Medline]
Fishman, J. A. (1994). Miniature swine as organ donors for man: strategies for prevention of xenotransplant-associated infections. Xenotransplantation 1, 47-57.
Fishman, J. A. (1997). Xenosis and xenotransplantation: addressing the infectious risks posed by an emerging technology. Kidney International Supplementum 58, S41-S45.
Gao, F., Yue, L., White, A. T., Pappas, P. G., Barchue, J., Hanson, A. P., Greene, B. M., Sharp, P. M., Shaw, G. M. & Hahn, B. H. (1992). Human infection by genetically diverse SIVSM-related HIV-2 in west Africa. Nature 358, 495-499.[Medline]
Gao, F., Bailes, E., Robertson, D. L., Chen, Y., Rodenburg, C. M., Michael, S. F., Cummins, L. B., Arthur, L. O., Peeters, M., Shaw, G. M., Sharp, P. M. & Hahn, B. H. (1999). Origin of HIV-1 in the chimpanzee Pan troglodytes troglodytes. Nature 397, 436-441.[Medline]
Holmes, G. P., Chapman, L. E., Stewart, J. A., Straus, S. E., Hilliard, J. K. & Davenport, D. S. (1995). Guidelines for the prevention and treatment of B-virus infections in exposed persons. The B virus Working Group. Clinical Infectious Diseases 20, 421-439.[Medline]
Honess, R. W., Gompels, U. A., Barrell, B. G., Craxton, M., Cameron, K. R., Staden, R., Chang, Y.-N. & Hayward, G. S. (1989). Deviations from expected frequencies of CpG dinucleotides in herpesvirus DNAs may be diagnostic of differences in the states of their latent genomes. Journal of General Virology 70, 837-855.
Hudnall, S. D., Rady, P. L., Tyring, S. K. & Fish, J. C. (1998). Serologic and molecular evidence of human herpesvirus 8 activation in renal transplant recipients. Journal of Infectious Diseases 178, 1791-1794.[Medline]
Kadakia, M. P. (1998). Human herpesvirus 6 infection and associated pathogenesis following bone marrow transplantation. Leukemia & Lymphoma 31, 251-266.
Knopf, C. W. (1998). Evolution of viral DNA-dependent DNA polymerases. Virus Genes 16, 47-58.[Medline]
Kocher, T. D., Thomas, W. K., Meyer, A., Edwards, S. V., Pææbo, S., Villablanca, F. X. & Wilson, A. C. (1989). Dynamics of mitochondrial DNA evolution in animals: amplification and sequencing with conserved primers. Proceedings of the National Academy of Sciences, USA 86, 6196-6200.
McGeoch, D. J., Cook, S., Dolan, A., Jamieson, F. E. & Telford, E. A. R. (1995). Molecular phylogeny and evolutionary timescale for the family of mammalian herpesviruses. Journal of Molecular Biology 247, 443-458.[Medline]
Martin, U., Kiessig, V., Blusch, J. H., Haverich, A., von der Helm, K., Herden, T. & Steinhoff, G. (1998). Expression of pig endogenous retrovirus by primary porcine endothelial cells and infection of human cells. Lancet 352, 692-694.[Medline]
Michaels, M. G. (1997). Infectious concerns of cross-species transplantation: xenozoonoses. World Journal of Surgery 21, 968-974.[Medline]
Moretti, T., Koons, B. & Budowle, B. (1998). Enhancement of PCR amplification yield and specificity using AmpliTaq Gold DNA polymerase. BioTechniques 25, 716-722.[Medline]
Neipel, F., Albrecht, J.-C. & Fleckenstein, B. (1997). Cell-homologous genes in the Kaposis sarcoma-associated rhadinovirus human herpesvirus 8: determinants of its pathogenicity? Journal of Virology 71, 4187-4192.[Medline]
Neipel, F., Albrecht, J.-C. & Fleckenstein, B. (1998). Human herpesvirus 8 the first human Rhadinovirus. Journal of the National Cancer Institute Monographs 23, 73-77.
Patience, C., Takeuchi, Y. & Weiss, R. A. (1997). Infection of human cells by an endogenous retrovirus of pigs. Nature Medicine 3, 282-286.[Medline]
Reid, H. W. & Buxton, D. (1989). Malignant catarrhal fever and the Gammaherpesvirinae of Bovidae. In Herpesvirus Diseases of Cattle, Horses and Pigs, pp. 116-162. Edited by G. Wittmann. Boston: Kluwer.
Rovnak, J., Quackenbush, S. L., Reyes, R. A., Baines, J. D., Parrish, C. R. & Casey, J. W. (1998). Detection of a novel bovine lymphotropic herpesvirus. Journal of Virology 72, 4237-4242.
Searles, R. P., Bergquam, E. P., Axthelm, M. K. & Wong, S. W. (1999). Sequence and genomic analysis of a rhesus macaque rhadinovirus with similarity to Kaposis sarcoma-associated herpesvirus/human herpesvirus 8. Journal of Virology 73, 3040-3053.
Siebert, P. D., Chenchik, A. & Kellogg, D. E. (1995). The Human GenomeWalker DNA Walking Kit: an improved method for walking in uncloned genomic DNA. CLONTECHniques X (II), 13.
Simas, J. P. & Efstathiou, S. (1998). Murine gammaherpesvirus 68: a model for the study of gammaherpesvirus pathogenesis. Trends in Microbiology 6, 276-282.[Medline]
Springfeld, C., Tidona, C. A., Kehm, R., Bahr, U. & Darai, G. (1998). Identification and characterization of the Tupaia herpesvirus DNA polymerase gene. Journal of General Virology 79, 3049-3053.[Abstract]
Stadejek, T., Vilcek, S., Lowings, J. P., Ballagi-Pordany, A., Paton, D. J. & Belak, S. (1997). Genetic heterogeneity of classical swine fever virus in Central Europe. Virus Research 52, 195-204.[Medline]
VanDevanter, D. R., Warrener, P., Bennett, L., Schultz, E. R., Coulter, S., Garber, R. L. & Rose, T. M. (1996). Detection and analysis of diverse herpesviral species by consensus primer PCR. Journal of Clinical Microbiology 34, 1666-1671.[Abstract]
Virgin, H. W.IV, Latreille, P., Wamsley, P., Hallsworth, K., Weck, K. E., Dal Canto, A. J. & Speck, S. H. (1997). Complete sequence and genomic analysis of murine gammaherpesvirus 68. Journal of Virology 71, 5894-5904.[Abstract]
Ye, Y., Niekrasz, M., Kosanke, S., Welsh, R., Jordan, H. E., Fox, J. C., Edwards, W. C., Maxwell, C. & Cooper, D. K. C. (1994). The pig as a potential organ donor for man. A study of potentially transferable disease from donor pig to recipient man. Transplantation 57, 694-703.[Medline]
Received 19 June 1999; accepted 26 August 1999.