Research Article

Role of the cytoplasmic tails of pseudorabies virus glycoproteins B, E and M in intracellular localization and virion incorporation

Journal of General Virology 2001; 82(1):215

PubMed

Abstract

The cytoplasmic domains of several herpesviral glycoproteins encompass potential intracellular sorting signals. To analyse the function of the cytoplasmic domains of different pseudorabies virus (PrV) glycoproteins, hybrid proteins were constructed consisting of the extracellular and transmembrane domains of envelope glycoprotein D (gD) fused to the cytoplasmic tails of gB, gE or gM (designated gDB, gDE and gDM), all of which contain putative endocytosis motifs. gD is a type I membrane protein required for binding to and entry into target cells. Localization of hybrid proteins compared to full-length gB, gE and gM as well as carboxy-terminally truncated variants of gD was studied by confocal laser scanning microscopy. The function of gD hybrids was assayed by trans-complementation of a gD-negative PrV mutant. The carboxy-terminal domains of gB and gM directed a predominantly intracellular localization of gDB and gDM, while full-length gD and a tail-less gD mutant (gDc) were preferentially expressed on the cell surface. In contrast gDE, and a gDB lacking the putative gB endocytosis signal (gDBΔ29), were predominantly located in the plasma membrane. Despite the different intracellular localization, all tested proteins were able to complement infectivity of a PrV gD- mutant. Cells which stably express full-length gD and plasma-membrane-associated gD hybrids exhibit a significant resistance to PrV infection, while cells expressing predominantly intracellularly located forms do not. This suggests that the assumed sequestration of receptors by gD, which is supposed to be responsible for the interference phenomenon, occurs at the cell surface.
Herpesviral glycoproteins are involved in attachment and entry of free virions, in virus maturation and egress, and in modulation of direct viral cell-to-cell spread. Although the roles of several glycoprotein homologues within the family Herpesviridae have been at least partially identified, the functions of most glycoproteins are not well understood in detail (Mettenleiter, 2000 ; Steven & Spear, 1997 ). Several herpesviral glycoproteins are internalized from the cell surface by endocytosis (Tirabassi & Enquist, 1998 ). The carboxy-terminal regions of nearly all known glycoproteins of the alphaherpesvirus pseudorabies virus (PrV) encompass putative endocytosis signals, i.e. YxxL and dileucine motifs. These motifs are thought to mediate retrieval of proteins into the cytoplasm by interaction with adaptor complexes (Marsh & McMahon, 1999 ; Trowbridge et al., 1993 ). Generally, endocytosis has been shown to be important for receptor regulation, antigen presentation and protein recycling (Marks et al., 1996 ; Trowbridge et al., 1993 ; Trowbridge, 1991 ). Although the purpose of endocytosis of virally encoded glycoproteins has not been clarified, it was proposed as a mechanism to target membrane proteins to the site of final envelopment, i.e. the trans-Golgi network (Zhu, 1995 ). Recently, the intracellular targeting of several herpesviral glycoproteins has been analysed. Best studied are pseudorabies virus glycoproteins E and I (Tirabassi & Enquist, 2000 , 1999 , 1998 ), varicella-zoster virus (VZV) gE (Olson et al., 1998 ; Olson & Grose, 1997 ) and gB of human cytomegalovirus (HCMV; Meyer & Radsak, 2000 ; Radsak et al., 1996 ; Reschke et al., 1995 ).

HCMV gB was shown to be internalized prior to incorporation into the viral envelope (Radsak et al., 1996 ). Recent studies suggest an acidic cluster within the carboxy terminus of gB as the key determinant for cellular trafficking, which includes recycling via the early endocytotic pathway and finally leads to an apical sorting of gB (Tugizov et al., 1999 , 1998 ). In the case of VZV gE the tyrosine residue in the YxxL motive was determined to be important for internalization of the protein followed by recycling to the cell surface or targeting either to endosomal compartments or to the trans-Golgi network, which is the assumed site of envelopment (Alconada et al., 1999 ; Gershon et al., 1994 ; Olson & Grose, 1997 ).

PrV gE is efficiently endocytosed for the first 6 h post-infection only (Tirabassi & Enquist, 1998 ). However, biotinylation experiments showed that retrieved gE was not directly targeted into viral particles, and efficient endocytosis of gE was not required for gE incorporation into virions, nor for virulence or spread in the rat central nervous system (Tirabassi & Enquist, 2000 , 1999 , 1998 ). Thus, the importance of endocytosis for virion morphogenesis remains unclear.

Previously, we reported that PrV gB is efficiently endocytosed from the plasma membrane of transfected rabbit kidney cells. This process required the presence of a portion of the cytoplasmic tail containing dileucine and YxxL endocytosis signals. Other domains within the gB tail seem to be responsible for efficient incorporation into virion particles or for modulation of direct cell-to-cell spread. However, efficient endocytosis did not appear to be essential for any of these functions (Nixdorf et al., 2000 ).

gD of herpes simplex virus 1 (HSV-1) is an envelope component essential for binding to cellular gD receptors (Cocchi et al., 1998 ; Geraghty et al., 1998 ; Krummenacher et al., 1998 ; Lopez et al., 2000 ; Whitbeck et al., 1999 , 1997 ) and virus entry. Similar functions have been described for PrV and bovine herpesvirus (BHV)-1 gD (Geraghty et al., 1998 ), although a gD-independent entry pathway could be demonstrated for PrV and BHV-1 mutants (Schmidt et al., 1997 ; Schröder et al., 1997 ). Binding of exogenously added soluble gD as well as intracellular expression of gD in stably transfected cells was shown to inhibit infection of otherwise susceptible cells. This phenomenon is thought to be caused by sequestration of gD receptors (Dasika & Letchworth, 2000 ; Johnson et al., 1990 ; Petrovskis et al., 1988 ). For HSV-1 gD not only the cytoplasmic tail but also the transmembrane domain directed intracellular targeting including retention in the endoplasmic reticulum and the Golgi complex (Ghosh & Ghosh, 1999 ).

PrV gD is detectable at the cell surface despite the presence of a YxxL motif in the carboxy-terminal region (our unpublished observations). To test for function of this cytoplasmic domain and to study potential sorting capacities of other glycoprotein tails, we constructed truncated and chimeric forms of PrV gD. Hybrids were expressed in rabbit kidney cells (RK13), and intracellular localization as well as functional complementation of a gD-deficient virus mutant were analysed.

Viruses and cells.
All virus mutants used in this study are based on PrV strain Kaplan (PrV-Ka) (Kaplan & Vatter, 1959 ). PrV-1112 carries a lacZ insertion cassette in the nonessential gG locus (Mettenleiter & Rauh, 1990 ) and behaves in a multitude of in vitro and in vivo experiments like wild-type PrV. PrV-gD-Pass was derived from a noninfectious gD- PrV mutant by serial passaging in cell culture (Schmidt et al., 1997 ).

For transient or stable expression, rabbit kidney cells (RK13) were transfected with 5 µg of plasmid DNA by using SuperFect reagent (Qiagen) under transfection conditions suggested by the manufacturer. To establish stable recombinants, cells were selected in medium containing 0·5 mg/ml G418 (Life Technologies).

Immunodetection.
Western blotting (immunoblotting), radioimmunoprecipitation and immunofluorescence analyses were performed as described previously (Lukàcs et al., 1985 ; Klupp et al., 1997 ) using monoclonal antibodies (MAbs) directed against PrV gD (b51-c5-1 or c14-c27), PrV gE (A9-b15-26), PrV gB (a80-c16) and a peptide antiserum recognizing the carboxy-terminal portion of PrV gM (Dijkstra et al., 1996 ). The antiserum specific for the cytoplasmic tail of PrV gE was kindly provided by L. W. Enquist (Tirabassi & Enquist, 2000 ).

Confocal laser scanning microscopy.
For indirect immunofluorescence analysis, cells were seeded onto coverslips in six-well culture dishes, grown to confluency, and fixed with 3% paraformaldehyde for 20 min followed by permeabilization with 3% paraformaldehyde0·3% Triton X-100 for 15 min. Cells were washed twice with PBS, and incubated with appropriate MAbs or antisera diluted in PBS for 1 h. After thorough washing, anti-mouse or anti-rabbit IgGfluorescein isothiocyanate (FITC) conjugate (DAKO) was added for 45 min. Monolayers were then washed twice and counterstained with 10-6 M propidium iodide in PBS10% glycerol. Finally, samples were analysed by confocal laser scanning microscopy (LSM510; Zeiss).

In vitro transcription and translation.
For determination of apparent molecular masses of the polypeptides, an in vitro transcription/translation assay using the TNT Coupled Reticulocyte Lysate System (Promega) was performed. Translation products were separated by SDSPAGE (7·5% polyacrylamide) and visualized by autoradiography.

Construction of a gD- PrV-mutant.
To generate a gD- PrV mutant, a recombinant vector was created with upstream sequences comprising part of the US4 (gG) gene and downstream US7 (gI) sequences which were obtained by two step-PCR from cloned BamHI fragment 7 of viral DNA. The primers for the upstream sequences were 5' CACAGCATGCCGACGTATCGTCCCGCTCCTC 3' and 5' CACAGTCGACCTGGCGGGTGAGTGTATGGGA 3' [nucleotides 449469 and 19001881 of GenBank accession no. M10986 (Rea et al., 1985 ) respectively]; for downstream sequences: 5' CACAGGATCCGCCGACGAGCTAAAAGCGCAG 3' and 5' CACAGGTACCGGCGAAGCTCGGCCAACGTC 3' [nt 12141233 of GenBank accession no. AJ271966 (Brack et al., 2000 ) and 10941075 of GenBank accession no. M14336 (Petrovskis et al., 1986 ), respectively]. SphI, SalI, BamHI and KpnI restriction sites which were introduced for convenient cloning are underlined. Fragments were amplified using Pfx-Platinum polymerase (Life Technologies) and directly cloned into appropriately cleaved pUC19. The resulting plasmid was digested with BamHI and SalI, and lacZ or GFP marker genes were inserted. The resulting plasmids, designated pD0lacZ and pD0GFP respectively, were transfected with PrV-Ka DNA into RK13 cells which carry BamHI fragment 7 of PrV-Ka (ab7-13; A. Brack, unpublished data). Marker gene-expressing mutants were isolated. Correct deletion of gD sequences and insertion of marker genes was verified by Southern- and Western blot analysis. In mutant PrV-gD0β gG sequences were also deleted due to homologous recombination of the duplicate gG promoter sequences, as has also been described for our previous gD- PrV mutant (Rauh & Mettenleiter, 1991 ).

Construction of truncated and hybrid gD open reading frames.
The plasmid encoding the soluble form of gD, designated gDs, was generated by insertion of a BamHIBsrBI fragment excised from gDgI-CMV (Gerdts et al., 1999 ) into BamHI/XbaI-cleaved pRc/CMV (InVitrogen). An open reading frame (ORF) for expression of a gD, which lacks the intracytoplasmic tail, was amplified by PCR with Pfx-Platinum polymerase from viral DNA using as upstream primer 5' ATATGGATCCATGCTGCTCGCAGCGCTATT 3' and as downstream primer 5' ACCGGAATTCCTAGAAGATGTAGACGCACA 3' [nt 4362 and 11611145 of GenBank accession no. AJ271966 (Brack et al., 2000 )]. In-frame start and stop codons are indicated by boldface letters. BamHI and EcoRI restriction sites which were introduced for convenient cloning are underlined. ORFs of hybrid proteins were generated by a modified fusion PCR as previously described (Ho et al., 1989 ) using primers listed in Table 1. This method is based on in-frame fusion of two separately amplified fragments by overlapping extensions. Resulting products were cleaved with appropriate restriction endonucleases and cloned into eukaryotic expression vector pcDNA3 (InVitrogen). The amino acid sequence of the relevant portions of the molecules is shown in Fig. 1.


Table 1. Primers used for fusion PCR



(14K):

Fig. 1. Predicted amino acid sequence of mutated gD. Carboxy-terminal amino acid sequences of gD, truncated gD and hybrid gD molecules are shown. The predicted transmembrane domain is shaded grey; YxxL and dileucine endocytosis motifs are underlined. The in-frame fusion sites are marked by arrows.
Isolation of PrV-gD0β
We previously described the isolation of a gD- PrV mutant which carries the lacZ cassette in a partially deleted US6 (gD) gene (Rauh & Mettenleiter, 1991 ). The rescue frequency of this mutant was relatively high after propagation on gD-expressing cells, since about half of the US6 gene was still present in the genome. To minimize rescue, we constructed a novel PrV mutant lacking the complete gD gene. To this end, a recombination plasmid was created by assembling PCR fragments amplified from the 5'-flanking US4 (gG) gene and the 3'-located US7 (gI) gene. To facilitate isolation of virus recombinants, lacZ- or GFP-expression cassettes were introduced between the recombination sequences. The respective viral mutants, PrV-gD0β and PrV-gD0GFP, were plaque-purified and propagated on cell line RK13-gD (Nixdorf et al., 1999 ), which constitutively expresses the US6 (gD) gene under control of the HCMV immediate-early promotor-enhancer complex.

Cellular localization of PrV glycoproteins B, D, E and M
To determine the intracellular localization of PrV glycoproteins RK13 cell lines which constitutively express gB, gD, gE or gM were analysed by confocal laser scanning microscopy. In RK13-gD cells gD is detected at the plasma membrane by indirect immunofluorescence on non-permeabilized cells (Fig. 3B) as well as in the cytoplasm after permeabilization (Fig. 2B). Constitutive expression of gM in RK13 cells (RK13-gM) resulted in intense cytoplasmic staining with an anti-gM rabbit serum (Fig. 2E). No surface expression could be detected on non-permeabilized cells (Fig. 3E. As shown recently, full-length gB accumulated in intracytoplasmic vesicles (Fig. 2G) and was not detectable at the cell surface (Fig. 3G), whereas truncated gB lacking the carboxy-terminal 29 aa (gB-008; Nixdorf et al., 2000 ) was found in the plasma membrane (Fig. 2H) as well as intracellularly (Fig. 3H). In RK13-gE cells (Brack et al., 1999 ) the staining pattern indicated surface localization (Fig. 3F) as well as the intracellular presence of gE (Fig. 2F).



(93K):

Fig. 3. Surface expression of PrV glycoproteins. Normal RK13 cells and RK13 cells stably expressing wild-type or mutant glycoproteins as indicated were grown to confluency, fixed with 3% paraformaldehyde, and incubated with appropriate antibodies or antisera. Fluorescence microscopy was performed after incubation with FITC-conjugated secondary antibodies.


(99K):

Fig. 2. Intracellular localization of PrV glycoproteins. Normal RK13 and RK13 cells stably expressing wild-type or mutant glycoproteins as indicated were grown to confluency, fixed and permeabilized with 3% paraformaldehyde0·3% Triton X-100, and incubated with the appropriate antisera or MAbs. Confocal laser scan microscopy was performed after incubation with FITC-conjugated secondary antibodies. Nuclear DNA was stained with propidium iodide.

Construction of cell lines expressing carboxy-terminally truncated gD
Deduced amino acid sequences predict that PrV gD is a type I membrane protein with a large extracytoplasmic domain, a membrane-spanning α-helix and a small intracytoplasmic domain of only 26 aa. The latter encompasses a YRLL sequence which can serve as an endocytosis signal. To test for function of this cytoplasmic tail, we constructed 3'-terminally truncated gD-ORFs specifying gD proteins which lack either only the intracytoplasmic domain (gDc) or the complete carboxy-terminal portion including the putative membrane anchor region (gDs; see Fig. 1). Both were cloned into mammalian expression vectors under the control of the HCMV immediate-early promotor-enhancer complex. After transfection into RK13 cells, stably expressing cell lines were established and analysed.

In indirect immunofluorescence with an anti-gD MAb, cells expressing gDc showed a bright staining near the plasma membrane in addition to weaker intracellular spotted signals (Fig. 2C). Surface expression of gDc could be verified by immunofluorescence assay on non-permeabilized cells (Fig. 3C). Thus, deletion of the intracytoplasmic domain of gD had no drastic effect on subcellular localization. As expected gDs, which lacks the complete cytoplasmic tail and the predicted membrane spanning domain, is secreted in large amounts (not shown). In addition, a distinct membrane-associated staining was detectable in immunofluorescence on non-permeabilized (Fig. 3D) and permeabilized (Fig. 2D) cells.

Construction of cell lines expressing hybrid gD
Intracytoplasmic domains of different PrV glycoproteins are involved in intracellular targeting and localization (Nixdorf et al., 2000 ; Tirabassi & Enquist, 1999 ). To test whether the sorting signals also function in a heterologous context, hybrid proteins consisting of the amino-terminal portion of PrV gD, including its own transmembrane domain, and the cytoplasmic tail of gB or gE were constructed and designated gDB and gDE, respectively. In addition, a gD hybrid containing the carboxy-terminal part of gM (gDM) was engineered. So far, membrane localization and topology of PrV gM has not yet been analysed. For gB, the carboxy-terminal 29 aa are responsible for efficient endocytosis from the cell surface (Nixdorf et al., 2000 ). Therefore, another hybrid gD protein was constructed carrying a truncated gB tail, here designated gDBΔ29. It lacks the carboxy-terminal 29 aa of gB including the putative endocytosis signals, and is therefore identical to the carboxy -terminal domain of the previously described gB-008 (Nixdorf et al., 2000 ), which is predominantly associated with the plasma membrane. All hybrid ORFs were established by fusion-PCR and inserted into pcDNA3 for constitutive expression. Resulting plasmids were transfected into RK13 cells, and stably expressing cell lines were selected and analysed.

In indirect immunofluorescence using a gD-specific MAb, cells expressing gDE or gDBΔ29 showed a bright membrane-associated fluorescence in permeabilized cells (Fig. 2J, L), while gDM and gDB are found preferentially in the cytoplasm (Fig. 2I, K). On non-permeabilized cells gDM, gDE and gDBΔ29 were detected (Fig. 3I, J, L), although the signal on gDM-expressing cells was relatively weak. Non-permeabilized RK13-gDB cells failed to react (Fig. 2K). To determine expression and membrane orientation of gDE and gDM, polyclonal antisera specific for the corresponding carboxy-terminal portions were used in the immunofluorescence assay. Both antisera reacted only with permeabilized cells (not shown), indicating an intracellular localization of the gE and gM tails.

Characterization of gD derivatives
Correct expression of recombinant proteins was first analysed in an in vitro-coupled transcription/translation assay in the absence of microsomal membranes. Translation products were separated by SDSPAGE, and labelled proteins were visualized by autoradiography. All truncated and hybrid forms of gD, including gDB (see below), migrated exactly as expected from the calculated molecular masses (data not shown). To determine proper intracellular processing, RK13 cells were metabolically labelled with Tran-35S-Label (ICN), and cell lysates were immunoprecipitated and subjected to SDSPAGE. As shown in Fig. 4, truncated forms of gD, as well as gDM, gDE and gDBΔ29, were detected in their anticipated size, indicating correct cellular expression and processing. Surprisingly, gDB migrated faster than expected from the deduced molecular mass and as suggested by the product of the in vitro transcription/translation assay. Thus, processing of gDB in RK13 cells appears to be aberrant (see Discussion).



(51K):

Fig. 4. Immunoprecipitation of mutant gD molecules. Normal RK13 cells and RK13 cells stably expressing wild-type or mutant gD proteins were metabolically radiolabelled, lysed, and precipitated with gD-specific MAb c14-c27. Precipitates were separated in SDSPAGE under reducing conditions, and labelled proteins were visualized by autoradiography.

Analysis by radioimmunoprecipitation and fluorescence-activated cell sorting (FACS) of permeabilized cells indicated that expression levels of the selected cell clones were comparable (data not shown).

Entry of PrV into recombinant RK13 cells
RK13 cells are fully susceptible to infection by wild-type PrV, but constitutive expression of gD leads to partial resistance to infection (Petrovskis et al., 1988 ). This interference had been explained by intracellular sequestration of gD receptors, which constituted one of the first pieces of evidence for interaction of gD with cellular receptors (Johnson et al., 1990 ). To test whether gD with a mutated carboxy-terminal domain still caused interference indicative of interaction with cellular receptors, RK13 cells as well as recombinant RK13 expressing truncated and hybrid gD molecules were infected with serial dilutions of wild-type-like PrV-1112. Two days post-infection, cells were fixed, stained with X-Gal, and plaques and foci were counted. As demonstrated in Fig. 5(A), compared to RK13 cells infectivity of PrV-1112 was reduced at least 10-fold on RK13-gD, RK13-gDc, RK13-gDE and RK13-gDBΔ29 cells. Titration on RK13-gDM led to only a ca. 2-fold reduction of infectivity. No titre reduction was observed on RK13 cells expressing gDs and gDB. In summary, cell lines expressing gD forms with a preferential (gDM) or exclusive intracellular localization (gDB) exhibited a decreased interference (gDM) or no interference at all (gDB). Cells expressing a preferentially secreted gD (gDs) also do not exhibit interference.



(25K):

Fig. 5. Titration of PrV on cells expressing wild-type and mutant gD. Wild-type-like PrV-1112 (A) and PrV-gD-Pass (B) were titrated in parallel on normal RK13 and RK13 cells stably expressing wild-type or mutant gD proteins. Data are averages of three independent experiments; vertical lines indicate standard deviations.

To exclude fortuitous natural resistance of selected cell clones against PrV infection, an infectious gD- PrV mutant (PrV-gD-Pass) was titrated on these cells. PrV-gD-Pass does not bind to known gD receptors, and, therefore, is resistant to gD-mediated interference (Nixdorf et al., 1999 ; Schmidt et al., 1997 ). As expected, PrV-gD-Pass infected all recombinant RK13 cells with equal efficiency (Fig. 5B).

Incorporation of mutant gD into virions
gD is an important component of the virion envelope. To test for incorporation of mutated gD into virion particles, cell lines expressing wild-type or mutant gD were infected with phenotypically complemented PrV-gD0β for 2 days at an m.o.i. of 0·1. Progeny virions were purified by sucrose-gradient centrifugation, and analysed by Western blot. As shown in Fig. 6(A), wild-type gD, gDc, gDM, gDE, gDB and gDBΔ29 were all detectable in purified virion preparations, although the amount of gDB in virions appeared to be less than that of the other gD mutants. As expected, in virus progeny derived from RK13 or RK13-gDs, which expresses soluble gD, no gD was detectable. For control, gE was present in comparable amounts in all preparations (Fig. 6B). To verify absence of non-structural proteins, parallel blots were probed with a UL50-specific antiserum, which did not yield any signal (data not shown).



(23K):

Fig. 6. Incorporation of wild-type and mutant gD into virions. RK13 cells and recombinant RK13 cells expressing wild-type or mutant gD proteins were infected with phenotypically complemented PrV-gD0β at an m.o.i. of 0·1. Virus progeny was purified by sucrose-gradient centrifugation, lysed, proteins separated in SDSPAGE and transferred onto nitrocellulose; blots were probed with gD-specific MAb b51-c5-1 (A) or an anti-gE MAb A9-b15-26 (B).

Complementation of infectivity of PrV-gD- by gD derivatives
gD is required for penetration of wild-type PrV but is not essential for direct cell-to-cell spread. Absence of gD results in drastically reduced virus titres by loss of the ability to enter target cells efficiently unless membrane fusion is induced experimentally, e.g. with polyethylene glycol (Rauh & Mettenleiter, 1991 ). To determine whether truncated gD or hybrid gD were able to complement the entry defect of a gD- PrV-mutant, RK13 cells expressing wild-type or mutated gD were infected with phenotypically complemented PrV-gD0β for 2 h at an m.o.i. of 0·1. Thereafter, residual extracellular input virus was inactivated by low-pH treatment (Mettenleiter, 1989 ) and cells were further incubated until complete cytopathic effect was observed. Virus progeny was then harvested, and titrated in parallel on RK13 and RK13-gD cells. As shown in Fig. 7, from RK13 as well as from RK13-gDs cells, about 102 p.f.u./ml were obtained when titrated on RK13 or RK13-gD. This very low level of infectivity probably reflects gD-independent entry. In contrast, on cells expressing gD, gDc, gDM, gDE, gDB or gDBΔ29 the titres of virus progeny were ca. 105106/ml on RK13 cells. Due to interference, titres were ca. 10-fold reduced on RK13-gD cells, indicative of gD-mediated entry of these viruses. Thus, neither absence nor exchange of the cytoplasmic domain of PrV gD resulted in loss of infectivity. Interestingly, those hybrid gD molecules with a predominantly intracellular localization (gDM and gDB; see above) rescued a lower level of infectivity than those which are preferentially detected at the plasma membrane (gDE and gDBΔ29). However, all incorporated gD derivatives were able to mediate PrV entry into cells and interference on wild-type-gD expressing RK13 cells.



(25K):

Fig. 7. Functional complementation of gD- PrV by wild-type and mutant gD. RK13 cells and recombinant RK13 cells expressing wild-type or mutant gD proteins were infected with phenotypically complemented PrV-gD0β. After complete CPE had developed virus progeny was harvested, and titrated in parallel on RK13 cells (open bars) and RK13-gD cells (shaded bars). Data represent averages of three independent experiments; vertical lines indicate standard deviations.
These studies were initiated to investigate the role of intracytoplasmic domains in subcellular localization and function of PrV glycoproteins. By confocal laser scanning microscopy gD and gE were easily detectable at the cell surface, while gB and gM could not be detected on non-permeabilized cells. Since the carboxy-terminal portions of all four proteins contain putative endocytosis motifs, we assumed that the carboxy-terminal domains have different properties which may result in distinct localization. The intracytoplasmic portions of several herpesviral glycoproteins comprise functional domains which are responsible for intracellular targeting. For example it has been shown that PrV gB and gE, as well as VZV gE and HCMV gB are internalized from the plasma membrane, and efficient endocytosis requires carboxy-terminally located sequence motifs (Nixdorf et al., 2000 ; Olson & Grose, 1997 ; Tirabassi & Enquist, 1999 ; Tugizov et al., 1999 ). To test whether the carboxy-terminal domains of gB, gE and gM are sufficient to induce endocytosis of a preferentially membrane-associated heterologous protein, carboxy-terminally truncated derivatives of the envelope glycoprotein gD, which is also present in the plasma membrane of infected cells, as well as hybrid proteins consisting of the extracellular and transmembrane region of gD fused to the carboxy-terminal domains of gB, gE and gM, were constructed and analysed.

Surprisingly, absence of the complete intracytoplasmic tail of gD (gDc) had no obvious effect on intracellular localization, incorporation into virions or recovery of infectivity. Therefore, this region of gD is apparently not essential for its function, at least in cultured cells. The only detectable difference compared to full-length gD was a slightly reduced interference after infection with wild-type PrV. In contrast, absence of the complete intracytoplasmic domain drastically decreased or abolished incorporation into virions of PrV gB and gE (Nixdorf et al., 2000 ; Tirabassi et al., 1997 ). However, it was recently suggested for HSV-1 gD that either the cytoplasmic tail or the transmembrane domain are sufficient for targeting to the nuclear envelope, the predicted site for primary envelopment (Ghosh & Ghosh, 1999 ). Thus, the transmembrane region may also be sufficient for intracellular targeting and function of PrV gD.

As expected, a gD lacking the carboxy-terminal portion including the predicted transmembrane domain (gDs) is secreted, and is therefore not available for incorporation and restoration of infectivity. Though, by immunofluorescence, PrV gDs was shown to be present at the plasma membrane, RK13-gDs cells did not exhibit interference with wild-type PrV infection. It has previously been reported that interference could be induced by exogenous addition of soluble forms of HSV-1 (Johnson et al., 1990 ) and BHV-1 gD (Dasika & Letchworth, 2000 ). This difference can be explained by the high amount of soluble gD, at least 100 µg of purified protein/ml, which had to be added before infection to block virus entry. Thus, the amount of secreted gDs may be insufficient to mediate interference exogenously. Apparently, intracellular sequestration of gD receptors by gDs does also not occur in RK13-gDs cells.

The deduced amino acid sequence of PrV gM predicts eight hydrophobic stretches of sufficient length to span the lipid bilayer (Dijkstra et al., 1997 ). In PrV gM, dileucine and YxxL motives are found in the extreme carboxy-terminal hydrophilic domain but subcellular location of gM has not been analysed so far. Confocal microscopy suggests an intracellular localization of gM when it is expressed in RK13 cells. A similar, predominantly intracellular localization was observed (using a gD-specific MAb) in RK13 cells expressing a chimeric protein consisting of the extracellular and transmembrane portions of gD fused to the carboxy terminus of gM (gDM). This suggests that the carboxy-terminal portion of gM functions in a heterologous context to direct a membrane protein to the cytoplasm. If the described targeting capability of the transmembrane portion of HSV gD is also valid for PrV, there may thus be two competitive targeting domains within gDM. The weak membrane fluorescence observed in RK13-gDM cells may be a result of inefficient endocytosis, caused either by interaction of the gD portion with its membrane-associated receptor or by the suggested sorting signals in the membrane-spanning domain of gD. In contrast, the gB tail totally precluded surface localization of gD (see below). Unfortunately, the gM-specific antiserum is directed against the extreme carboxy-terminal portion, one of the very few regions of this protein with a high antigenicity index, and hence absence of surface fluorescence on non permeabilized RK13-gM cells could be due to intracellular localization of the gM tail, despite membrane association of gM. Therefore, our studies do not prove absence of gM from the plasma membrane of RK13-gM cells. However, they clearly show the capacity of the gM tail to redirect a heterologous protein from a predominantly membrane-associated to a predominantly intracellular localization. In spite of the predominant intracytoplasmic localization gDM is efficiently incorporated into mature virion particles and supports recovery of infectivity. Interestingly, RK13-gDM cells show a reduced interference which correlates with the decreased surface expression compared to wild-type gD or gDc.

PrV gE is internalized from the plasma membrane, and the functional involvement of the cytoplasmic tail within the endocytosis process has been analysed in detail (Tirabassi & Enquist, 1999 , 1998 ). However, retrieval of gE is not necessary for incorporation into virions nor for infectivity (Tirabassi & Enquist, 1999 ). In RK13-gE cells gE shows a distinct membrane fluorescence in addition to an intracellular localization. This contrasting result may be due to the different assay systems. Previously, gE endocytosis was detected in infected cells during the first 6 h after infection (Tirabassi & Enquist, 1998 ). We analysed a stably gE-expressing cell line which presumably leads to a steady-state production level. Correlating with the surface expression of gE, gDE is also detected on the cell surface and causes interference. In addition, gDE is fully able to complement the entry defect of gD- PrV.

PrV gB expressed in RK13 cells is endocytosed from the plasma membrane (Nixdorf et al., 2000 ). In contrast to a more uniform intracellular distribution of gE, in RK13-gB (Nixdorf et al., 2000 ) or MT-3 MDBK cells (Rauh & Mettenleiter, 1991 ) gB is present in intracytoplasmic vesicles (unpublished). Thus, gB was not detectable on the cell surface, except when at least the carboxy-terminal 29 amino acids, which include putative endocytosis signals, are deleted. This localization pattern is reflected by hybrid proteins consisting of the extracellular and transmembrane portions of gD and either the complete gB tail or a gB tail lacking the putative endocytosis signals. As demonstrated by confocal laser scanning microscopy, FACS analysis (not shown) and immunofluorescence on non-permeabilized cells, the full-length gB tail seems to be capable of mediating efficient retrieval of a heterologous protein, since gDB is only detected intracellularly, and not on the cell surface. In contrast, gDBΔ29 is preferentially detected in the plasma membrane. However, interpretation of these results is complicated due to the aberrant migration of gDB in gel electrophoresis. Neither in RK13-gDB nor in transcomplemented virions was a protein detectable which migrated as expected. Sequencing as well as in vitro translation of the recombinant ORF verified correct construction and proper expression of gDB, but the intracellularly expressed hybrid protein migrated with an apparent molecular mass ca. 10 kDa smaller than expected. This might be an artefact caused by unusual folding of gDB, but considering the normal migration of gDBΔ29 we think it more likely that an altered processing of gDB occurs after retrieval from the plasma membrane, for which the full-length tail of gB is responsible. However, gDB as well as gDBΔ29 were incorporated into virions and complemented infectivity of gD- PrV despite their different cellular localization. As observed with gDs and partially reflected by RK13-gDM, no interference was detected on RK13-gDB cells, which again correlates with the absence of gDB from the plasma membrane.

In summary, we report distinct roles of carboxy-terminal portions of PrV glycoproteins for subcellular targeting of hybrid proteins. This altered localization does not strictly correlate with presence or absence of endocytosis motifs within the carboxy-terminal domain, suggesting additional properties in the cytoplasmic portion or other parts of the proteins which are responsible for localization. Surprisingly, gD function in virus entry is not or only slightly reduced in all hybrid proteins irrespective of their different intracellular localization. In addition, surface localization of gD and gD hybrids correlated with resistance against superinfection by gD-positive PrV, which indicates that the assumed sequestration of gD receptor(s) by cellularly expressed gD may occur at the cell surface.

This study was supported by the Deutsche Forschungsgemeinschaft (DFG Grant Me 854/4-2).

We thank Klaus Osterrieder for his help with the confocal laser scan microscope, Alexandra Brack for gE-expressing cells, Lynn Enquist for the gE-tail-specific antiserum, and Uta Hartwig and Nadine Müller for excellent technical assistance.

References

Alconada, A., Bauer, U., Sodeik, B. & Hoflack, B.(1999). Intracellular traffic of herpes simplex virus glycoprotein gE: characterization of the sorting signals required for its trans-Golgi network localization. Journal of Virology 73, 377-387.[Abstract/Free Full Text]

Brack, A. R., Dijkstra, J. M., Granzow, H., Klupp, B. G. & Mettenleiter, T. C.(1999). Inhibition of virion maturation by simultaneous deletion of glycoproteins E, I, and M of pseudorabies virus. Journal of Virology 73, 5364-5372.[Abstract/Free Full Text]

Brack, A. R., Klupp, B. G., Granzow, H., Tirabassi, R., Enquist, L. W. & Mettenleiter, T. C.(2000). Role of the cytoplasmic tail of pseudorabies virus glycoprotein E in virion formation. Journal of Virology 74, 4004-4016.[Abstract/Free Full Text]

Cocchi, F., Lopez, M., Menotti, L., Aoubala, M., Dubreuil, P. & Campadelli-Fiume, G.(1998). The V domain of herpesvirus Ig-like receptor (HIgR) contains a major functional region in herpes simplex virus-1 entry into cells and interacts physically with the viral glycoprotein D. Proceedings of the National Academy of Sciences, USA 95, 15700-15705.[Abstract/Free Full Text]

Dasika, G. K. & Letchworth, G. J.(2000). Homologous and heterologous interference requires bovine herpesvirus-1 glycoprotein D at the cell surface during virus entry. Journal of General Virology 81, 1041-1049.[Abstract/Free Full Text]

Dijkstra, J. M., Visser, N., Mettenleiter, T. C. & Klupp, B. G.(1996). Identification and characterization of pseudorabies virus glycoprotein gM as a nonessential virion component. Journal of Virology 70, 5684-5688.[Abstract/Free Full Text]

Dijkstra, J. M., Fuchs, W., Mettenleiter, T. C. & Klupp, B. G.(1997). Identification and transcriptional analysis of pseudorabies virus UL6 to UL12 genes. Archives of Virology 142, 17-35.[Medline]

Geraghty, R. J., Krummenacher, C., Cohen, G. H., Eisenberg, R. J. & Spear, P. G.(1998). Entry of alphaherpesviruses mediated by poliovirus receptor-related protein 1 and poliovirus receptor. Science 280, 1618-1620.[Abstract/Free Full Text]

Gerdts, V., Jöns, A. & Mettenleiter, T. C.(1999). Potency of an experimental DNA vaccine against Aujeszkys disease in pigs. Veterinary Microbiology 66, 1-13.[Medline]

Gershon, A. A., Sherman, D. L., Zhu, Z., Gabel, C. A., Ambron, R. T. & Gershon, M. D.(1994). Intracellular transport of newly synthesized varicella-zoster virus: final envelopment in the trans-Golgi network. Journal of Virology 68, 6372-6390.[Abstract/Free Full Text]

Ghosh, K. & Ghosh, H. P.(1999). Role of the membrane anchoring and cytoplasmic domains in intracellular transport and localization of viral glycoproteins. Biochemical Cell Biology 77, 165-178.[Medline]

Ho, S. N., Hunt, H. D., Horton, R. M., Pullen, J. K. & Pease, L. R.(1989). Site-directed mutagenesis by overlap extension using the polymerase chain reaction. Gene 77, 51-59.[Medline]

Johnson, D. C., Burke, R. L. & Gregory, T.(1990). Soluble forms of herpes simplex virus glycoprotein D bind to a limited number of cell surface receptors and inhibit virus entry into cells. Journal of Virology 64, 2569-2576.[Abstract/Free Full Text]

Kaplan, A. S. & Vatter, A. E.(1959). A comparison of herpes simplex and pseudorabies viruses. Virology 182, 732-741.

Klupp, B. G., Fuchs, W., Weiland, E. & Mettenleiter, T. C.(1997). Pseudorabies virus glycoprotein L is necessary for virus infectivity but dispensable for virion localization of glycoprotein H. Journal of Virology 71, 7687-7695.[Abstract]

Krummenacher, C., Nicola, A. V., Whitbeck, J. C., Lou, H., Hou, W., Lambris, J. D., Geraghty, R. J., Spear, P. G., Cohen, G. H. & Eisenberg, R. J.(1998). Herpes simplex virus glycoprotein D can bind to poliovirus receptor- related protein 1 or herpesvirus entry mediator, two structurally unrelated mediators of virus entry. Journal of Virology 72, 7064-7074.[Abstract/Free Full Text]

Lopez, M., Cocchi, F., Menotti, L., Avitabile, E., Dubreuil, P. & Campadelli-Fiume, G.(2000). Nectin2α (PRR2α or HveB) and nectin2δ are low-efficiency mediators for entry of herpes simplex virus mutants carrying the Leu25Pro substitution in glycoprotein D. Journal of Virology 74, 1267-1274.[Abstract/Free Full Text]

Lukàcs, N., Thiel, H. J., Mettenleiter, T. C. & Rziha, H. J.(1985). Demonstration of three major species of pseudorabies virus glycoproteins and identification of a disulfide-linked glycoprotein complex. Journal of Virology 53, 166-173.[Abstract/Free Full Text]

Marks, M. S., Woodruff, L., Ohno, H. & Bonifacino, J. S.(1996). Protein targeting by tyrosine- and di-leucine-based signals: evidence for distinct saturable components. Journal of Cell Biology 135, 341-354.[Abstract/Free Full Text]

Marsh, M. & McMahon, H. T.(1999). The structural era of endocytosis. Science 285, 215-220.[Abstract/Free Full Text]

Mettenleiter, T. C.(1989). Glycoprotein gIII deletion mutants of pseudorabies virus are impaired in virus entry. Virology 171, 623-625.[Medline]

Mettenleiter, T. C.(2000). Aujeszkys disease (pseudorabies) virus: the virus and molecular pathogenesis state of the art, June 1999. Veterinary Research 31, 99-115.[Medline]

Mettenleiter, T. C. & Rauh, I.(1990). A glycoprotein gXβ-galactosidase fusion gene as insertional marker for rapid identification of pseudorabies virus mutants. Journal of Virological Methods 30, 55-65.[Medline]

Meyer, G. A. & Radsak, K. D.(2000). Identification of a novel signal sequence that targets transmembrane proteins to the nuclear envelope inner membrane. Journal of Biological Chemistry 275, 3857-3866.[Abstract/Free Full Text]

Nixdorf, R., Schmidt, J., Karger, A. & Mettenleiter, T. C.(1999). Infection of Chinese hamster ovary cells by pseudorabies virus. Journal of Virology 73, 8019-8026.[Abstract/Free Full Text]

Nixdorf, R., Klupp, B. G., Karger, A. & Mettenleiter, T. C.(2000). Effects of truncation of the carboxy terminus of pseudorabies virus glycoprotein B on infectivity. Journal of Virology 74, 7137-7145.[Abstract/Free Full Text]

Olson, J. K. & Grose, C.(1997). Endocytosis and recycling of varicella-zoster virus Fc receptor glycoprotein gE: internalization mediated by a YXXL motif in the cytoplasmic tail. Journal of Virology 71, 4042-4054.[Abstract]

Olson, J. K., Santos, R. A. & Grose, C.(1998). Varicella-zoster virus glycoprotein gE: endocytosis and trafficking of the Fc receptor. Journal of Infectious Diseases 178, 2-6.

Petrovskis, E. A., Timmins, J. G. & Post, L. E.(1986). Use of lambda gt11 to isolate genes for two pseudorabies virus glycoproteins with homology to herpes simplex virus and varicella-zoster virus glycoproteins. Journal of Virology 60, 185-193.[Abstract/Free Full Text]

Petrovskis, E. A., Meyer, A. L. & Post, L. E.(1988). Reduced yield of infectious pseudorabies virus and herpes simplex virus from cell lines producing viral glycoprotein gp50. Journal of Virology 62, 2196-2199.[Abstract/Free Full Text]

Radsak, K., Eickmann, M., Mockenhaupt, T., Bogner, E., Kern, H., Eis-Hubinger, A. & Reschke, M.(1996). Retrieval of human cytomegalovirus glycoprotein B from the infected cell surface for virus envelopment. Archives of Virology 141, 557-572.[Medline]

Rauh, I. & Mettenleiter, T. C.(1991). Pseudorabies virus glycoproteins gII and gp50 are essential for virus penetration. Journal of Virology 65, 5348-5356.[Abstract/Free Full Text]

Rea, T. J., Timmins, J. G., Long, G. W. & Post, L. E.(1985). Mapping and sequence of the gene for the pseudorabies virus glycoprotein which accumulates in the medium of infected cells. Journal of Virology 54, 21-29.[Abstract/Free Full Text]

Reschke, M., Reis, B., Noding, K., Rohsiepe, D., Richter, A., Mockenhaupt, T., Garten, W. & Radsak, K.(1995). Constitutive expression of human cytomegalovirus glycoprotein B (gpUL55) with mutagenized carboxy-terminal hydrophobic domains. Journal of General Virology 76, 113-122.[Abstract/Free Full Text]

Robbins, A. K., Dorney, D. J., Wathen, M. W., Whealy, M. E., Gold, C., Watson, R. J., Holland, L. E., Weed, S. D., Levine, M. & Glorioso, J. C.(1987). The pseudorabies virus gII gene is closely related to the gB glycoprotein gene of herpes simplex virus. Journal of Virology 61, 2691-2701.[Abstract/Free Full Text]

Schmidt, J., Klupp, B. G., Karger, A. & Mettenleiter, T. C.(1997). Adaptability in herpesviruses: glycoprotein D-independent infectivity of pseudorabies virus. Journal of Virology 71, 17-24.[Abstract]

Schröder, C., Linde, G., Fehler, F. & Keil, G. M.(1997). From essential to beneficial: glycoprotein D loses importance for replication of bovine herpesvirus 1 in cell culture Journal of Virology 71, 25-33.[Abstract]

Steven, A. C. & Spear, P. G.(1997). Herpesvirus capsid assembly and envelopment. In Structural Biology of Viruses , pp. 312-351. Edited by W. Chiu, R. M. Burnett& R. Garcea. New York:Oxford University Press.

Tirabassi, R. S. & Enquist, L. W.(1998). Role of envelope protein gE endocytosis in the pseudorabies virus life-cycle. Journal of Virology 72, 4571-4579.[Abstract/Free Full Text]

Tirabassi, R. S. & Enquist, L. W.(1999). Mutation of the YXXL endocytosis motif in the cytoplasmic tail of pseudorabies virus gE. Journal of Virology 73, 2717-2728.[Abstract/Free Full Text]

Tirabassi, R. S. & Enquist, L. W.(2000). Role of the pseudorabies virus gI cytoplasmic domain in neuroinvasion, virulence, and posttranslational N-linked glycosylation. Journal of Virology 74, 3505-3516.[Abstract/Free Full Text]

Tirabassi, R. S., Townley, R. A., Eldridge, M. G. & Enquist, L. W.(1997). Characterization of pseudorabies virus mutants expressing carboxy- terminal truncations of gE: evidence for envelope incorporation, virulence, and neurotropism domains. Journal of Virology 71, 6455-6464.[Abstract]

Trowbridge, I. S. (1991). Endocytosis and signals for internalization. Current Opinion in Cell Biology 3, 634641 [erratum 3, 1062].[Medline]

Trowbridge, I. S., Collawn, J. F. & Hopkins, C. R.(1993). Signal-dependent membrane protein trafficking in the endocytic pathway. Annual Review of Cell Biology 9, 129-161.

Tugizov, S., Maidji, E., Xiao, J., Zheng, Z. & Pereira, L.(1998). Human cytomegalovirus glycoprotein B contains autonomous determinants for vectorial targeting to apical membranes of polarized epithelial cells. Journal of Virology 72, 7374-7386.[Abstract/Free Full Text]

Tugizov, S., Maidji, E., Xiao, J. & Pereira, L.(1999). An acidic cluster in the cytosolic domain of human cytomegalovirus glycoprotein B is a signal for endocytosis from the plasma membrane. Journal of Virology 73, 8677-8688.[Abstract/Free Full Text]

van Zijl, M., van der Gulden, H., de Wind, N., Gielkens, A. & Berns, A.(1990). Identification of two genes in the unique short region of pseudorabies virus; comparison with herpes simplex virus and varicella-zoster virus. Journal of General Virology 71, 1747-1755.[Abstract/Free Full Text]

Whitbeck, J. C., Peng, C., Lou, H., Xu, R., Willis, S. H., Ponce, D. L., Peng, T., Nicola, A. V., Montgomery, R. I., Warner, M. S., Soulika, A. M., Spruce, L. A., Moore, W. T., Lambris, J. D., Spear, P. G., Cohen, G. H. & Eisenberg, R. J.(1997). Glycoprotein D of herpes simplex virus (HSV) binds directly to HVEM, a member of the tumor necrosis factor receptor superfamily and a mediator of HSV entry. Journal of Virology 71, 6083-6093.[Abstract]

Whitbeck, J. C., Muggeridge, M. I., Rux, A. H., Hou, W., Krummenacher, C., Lou, H., van Geelen, A., Eisenberg, R. J. & Cohen, G. H.(1999). The major neutralizing antigenic site on herpes simplex virus glycoprotein D overlaps a receptor-binding domain. Journal of Virology 73, 9879-9890.[Abstract/Free Full Text]

Zhu, Z., Gershon, M. D., Hao, Y., Ambron, R. T., Gabel, C. A. & Gershon, A. A.(1995). Envelopment of varicella-zoster virus: targeting of viral glycoproteins to the trans-Golgi network. Journal of Virology 69, 7951-7959.[Abstract]

Received 23 August 2000; accepted 6 October 2000.