Research Article

Latency-associated transcripts of equine herpesvirus type 4 in trigeminal ganglia of naturally infected horses

Journal of General Virology 1999; 80(8):2165

PubMed

With thanks to our partners for supporting this archive.

Abstract

Equine herpesvirus type 4 (EHV-4) is a major respiratory pathogen of horses. Unlike most other members of the Alphaherpesvirinae, EHV-4 was regarded as non-neurotropic. Here, neural and lymphoid tissues of 17 horses have been analysed post-mortem. EHV-4 DNA was detected in 11 cases (65%) by PCR, exclusively in the trigeminal ganglia. In order to define the transcriptional activity, RNA preparations of 10 EHV-4 DNA-positive ganglia were investigated by nested RTPCR. EHV-4-specific transcripts derived from genes 63 [herpes simplex virus type 1 (HSV-1) ICP0 gene homologue] and 64 (HSV-1 ICP4 gene homologue) were detected in six trigeminal ganglia. In one other case, only gene 64-specific transcripts were present. All of the transcripts proved to be antisense orientated when a strand-specific RTPCR was applied. Type-specific primers for gene 33 (encoding glycoprotein B) served to detect transcripts of an acute EHV-4-infection, which were found in only one of the six ganglia positive for gene 63- and gene 64-specific transcripts. Overall, these studies clearly demonstrate that EHV-4 is latent in trigeminal ganglia.
Equine herpesvirus type 4 (EHV-4) belongs to the Alphaherpesvirinae, one of the three subfamilies of the Herpesviridae, which includes the closely related EHV-1, Marek's disease virus (MDV), bovine herpesvirus type 1 (BHV-1), pseudorabies virus (PRV), feline herpesvirus type 1 (FHV-1) as well as human herpes simplex virus types 1 and 2 (HSV-1, HSV-2). Most of these viruses have been reported to establish latency in neural tissues, mainly in the trigeminal ganglion (Gaskell et al., 1985 ; Rock et al., 1986 , 1987 ; Cheung, 1989 ; Mitchell et al., 1990 ; Ohmura et al., 1993 ; Slater et al., 1994 ), with the exception of MDV, which is T-cell tropic (Cantello et al., 1994 ; Li et al., 1994 ). EHV-1 and PRV seem to be both neurotropic and lymphotropic (Ohlinger et al., 1987 ; Welch et al., 1992 ; Slater et al., 1994 ; Edington et al., 1994 ; Chesters et al., 1997 ; Smith et al., 1998 ).

It is known from the well-studied HSV-1 that, in the natural host, the virus enters the sensory nerve endings after an initial acute infection of peripheral tissues and is transported to neuronal cell bodies by retrograde axonal transport (reviewed in Roizman & Sears, 1987 ). HSV-1 remains life-long in these non-proliferating cells in a non-integrated form (Mellerick & Fraser, 1987 ).

The virus is undetectable by classical diagnostic techniques during the latent phase. Reactivation occurs periodically, however, and virus is then transported anterograde via the axon from the nerve cell body to the original peripheral site of infection, where it causes recurrent lesions through productive virus replication. Stroop et al. (1984) detected the so-called latency-associated transcripts (LATs), which comprise a family of overlapping transcripts, the only detectable RNAs in the nuclei of latently HSV-1-infected neurons or of T cells, in the case of MDV (Shek et al., 1983 ). HSV-1 LATs are about 2 and 1·3 kb in length and represent introns derived from the processing of an 8·3 kb precursor mRNA. Moreover, the 2 kb LAT is complementary to the HSV-1 immediate-early (IE) gene ICP0 and partially overlaps the 3' end of the corresponding transcript (Rock et al., 1987 ; Dobson et al., 1989 ). RNA antisense to gene ICP0 has also been detected for HSV-2 and BHV-1 (Kutish et al., 1990 ; Tenser et al., 1991 ; reviewed in Jones, 1998 ), while PRV, MDV and FHV-1 express transcripts derived from gene ICP4, another IE gene (Cheung, 1989 , 1991 ; Li et al., 1994 ; Cantello et al., 1994 ; Kawaguchi et al., 1994 ). In the case of EHV-1, Chesters et al. (1997) found gene 64-specific (HSV-1 ICP4 gene homologue) LATs in peripheral blood leukocytes (PBL). We and others discovered EHV-1 LATs derived from gene 63 (HSV-1 ICP0 gene homologue) in trigeminal ganglia (Baxi et al., 1995 ; Borchers et al., 1999 ). Gene 63 belongs to the early kinetic class of viral genes (Bowles et al., 1997 ). The majority of the LATs studied to date, however, are transcribed from IE genes. Although the function and significance of the LATs remain undefined, they are considered to represent latency markers.

Conflicting results have been reported on the tissue tropism of latent EHV-4. Thus, on the one hand, EHV-4 has been found to establish latency in lymph nodes of the respiratory tract and in PBL (Welch et al., 1992 ; Edington et al., 1994 ). Although EHV-4 has, on rare occasions, been shown to be viraemic, in contrast to EHV-1, this is not a dominant feature of EHV-4 pathogenesis (Allen & Bryans, 1986 ; Edington et al., 1994 ). Recently, in situ PCR studies on trigeminal ganglia of naturally infected horses demonstrated that EHV-4 DNA is located in the nuclei of these cells (Borchers et al., 1997 ).

In order to investigate the transcriptional activity of latent EHV-4, we used trigeminal ganglia that tested positive for EHV-4 DNA by gene 33-specific nested PCR (nPCR). Nested RTPCR (nRTPCR) analysis demonstrated that latent EHV-4 expresses transcripts complementary to gene 63 and gene 64 mRNA in these tissues.

Sample origin.
Seventeen horses, all exhibiting different severe clinical signs, have been subjected to autopsy. The EHV antibody status of these horses was unknown. Specimens (cerebrum, cerebellum, olfactory bulb, medulla oblongata, trigeminal ganglion, spinal cord, ischiatic nerve, optic nerve, lung, liver, spleen, bronchial lymph nodes and tonsils) were collected post-mortem and either stored immediately at -70 °C or used directly for nucleic acid extraction.

Tissue DNA extraction and nPCR.
DNA from equine tissues was extracted as detailed elsewhere (Slater et al., 1994 ). All tissue manipulations were performed in an EHV-1- and EHV-4-free flow cabinet to avoid contamination. The quantity of DNA was monitored by spectrophotometry and the quality by amplification of a 248 bp ß-actin fragment (upstream primer 5' GTGTGGTGCCAAATCTTCTCC 3'; downstream primer 5' GCGCTCGTCGTCGACAACGG 3').

The nPCR for EHV-4 genes 33, 63 and 64 were established on the basis of the sequences published by Telford et al. (1998) by using computer software (Oligo version 4.0 for Macintosh), with one exception: gene 64 primers 3 and 4 were derived from the EHV-1 sequence (Telford et al., 1992 ). These primers have only two and three mismatches with the EHV-4 sequence, respectively, leading to cross-reactivity with EHV-4. Since this primer pair was used in the second round of nPCR, after an EHV-4-specific amplification with primers 1 and 2, the resulting amplification product was EHV-4 specific. Details of the primers and amplification products are given in Table 1 and Fig. 1. The PCR mixtures (50 µl) contained 1 µg cellular DNA, 0·4 µM of each primer, 0·2 mM dNTPs, 1·5 U Taq polymerase (Qiagen) and 1xreaction buffer, as well as 1x Q-solution (Qiagen). Finally, the aqueous phase was covered with a drop of mineral oil (Sigma).


Table 1. Primer sequences, fragment sizes and conditions for EHV-4-specific nPCR



(19K):

Fig. 1. Genomic localization of EHV-4 transcripts amplified by nRTPCR. The 150 kbp EHV-4 DNA consists of two unique regions (UL and US) flanked by repeats (IRS and TRS). The location and size of the amplification products of the EHV-4 gene 33-specific nPCR are given in relation to ORF33 (a). Two putative LAT fragments amplified by nRTPCR are shown in relation to ORF63 and ORF64 (b). The orientation of the nPCR primers and the mRNA of ORF33, ORF63 and ORF64 are indicated by arrows.

Cycling was carried out using a thermal cycler (UNO-thermoblock, Biometra). Following an initial denaturing step (1 min at 94 °C and 3 min at 96 °C), 35 amplification cycles were performed consisting of denaturation at 94 °C and then at 96 °C for 30 s each, annealing at the experimentally optimized temperature (Table 1) for 30 s and extension at 72 °C for 1 min. With the exception of the gene 63-specific primers 3 and 4, which were 21 nucleotides long, all primers were 20mers. Aliquots (1 µl) of the first PCR were amplified with the inner pair of primers in a second round.

Gene 33-specific nested primer sets were used for the detection of EHV-1 DNA and primers derived from genes 63 and 64 were used for the amplification of LAT fragments, as described elsewhere (Borchers et al., 1999 ).

Purified DNA from EHV-4 strain T252 and EHV-1 strain Mar87 was used as a positive control. At least one reagent control was included in each nPCR experiment.

The PCR products were analysed in an ethidium bromide-stained 1% agarose gel. The sensitivity of all nPCRs was calculated to be 1 fg purified EHV-4 DNA after the second round of PCR. With the exception of the gene 64-specific primers 3 and 4, none of the EHV-4-specific nPCR primers showed cross-reactivity with EHV-1 DNA.

RNA extraction from tissues and infected cell cultures and analysis by nRTPCR.
For the detection of viral transcripts, RNA was extracted from horse tissues using the TRIzol reagent (Life Technologies) according to the manufacturer's instructions. As a positive control, equine dermal (ED) cells grown in Dulbecco's modified Eagle's minimum essential medium supplemented with 5% foetal calf serum were infected with 1 p.f.u. per cell of EHV-4 (strain T252) or EHV-1 (strain Mar87). After 24 h (EHV-1) or 48 h (EHV-4), the infected cells were harvested and pelleted. Finally, 2x106 cells were used for RNA extraction. Isolated RNA was further treated with DNase I (Boehringer) at 37 °C for 40 min to digest any contaminating viral DNA. The enzyme was removed by applying the sample to an RNeasy spin column (Qiagen). To prove the absence of viral DNA, 1 µg of each RNA preparation, including that of infected cells, was tested by EHV-1 and EHV-4 gene 63 nPCR. None of the preparations contained viral DNA, as shown for representative samples analysed with EHV-4 gene 63 nested primers (Fig. 2). Virus DNA-free RNA (2 µg) was then reverse-transcribed using Expand reverse transcriptase (Boehringer) and random-hexamer primers (50 pmol/µl). After the reverse transcription reaction the enzyme was inactivated by incubation for 5 min at 95 °C. One-tenth of the cDNA was subjected to EHV-1 and EHV-4 nPCRs. Expression of ß-actin mRNAs in all tissue samples was used as a control of RNA quality.



(33K):

Fig. 2. EHV-4 gene 63-specific nPCR on RNA preparations. In order to exclude the presence of viral DNA in tissue RNA preparations, the latter were treated with DNase. Subsequently, 1 µg of each RNA preparation derived from the trigeminal ganglia of horses 656, 915, 1207, 584, 2163, 16, 2103, 2155, 1697 and 2094 (lanes 110) was subjected to EHV-4 gene 63 nPCR. None of the RNA preparations contained viral DNA. As controls, EHV-4-infected ED cells (lane 11), a negative reagent control (12) and purified EHV-4 virus DNA (13) were used. Lane M contains DNA markers φX-174/HaeIII and λ-RF/HindIII.

Determination of the orientation of viral transcripts.
The outer nPCR primer pairs of genes 33, 63 and 64 were used to define the orientation of the EHV-4 transcripts. In vitro reverse transcription was performed in individual reactions with either the sense or the antisense primer and Expand reverse transcriptase (Boehringer) according to manufacturer's recommendation. To avoid non-specific binding, only 0·25 pmol of each of the primers was used. Furthermore, the duration of the reverse transcription reaction was reduced from 1 h to 10 min at 42 °C. The reactions were set up simultaneously to provide exactly the same conditions for both primers. One-tenth of the resulting cDNA was amplified by nPCR as described above. As controls, RNA preparations derived from non-infected and acutely EHV-4-infected ED cells were used. Since the type of EHV-4-specific LATs present in naturally infected tissues is unknown, neural and lymphoid tissues from randomly selected horses were analysed by liquid nPCR to identify putative latently infected samples. EHV-4 DNA was detected by type-specific gene 33 nPCR in 11 of 17 samples (65%) from horses exhibiting different clinical signs, exclusively in the trigeminal ganglia (Table 2). All other tissues were EHV-4 DNA negative. Six of the 11 EHV-4 DNA-positive horses (16, 656, 1207, 1697, 2094 and 2163) had ataxia or central nervous system (CNS) signs. Five of the trigeminal ganglia were simultaneously infected with EHV-1 (animals 584, 656, 915, 2094 and 2155), as demonstrated by amplification of EHV-1 gene 33-specific sequences (Borchers et al., 1999 ).


Table 2. PCR and nRTPCR results from 17 trigeminal ganglia derived from naturally EHV-4-infected horses with different clinical signs


Detection of EHV-4 transcripts by nRTPCR
In order to clarify whether the PCR-positive tissues contained latent or infectious virus, we analysed whole RNA preparations from 10 of 11 EHV-4 PCR-positive trigeminal ganglia and one PCR-negative sample for viral transcripts. Since the quantity and quality of the RNA preparation from the trigeminal ganglion of horse 916, which was EHV-4 DNA positive, was not suitable, RTPCR was not carried out.

According to the observation that the 2 kb LAT of HSV-1 appears not to be polyadenylated (Wagner et al., 1988 ), we used random-hexamer primers for in vitro reverse transcription. The cDNA obtained was then submitted to gene 33-, 63- and 64-specific nPCR. Cells productively infected with EHV-4 served as a positive control. RNA derived from these cells was nRTPCR positive for all three genes. In comparison, EHV-4 gene 63 and gene 64 transcripts were amplified from the trigeminal ganglia of horses 16, 656, 915, 1697, 2155 and 2163 (Table 2). In horse 584, we only found gene 64 transcripts and we detected gene 33-specific transcripts in addition to those derived from genes 63 and 64 in horse 2163. All other ganglia were negative for gene 33 transcripts (data not shown).

In order to confirm that the positive RTPCR resulted from the detection of transcripts and not from contamination of samples with viral DNA, all RNA preparations were treated with DNase and checked by nPCR prior to RTPCR analysis. As shown in Fig. 2, none of the preparations used was EHV-4 DNA positive. The same control experiment was done to exclude contamination with EHV-1 DNA (data not shown).

Since the inner primer pair of the EHV-4 gene 64 nPCR cross-reacts with EHV-1, we checked all ganglion samples for EHV-1 gene 64-specific sequences. As described elsewhere (Borchers et al., 1999 ) and as shown for representative animals 16, 1207, 1672, 2103, 656 and 915 (Fig. 3c), none of the ganglia contained EHV-1 gene 64 transcripts, as shown by using nested primer pairs amplifying the LAT region defined by Chesters et al. (1997) . However, in the ganglia of horses 656 and 915, we described previously the presence of EHV-1-specific LATs derived from gene 63 (Borchers et al., 1999 ), an LAT region published by Baxi et al. (1995) . As already mentioned above and demonstrated in Fig. 3(a, b), these two ganglia also contained EHV-4 gene 63 and 64 transcripts. Since both the EHV-1 and EHV-4 gene 63 nPCRs are type-specific, we could discriminate between EHV-1- and EHV-4-specific LATs.



(44K):

Fig. 3. Detection of EHV-4-specific transcripts in RNA preparations from trigeminal ganglia by nRTPCR. Virus DNA-free RNA (2 µg) was subjected to nRTPCR specific for EHV-4 gene 63 (a), EHV-4 gene 64 (b) and EHV-1 gene 64 (c). The following trigeminal ganglia are shown (lanes 16): 16, 1207, 1672, 2103, 656 and 915. As controls, RNA derived from non-infected ED cells (lanes 7) as well as from ED cells infected with EHV-4 (a, b) or EHV-1 (c) (lanes 8) was used. A negative reagent control (lanes 9) and purified EHV-4 (a, b) and EHV-1 (c) DNA (lanes 10) served as further controls. Lanes M contain DNA markers φX-174/HaeIII and λ-RF/HindIII.

Orientation of EHV-4 LATs
Virus DNA-free RNA preparations from EHV-4-positive trigeminal ganglia, together with either the sense or the antisense primer (Fig. 1) of the type-specific gene 63 and gene 64 nPCR, were applied to individual reverse transcription reactions and subsequently to the corresponding nPCR, in order to define the orientation of the EHV-4 transcripts. As shown for representative ganglia 16, 1697 and 2155, RNA was transcribed with primer 2 of either the gene 63 or gene 64 nPCR (Fig. 4a, b). No transcripts were amplified by the corresponding primers 1. Since primer 2 has the same sense as the gene 63 and 64 mRNA, it binds antisense transcripts (Fig. 1). We therefore concluded that EHV-4 gene 63 and gene 64 transcripts from latently infected ganglia were exclusively in the antisense orientation. This was also the case for the transcripts detected in the ganglia of horses 656, 584, 915 and 2163 (data not shown). However, cDNA from acutely infected cell cultures was PCR positive after reverse transcription with each of the two primers and was therefore shown to contain both sense and antisense transcripts (Fig. 4a, b). Using the EHV-4 gene 33 primers in the same way as described above, we confirmed that acutely infected cells also contained gene 33-derived transcripts of both orientations (data not shown). However, in the latently infected ganglion of horse 2163, gene 33 transcripts were amplified only when reverse transcription was carried out with primer 2, which is complementary to the gene 33 mRNA (Fig. 4c). Consequently, the transcripts detected had sense polarity only.



(51K):

Fig. 4. Orientation of viral EHV-4 transcripts. Primer 1 or 2 from the nPCR specific for EHV-4 gene 63 (a), gene 64 (b) or gene 33 (c) was used in individual reactions for reverse transcription of whole RNA preparations from equine trigeminal ganglia. cDNA was synthesized only when primer 2 was used, as demonstrated after amplification of one-tenth of the reverse transcription products by nPCR in lanes 69 (a, b) or in lane 2 (c). No amplification products were generated with primer 1 in lanes 13 of (a, b) or lane 1 (c). However, PCR products were obtained using RNA from EHV-4-infected ED cells (lanes 4; a, b). (a)(b) RNA for nRTPCR was derived from: ganglia 16 (lanes 1, 6), 1697 (2, 7) and 2155 (3, 8) or EHV-4-infected ED cells (4, 9). A negative reagent control is shown in lanes 10, and lanes 11 contain the positive control (purified EHV-4 DNA). Lane 5 contains the DNA marker φX-174/Hae III. (c) RNA was derived from ganglion 2163. Lane 3 contains the negative reagent control and lane 4 contains the positive control (purified EHV-4 DNA).
Latent EHV-4 has been reactivated by co-cultivation from both lymphoid and neural tissues (Allen & Bryans, 1986 ; Edington et al., 1994 ), although the site of latency was considered to be the lymphoid system (Edington et al., 1994 ). Recently, however, we detected latent EHV-4 in 4/15 trigeminal ganglia (26%) of naturally infected horses, but not in PBL or lymph nodes (Borchers et al., 1997 ). Here, we have extended our inquiries into the transcriptional activity of latent EHV-4.

Tissues of 17 horses, all exhibiting severe clinical signs, that have been subjected to autopsy were used for this study. More than half of the animals (11 of 17) had evidence of EHV-4 infection based on the detection of EHV-4 DNA in the trigeminal ganglia by a sensitive type-specific nPCR. Five of the 11 animals were positive for both EHV-4 and EHV-1, but there was no obvious relationship between either infection and the clinical signs reported at the time of death. However, the presence of latent EHV-4 in trigeminal ganglia may be significant, as it would provide a reservoir from which latent EHV-4 could be reactivated and spread to the nasal mucosa, where transmission to susceptible hosts via the respiratory tract would be facilitated. EHV-4 is most likely to enter the trigeminal ganglion via nasal epithelium, as shown for EHV-1 (Baxi et al., 1995 ; Bartels et al., 1998 ) and PRV (Kritas et al., 1994 , 1995 ). The existence of ganglionic latency suggests that reactivation results in anterograde axonal distribution of infectious virus to the respiratory site of recurrence without viraemia. This is in accordance with the finding that EHV-4 has seldom been found in the peripheral blood (Matsumura et al., 1992 ).

Because Northern blot hybridization of RNA preparations from latently infected tissues gave no signals, even when 32P-labelled viral genomic or subgenomic probes were used (data not shown), we preferred the more sensitive nRTPCR technique for transcript analysis. Genes 63 and 64 were chosen as targets as both encode LATs in other alphaherpesviruses. EHV-4 DNA-positive trigeminal ganglia were used for RNA preparation and subsequent nRTPCR. Only samples that were completely free of viral DNA were used for cDNA production. We detected transcripts derived from genes 63 and 64 in six of the ganglia, whereas a seventh ganglion contained only gene 64-specific transcripts. Recently, the same tissues were analysed for latent EHV-1 (Borchers et al., 1999 ) and we emphasize that they were negative for EHV-1-specific gene 64 transcripts. However, EHV-1 gene 63-specific transcripts were detected in the ganglia of horses 656 and 915. Thus, in contrast to EHV-1 and most other alphaherpesviruses, EHV-4 expressed LATs derived from both genes 63 and 64. Our failure to detect LATs in all of the EHV-4 DNA-positive trigeminal ganglia (Table 1) may be due to small numbers of neuronal cells being latently infected. Thus, even in experimentally infected animals, EHV-1 LATs were found in only 2/4 ponies (Baxi et al., 1995 ) and FHV-1 transcripts in 3/5 cats (Ohmura et al., 1993 ).

The absence of gene 33 transcripts in all ganglia harbouring gene 63 and gene 64 transcripts, with the exception of one (animal 2163), suggested that these tissues were latently infected. In order to prove this, we analysed the polarity of the transcripts. Whereas gene 63- and 64-specific transcripts had antisense orientation, the gene 33 transcripts had the same sense as the mRNA. In contrast, in RNA preparations of productively infected cells, transcripts of both polarities were detected. Hence, complementary mRNAs are probably produced by opposite transcription of the same DNA segment in productively infected cells. The detection of gene 33-specific transcripts with sense orientation in one ganglion may result from spontaneous reactivation that did not yield detectable levels of infectious virus.

In summary, we found EHV-4 DNA in 11 of 17 naturally infected equine trigeminal ganglia, five of which were simultaneously EHV-1 DNA positive. Transcripts derived from genes 63 and 64 were discovered in six of the EHV-4 DNA-positive ganglia. The antisense polarity of the transcripts strongly suggests that they are real LATs. Further studies are necessary to define the full size of these transcripts and their functional role in natural infection.

We thank A. Schellenbach for performing the nRTPCR experiments. We are grateful to E. Deegen, F. Glitz, P. Wohlsein, P. Thein and especially to B. Lawrenz for providing us with post-mortem tissues. We also thank A. Davison for making EHV-4 sequence data available prior to publication. G. J. Letchworth is especially thanked for critical review of the manuscript. This work was supported by a grant of the Deutsche Forschungsgemeinschaft (DFG), Bo 1005/3-2.

References

Allen, G. P. & Bryans, J. T. (1986). Molecular epizootiology, pathogenesis, and prophylaxis of equine herpesvirus-1 infections. Progress in Veterinary Microbiology and Immunology 2, 78-144.[Medline]

Bartels, T., Steinbach, F., Hahn, G., Ludwig, H. & Borchers, K. (1998). In situ study on the pathogenesis and immune reaction of equine herpesvirus type 1 (EHV-1) infections in mice. Immunology 93, 329-334.[Medline]

Baxi, M. K., Efstathiou, S., Lawrence, G., Whalley, J. M., Slater, J. D. & Field, H. J. (1995). The detection of latency-associated transcripts of equine herpesvirus 1 in ganglionic neurons. Journal of General Virology 76, 3113-3118.[Abstract/Free Full Text]

Borchers, K., Wolfinger, U., Lawrenz, B., Schellenbach, A. & Ludwig, H. (1997). Equine herpesvirus 4 DNA in trigeminal ganglia of naturally infected horses detected by direct in situ PCR. Journal of General Virology 78, 1109-1114.[Abstract]

Borchers, K., Wolfinger, U., Schellenbach, A., Lawrenz, B., Glitz, F. & Ludwig, H. (1999). Equid herpesvirus type 1 (EHV-1) and trigeminal ganglia of naturally infected horses: detection of DNA and latency associated transcripts (LATs) by RT-PCR. In Proceedings of the 18th International Conference on Equine Infectious Diseases, pp. 147-152. Edited by U. Wernery, J. F. Wade, J. A. Mumford & O.-R. Kaaden. Newmarket: R & W Publications.

Bowles, D. E., Holden, V. R., Zhao, Y. & O'Callaghan, D. J. (1997). The ICP0 protein of equine herpesvirus 1 is an early protein that independently transactivates expression of all classes of viral promoters. Journal of Virology 71, 4904-4914.[Abstract]

Cantello, J. L., Anderson, A. S. & Morgan, R. W. (1994). Identification of latency-associated transcripts that map antisense to the ICP4 homolog gene of Marek's disease virus. Journal of Virology 68, 6280-6290.[Abstract/Free Full Text]

Chesters, P. M., Allsop, R., Purewal, A. & Edington, N. (1997). Detection of latency-associated transcripts of equid herpesvirus 1 in equine leukocytes but not in trigeminal ganglia. Journal of Virology 71, 3437-3443.[Abstract]

Cheung, A. K. (1989). Detection of pseudorabies virus transcripts in trigeminal ganglia of latently infected swine. Journal of Virology 63, 2908-2913.[Abstract/Free Full Text]

Cheung, A. K. (1991). Cloning of the latency gene and the early protein 0 gene of pseudorabies virus. Journal of Virology 65, 5260-5271.[Abstract/Free Full Text]

Dobson, A. T., Sederati, F., Devi-Rao, G., Flanagan, W. M., Farrell, M. J., Stevens, J. G., Wagner, E. K. & Feldman, L. T. (1989). Identification of the latency-associated transcript promoter by expression of rabbit beta-globin mRNA in mouse sensory nerve ganglia latently infected with a recombinant herpes simplex virus. Journal of Virology 63, 3844-3851.[Abstract/Free Full Text]

Edington, N., Welch, H. M. & Griffiths, L. (1994). The prevalence of latent equid herpesviruses in the tissues of 40 abattoir horses. Equine Veterinary Journal 26, 140-142.[Medline]

Gaskell, R. M., Dennis, P. E., Goddard, L. E., Cocker, F. M. & Wills, J. M. (1985). Isolation of felid herpesvirus I from the trigeminal ganglia of latently infected cats. Journal of General Virology 66, 391-394.[Abstract/Free Full Text]

Jones, C. (1998). Alphaherpesvirus latency: its role in disease and survival of the virus in nature. Advances in Virus Research 51, 81-133.[Medline]

Kawaguchi, Y., Maeda, K., Miyazawa, T., Ono, M., Kai, C. & Mikami, T. (1994). Nucleotide sequence and characterization of the feline herpesvirus type 1 immediately early gene. Virology 204, 430-435.[Medline]

Kritas, S. K., Pensaert, M. B. & Mettenleiter, T. C. (1994). Role of envelope glycoproteins gI, gp63 and gIII in the invasion and spread of Aujeszky's disease virus in the olfactory nervous pathway of the pig. Journal of General Virology 75, 2319-2327.[Abstract/Free Full Text]

Kritas, S. K., Nauwynck, H. J. & Pensaert, M. B. (1995). Dissemination of wild-type and gC-, gE- and gI-deleted mutants of Aujeszky's disease virus in the maxillary nerve and trigeminal ganglion of pigs after intranasal inoculation. Journal of General Virology 76, 2063-2066.[Abstract/Free Full Text]

Kutish, G., Mainprize, T. & Rock, D. (1990). Characterization of the latency-related transcriptionally active region of the bovine herpesvirus 1 genome. Journal of Virology 64, 5730-5737.[Abstract/Free Full Text]

Li, D.-S., Pastorek, J., Zelník, V., Smith, G. D. & Ross, L. J. N. (1994). Identification of novel transcripts complementary to the Marek's disease virus homologue of the ICP4 gene of herpes simplex virus. Journal of General Virology 75, 1713-1722.[Abstract/Free Full Text]

Matsumura, T., Sugiura, T., Imagawa, H., Fukunaga, Y. & Kamada, M. (1992). Epizootiological aspects of type 1 and type 4 equine herpesvirus infections among horse populations. Journal of Veterinary Medical Science 54, 207-211.[Medline]

Mellerick, D. M. & Fraser, N. W. (1987). Physical state of the latent herpes simplex virus genome in a mouse model system: evidence suggesting an episomal state. Virology 158, 265-275.[Medline]

Mitchell, W. J., Deshmane, S. L., Dolan, A., McGeoch, D. J. & Fraser, N. W. (1990). Characterization of herpes simplex virus type 2 transcription during latent infection of mouse trigeminal ganglia. Journal of Virology 64, 5342-5348.[Abstract/Free Full Text]

Ohlinger, V. F., Heck, R., Behrens, P., Rziha, H.-J., Weiland, F. & Wittmann, G. (1987). Die Infektion von Zellen des hämatopoetischen Systems durch das Aujeszkyvirus Neue Aspekte für Immunbiologie und Praxis? Tierärztliche Umschau 3, 210-219.

Ohmura, Y., Ono, E., Matsuura, T., Kida, H. & Shimizu, Y. (1993). Detection of feline herpesvirus 1 transcripts in trigeminal ganglia of latently infected cats. Archives of Virology 129, 341-347.[Medline]

Rock, D. L., Hagemoser, W. A., Osorio, F. A. & Reed, D. E. (1986). Detection of bovine herpesvirus type 1 RNA in trigeminal ganglia of latently infected rabbits by in situ hybridization. Journal of General Virology 67, 2515-2520.[Abstract/Free Full Text]

Rock, D. L., Nesburn, A. B., Ghiasi, H., Ong, J., Lewis, T. L., Lokensgard, J. R. & Wechsler, S. L. (1987). Detection of latency-related viral RNAs in trigeminal ganglia of rabbits latently infected with herpes simplex virus type 1. Journal of Virology 61, 3820-3826.[Abstract/Free Full Text]

Roizman, B. & Sears, A. E. (1987). An inquiry into the mechanisms of herpes simples virus latency. Annual Reviews in Microbiology 41, 543-571.[Medline]

Shek, W. R., Calnek, B. W., Schat, K. A. & Chen, C. H. (1983). Characterization of Marek's disease virus-infected lymphocytes: discrimination between cytolytically and latently infected cells. Journal of the National Cancer Institute 70, 485-491.

Slater, J. D., Borchers, K., Thackray, A. M. & Field, H. J. (1994). The trigeminal ganglion is a location for equine herpesvirus 1 latency and reactivation in the horse. Journal of General Virology 75, 2007-2016.[Abstract/Free Full Text]

Smith, D. J., Iqbal, J., Purewal, A., Hamblin, A. S. & Edington, N. (1998). In vitro reactivation of latent equid herpesvirus-1 from CD5+/CD8+ leukocytes indirectly by IL-2 or chorionic gonadotrophin. Journal of General Virology 79, 2997-3004.[Abstract]

Stroop, W. G., Rock, D. L. & Fraser, N. W. (1984). Localization of herpes simplex virus in the trigeminal and olfactory systems of the mouse central nervous system during acute and latent infections by in situ hybridization. Laboratory Investigations 51, 27-38.

Telford, E. A. R., Watson, M. S., McBride, K. & Davison, A. J. (1992). The DNA sequence of equine herpesvirus-1. Virology 189, 304-316.[Medline]

Telford, E. A. R., Watson, M. S., Perry, J., Cullinane, A. A. & Davison, A. J. (1998). The DNA sequence of equine herpesvirus-4. Journal of General Virology 79, 1197-1203.[Abstract]

Tenser, B. R., Edris, W. A., Hay, K. A. & de Galan, B. E. (1991). Expression of herpes simplex virus type 2 latency-associated transcript in neurons and nonneurons. Journal of Virology 65, 2745-2750.[Abstract/Free Full Text]

Wagner, E. K., Devi-Rao, G., Feldman, L. T., Dobson, A. T., Zhang, Y.-F., Flanagan, W. M. & Stevens, J. G. (1988). Physical characterization of the herpes simplex virus latency-associated transcript in neurons. Journal of Virology 62, 1194-1202.[Abstract/Free Full Text]

Welch, H. M., Bridges, C. G., Lyon, A. M., Griffiths, L. & Edington, N. (1992). Latent equid herpesviruses 1 and 4: detection and distinction using the polymerase chain reaction and co-cultivation from lymphoid tissues. Journal of General Virology 73, 261-268.[Abstract/Free Full Text]

Received 18 February 1999; accepted 26 April 1999.