Research Article

Gene transfer using human polyomavirus BK virus-like particles expressed in insect cells

Journal of General Virology 2001; 82(12):3005

PubMed

Abstract

The major structural protein (VP1) of the BK polyomavirus (BKV) was expressed in the recombinant baculovirus expression system. Recombinant BKV VP1 was shown to self-assemble into virus-like particles (VLPs) with a diameter of 4550 nm. As for other polyomaviruses, BKV VP1 has the capacity to bind to exogenous DNA. Furthermore, the potential of BKV VP1 VLPs was investigated for gene transfer into COS-7 cells using three methods for the formation of pseudo-virions: disassembly/reassembly, osmotic shock and direct interaction between VLPs and reporter plasmid DNA. The latter method was shown to be the most efficient when using linearized plasmid. Gene transfer efficiency with BKV pseudo-virions was of the same order as that observed with human papillomavirus type 16 L1 protein VLPs. In addition, it is demonstrated that cellular entry of BKV pseudo-virions is dependent on cell surface sialic acid.



Human BK polyomavirus (BKV) is a member of the family Polyomaviridae, genus Polyomavirus, a family which also includes simian virus 40 (SV40), JC virus (JCV) and other animal polyomaviruses such as murine polyomavirus. Primary infection with BKV and JCV leads to lifetime persistence in the kidney, CNS and in lymphoid cells (Dörries, 1998 ). BKV/human cohabitation is considered to be an innocent relationship and most infections, which occur early in childhood, are asymptomatic. BKV is regarded as an opportunistic pathogen in immunocompromised patients and is frequently recovered from the urine of kidney and bone marrow transplant recipients. In such patients, BKV infection has been associated with haemorrhagic cystitis, ureteral stenosis and the development of neuroblastoma (Arthur et al., 1986 ; Flaegstad et al., 1999 ).

Polyomaviruses contain a double-stranded circular DNA molecule of about 5 kb, which is packaged with cellular histones in a capsid of 4550 nm in diameter. The capsid of polyomaviruses contains three proteins, VP1, VP2 and VP3. X-ray crystallography of SV40 and murine polyomavirus (Liddington et al., 1991 ; Griffith et al., 1992 ) has demonstrated that the polyomavirus capsid consists of 72 pentamers arranged in a T=7 icosahedral lattice. Each pentamer comprises five VP1 and the minor capsid protein VP2 and/or VP3 extend from the core into the cavity of the VP1 pentamer (Griffith et al., 1992 ).

The major structural protein (VP1) of SV40, JCV, murine polyomavirus and monkey B-lymphotropic papovavirus and the corresponding structural proteins of many papillomaviruses (L1) have been shown to self-assemble into virus-like particles (VLPs) when expressed in insect cells (Schiller & Roden, 1995 ; Stokrova et al., 1999 ; Gillock et al., 1997 ; Pawlita et al., 1996 ). Moreover, the use of papillomavirus or polyomavirus VLPs as carriers for gene transfer has been described recently (Forstova et al., 1995 ; Roden et al., 1996 ; Unckell et al., 1997 ; Touzé & Coursaget, 1998 ; Stokrova et al., 1999 ; Goldmann et al., 1999 ; Ou et al., 1999 ).

The aim of this study was to produce BKV VLPs by the expression of the VP1 gene in insect cells and to investigate their potential as gene transfer vectors using different methods to form pseudo-virions.

Viral DNA was purified from the urine of a kidney transplant patient. The BKV VP1 gene (strain PA) was amplified by PCR using the primers upper 5' TGATCATGGCCCCAACCAAAAGA and lower 5' AAGCTTCTGTTTAAAGCATTTTGG, each containing BclI and Hindlll restriction sites, respectively. The PCR product was cloned into the pCR2.1 vector by TA cloning and sequenced using Big Dye Terminators in an ABl prism 310 sequencer (Perkin Elmer). Comparison of the deduced amino acid revealed a close relationship with the BKV Dunlop strain (Dhar et al., 1978 ). Eight amino acid changes were observed in the VP1 gene of the PA strain compared to the VP1 gene of the Dunlop strain (Dunlop→PA): V42L, D60N, E158D, S171T, D175E, V210I, A219T and R370K. Only two of these changes, positions 60 and 219, involved amino acids with different properties. Nevertheless, the point mutation detected at position 219 is also present in the MM strain of BKV (Seif et al., 1979 ).

The VP1 gene was then cloned into the pFASTBAC1 vector to generate a recombinant baculovirus (BacBKVP1) using the BAC-TO-BAC system (Gibco BRL). Sf21 cells were infected with BacBKVP1 and fractionated into cytoplasmic and nuclear fractions 4 days post-infection, as described previously (Touzé et al., 1998 ). Analysis by SDSPAGE and Coomassie blue staining revealed the presence of an extra 40 kDa band in the nucleus of BacBKVP1-infected cells (data not shown). In order to investigate the self-assembly of BKV VP1 into VLPs, a nuclear lysate of infected cells was analysed by isopycnic banding in CsCl gradients. Fractions with densities ranging from 1·25 to 1·35 g/ml were observed by transmission electron microscopy (TEM). VLPs were observed in fractions with densities ranging from 1·28 to 1·30 g/ml. TEM micrographs demonstrated that most of the VLPs exhibited the typical morphology of empty polyomaviruses (Fig. 1a). Positive fractions were pooled, pelleted by ultra-centrifugation and resuspended in PBS. Human papillomavirus type 16 (HPV-16) L1 VLPs were purified according to the same protocol (Touzé et al., 1998 ). Exogenous DNA binding of BKV VP1 (5 µg) was analysed by SouthWestern blotting using digoxigenin-Iabelled pBR322. Under these conditions, BKV VP1 showed strong DNA-binding activity (Fig. 1b). The nuclear localization signal (NLS) and DNA-binding domain of polyomavirus and SV40 VP1 are located in the first 12 N-terminal amino acids (Chang et al., 1993 ; Ishii et al., 1996 ; Moreland & Garcea, 1991 ; Moreland et al., 1991 ) and the amino acid sequence of BKV VP1 is closely related to that of murine polyomavirus and SV40 VP1. It is therefore reasonable to predict that the NLS and DNA-binding domain of BKV VP1 may also be located at the N terminus in the positively charged amino acid stretch (MAPTKRKGECPGAAPKKPK).



(41K):

Fig. 1. (a) Electron micrograph of VLPs obtained by expression of the BKV VP1 gene in insect cells. The preparation was negatively stained with 1·5% uranyl acetate and observed at x50000 nominal magnification with a JEOL 1010 electron microscope. Bar, 100 nm. (b) Detection of DNA binding to BKV VP1 by SouthWestern blotting using digoxigenin-Iabelled pBR322. Bound DNA was shown by an anti-digoxigenin alkaline phosphatase-conjugated antibody with NBT/BCIP as the substrate. BSA was used as the negative control. (c) Electron micrographs of VLPDNA complexes obtained by direct interaction between BKV VLPs and linear plasmid. Bar, 100 nm.

The gene transfer properties of BKV VP1 VLPs into COS-7 cells were investigated using three methods to form pseudo-virions: disassembly/reassembly, osmotic shock and direct interaction. Gene transfer experiments were carried out using a pCMV-Iuciferase plasmid of 7·1 kb. This plasmid was used either in the circular form or as a restriction enzyme-linearized form. A VLP:DNA mass ratio of 10 was used in all experiments. For the disassembly/reassembly method, VLPs were incubated in 50 mM TrisHCl buffer (pH 7·5) containing 150 mM NaCl, 1 mM EGTA and 20 mM DTT at room temperature for 30 min. At this step, pCMV-Iuciferase diluted in 50 mM TrisHCl buffer (pH 7·5)150 mM NaCl was added. The preparation was then diluted in 50 mM TrisHCl buffer (pH 7·5)150 mM NaCl containing 2 mM CaCl2 and 1% DMSO. CaCl2 molarity was increased stepwise from 2 to 5 mM with an increment of 1 mM/h at 20 °C (El Mehdaoui et al., 2000 ). VLPDNA complexes were also obtained by osmotic shock according to Barr et al. (1979) for polyomavirus, with some modifications. VLPs and DNA were mixed in a buffer containing 150 mM NaCl, 10 mM TrisHCI (pH 7·5) and 0·01 mM CaCI2 (final volume 25 µl prior to dilution). After 10 min of incubation at 37 °C, the mixture was submitted to osmotic shock by dilution in 100 µl of distilled water and incubated for 20 min at 37 °C. In the direct interaction method, VLPs and DNA were mixed in 40 µl of 150 mM NaCl and incubated for 30 min at room temperature.

In order to investigate if the DNA is packaged into BKV VLPs, pseudo-virions obtained with the three methods were treated with Benzonase, as described previously (El Mehdaoui et al., 2000 ). Results indicate that protection was observed in the three methods and that the highest level of protection was observed with the direct interaction method. In order to better characterize the interaction between DNA and BKV VLPs using osmotic shock and direct interaction, preparations were observed by TEM in dark field after positive staining with 1·5% aqueous uranyl acetate. In these conditions, VLPs were shown to decorate the circular DNA molecule (data not shown) and to be combined with the ends of linear DNA molecules (Fig. 1c), as observed previously for murine polyomavirus using osmotic shock (Stokrova et al., 1999 ) and for HPV-31 using both methods (L. Bousarghin, A. L. Combita, A. Touzé, S. El Mehdaoui, P. Y. Sizaret, M. M. Bravo and P. Coursaget, unpublished results). VLPDNA complexes (101 µg per well, respectively) were incubated with COS-7 cells in 96-well plates. Lipofectamine (Invitrogen) was used as a positive control, according to the manufacturers instructions, with the same amount of DNA. After 2 days of pseudo-infection, luciferase activity was determined using the Luciferase reporter gene assay with constant light signal (Roche). The signal was integrated over 10 s (Victor2; Perkin Elmer) and results were expressed as counts per second (c.p.s.) per well. The results are the mean of two independent experiments and statistical analysis was carried out using the F-test (Epilnfo 6.04 software).

BKV VP1 VLPs were shown to be able to transfer a gene of interest into COS-7 cells with the three methods explored (Fig. 2). Nevertheless, the level of gene transfer depends both on the method used to form pseudo-virions and on the conformation of the DNA. The more effective way to produce efficient pseudo-virions is the direct interaction method between BKV VLPs and linear DNA. The results obtained with this latter method are similar to those obtained with Lipofectamine (15821 and 12750 c.p.s., respectively; P=0·35) and, when using a 7·2 kb β-galactosidase plasmid in place of the luciferase plasmid, 50% of COS-7 cells were transfected. Gene transfer results were shown to correlate protection of DNA from Benzonase. The BKV data were also compared to those obtained with HPV-16 VLPs. The levels of gene transfer with the same amount of HPV-16 L1 VLPs were higher than those observed with BKV VLPs (P=0·019 to P<0·001), with the exception of the direct interaction method using linear DNA (P=0·25). HPV VLPs may have been more efficient than BKV VLPs, since the plasmid used was 7·1 kb, which is larger than the BKV genome (5·1 kb) but smaller than the size of the HPV-16 genome (7·9 kb). We have shown previously that the size of DNA that can be packaged into HPV-16 VLPs by the disassembly/reassembly method is limited to the size of the genome (Touzé & Coursaget, 1998 ). It could thus be expected that the size of the plasmid used might have inhibited the packaging into BKV VLPs. However, the results indicate that gene transfer and thus DNA packaging was obtained with a plasmid of a higher size than the BKV genome. This is in agreement with the observation that SV40 capsids can package plasmids that are at least 50% larger than the SV40 minichromosome of 5·2 kb (Sandalon et al., 1997 ).



(28K):

Fig. 2. Efficiency of gene transfer into COS-7 cells using BKV VP1 (empty bars) or HPV-16 L1 (hatched bars) VLPs. Pseudo-virions were generated by the disassembly/reassembly, the osmotic shock and the direct interaction methods. The reporter plasmid, pCMV-Iuciferase, was used in either a circular (C) or a linear (L) form. Control experiments (dotted bars) were carried out using plasmid DNA alone or DNA complexed with Lipofectamine (Lipo). Results are the mean of two independent experiments. Error bars represent the mean±SD.

Gene transfer using linear DNA was always better than that observed with circular DNA (P=0·038 to P<0·001). In contrast, gene transfer was lower with linear DNA than with circular DNA when using Lipofectamine (P=0·28). A similar result was reported previously by Zanta et al. (1999) using synthetic peptides as carriers and by Kreiss et al. (1999) using cationic liposomes. Zanta et al. (1999) explained the lower efficiency of linear DNA by the fact that free ends are prone to cytosolic exonuclease-mediated degradation. TEM results suggest that linear DNA is protected from such degradation when BKV (Fig. 1c) or HPV VLPs stick to the end of the DNA molecules. In addition, the specificity of the gene transfer with BKV pseudo-virions, generated by direct interaction with linear DNA, was established by pre-incubation with anti-BKV VP1 serum raised in mice (diluted 1/1000) before COS-7 cell transfection. In these conditions, gene transfer was totally abolished.

In order to characterize cellular entry of BKV pseudo-virions, COS-7 cells were treated with increasing concentrations (0·0020·03 IU/ml) of Vibrio cholerae neuraminidase (Sigma) prior to incubation with VLPDNA complexes generated by direct interaction between VLPs and linear DNA (Table 1). Neuraminidase treatment inhibited gene transfer mediated by BKV VLPs in a dose-dependent manner, whereas no reduction was observed on gene transfer induced by HPV-16 VLPDNA complexes. These findings indicate that entry of BKV, but not HPV pseudo-virions, is dependent on the presence of cell surface sialic acid, like JCV and murine polyomavirus (Cahan & Paulson, 1980 ; Fried et al., 1981 ; Chen & Benjamin, 1997 ) and in contrast with SV40 (Haun et al., 1993 ; Liu et al., 1998 ).


Table 1. Inhibition of gene transfer mediated by BKV VP1 into COS-7 cells by neuraminidase treatment of target cells


In conclusion, the BKV VP1 major structural protein was shown to self-assemble into VLPs when expressed in insect cells, as observed for other polyomaviruses (Gillock et al., 1997 ; Stokrova et al., 1999 ; Pawlita et al., 1996 ; Ou et al., 1999 ) and recently by Lenz et al. (2001) for BKV. The findings also show that BKV VLPs have DNA-binding activity, bind to cell surface sialic acid and are shown to be promising vehicles for gene transfer studies, especially when pseudo-virions are formed using the direct interaction of VLPs with linear DNA.
A.T. and L.B. contributed equally to this work. We wish to thank Bernard Yvonnet for statistical analysis. This study was supported by the Association pour la Recherche sur le Cancer, the Ligue Contre le Cancer (Comité dlndre et Loire) and the Association Vaincre la Mucoviscidose. L.B., C.S. and A.L.C. were supported by the Région Centre, the Ministère de lEducation Nationale et de la Recherche Technologique, and Colciencias (Colombia), respectively.

References

Arthur, R. R., Shah, K. V., Baust, S. J., Santos, G. W. & Saral, R. (1986). Association of BK viruria with hemorrhagic cystitis in recipients of bone marrow transplants. New England Journal of Medicine 315, 230-234.[Abstract]

Barr, S. M., Keck, K. & Aposhian, H. V. (1979). Cell-free assembly of a polyoma-like particle from empty capside and DNA. Virology 96, 656-659.[Medline]

Cahan, L. D. & Paulson, J. C. (1980). Polyoma virus adsorbs to specific sialyloligosaccharide receptors on erythrocytes. Virology 103, 505-509.[Medline]

Chang, D., Cai, X. & Consigli, R. A. (1993). Characterization of the DNA binding properties of polyomavirus capsid protein. Journal of Virology 67, 6327-6331.[Abstract/Free Full Text]

Chen, M. H. & Benjamin, T. (1997). Roles of N-glycans with alpha 2,6 as well as alpha 2,3-linked sialic acid in infection by polyomavirus. Virology 233, 440-442.[Medline]

Dhar, R., Lai, C. J. & Khoury, G. (1978). Nucleotide sequence of the DNA replication origin for human papovavirus BKV: sequence and structural homology with SV40. Cell 13, 345-358.[Medline]

Dörries, K. (1998). Molecular biology and pathogenesis of human polyomavirus infections. Developments in Biological Standardization 94, 71-79.[Medline]

El Mehdaoui, S., Touzé, A., Laurent, S., Sizaret, P. Y., Rasschaert, D. & Coursaget, P. (2000). Gene transfer using recombinant rabbit hemorrhagic disease virus capsids with genetically modified DNA encapsidation capacity by addition of packaging sequences from L1 or L2 protein of human papillomavirus type 16. Journal of Virology 74, 10332-10340.[Abstract/Free Full Text]

Flaegstad, T., Andresen, P. A., Johnsen, J. I., Asomano, S. K., Jorgensen, G. E., Vignarajan, S., Kjuul, A., Kogner, P. & Traavik, T. (1999). A possible contributory role of BK virus infection in neuroblastoma development. Cancer Research 59, 1160-1163.[Abstract/Free Full Text]

Forstova, J., Krauzewicz, N., Sandig, V., Elliot, J., Stauss, M. & Griffin, B. E. (1995). Polyoma virus pseudocapsids as efficient carriers of heterologous DNA into mammalian cells. Human Gene Therapy 6, 297-306.[Medline]

Fried, H., Cahan, L. & Paulson, J. (1981). Polyomavirus recognizes specific sialyloligosaccharide receptors on host cells. Virology 109, 188-192.[Medline]

Gillock, E. T., Rottinghaus, S., Chang, D., Cai, X., Smiley, S. A. & Consigli, R. A. (1997). Polyomavirus major capsid protein VP1 is capable of packaging cellular DNA when expressed in the baculovirus system. Journal of Virology 71, 2857-2865.[Abstract]

Goldmann, C., Petry, H., Frye, S., Ast, O., Ebitsch, S., Jentsch, K. D., Kaup, F. J., Weber, F., Trebst, C., Nisslein, T., Hunsmann, G., Weber, T. & Luke, W. (1999). Molecular cloning and expression of major structural protein VP1 of the human polyomavirus JC virus: formation of virus-like particles useful for immunological and therapeutic studies. Journal of Virology 73, 4465-4469.[Abstract/Free Full Text]

Griffith, G. P., Griffith, D. L., Rayment, I., Marakami, W. T. & Caspar, D. L. D. (1992). Inside polyomavirus at 25 resolution. Nature 355, 652-654.[Medline]

Haun, G., Keppler, O. T., Bock, C. T., Herrmann, M., Zentgraf, H. & Pawlita, M. (1993). The cell surface receptor is a major determinant restricting the host range of the B-Iymphotropic papovavirus. Journal of Virology 67, 7482-7492.[Abstract/Free Full Text]

Ishii, N., Minami, N., Chen, E. Y., Medina, A. L., Chico, M. M. & Kasamatsu, H. (1996). Analysis of a nuclear localization signal of simian virus 40 major capsid protein Vp1. Journal of Virology 70, 1317-1322.[Abstract]

Kreiss, P., Cameron, B., Rangara, R., Mailhe, P., Aguerre-Charriol, O., Airiau, M., Scherman, D., Crouzet, J. & Pitard, B. (1999). Plasmid size does not affect the physicochemical properties of lipoplexes but modulates gene transfer efficiency. Nucleic Acids Research 27, 3792-3798.[Abstract/Free Full Text]

Lenz, P., Day, P. M., Pang, Y. Y., Frye, S. A., Jensen, P. N., Lowy, D. R. & Schiller, J. T. (2001). Papillomavirus-like particles induce acute activation of dendritic cells. Journal of Immunology 166, 5346-5355.[Abstract/Free Full Text]

Liddington, R. C., Yan, Y., Moulai, J., Sahli, R., Benjamin, T. L. & Harrison, S. C. (1991). Structure of simian virus 40 at 3·8 resolution. Nature 354, 278-284.[Medline]

Liu, C. K., Hopa, A. P. & Atwood, W. J. (1998). The human polyomavirus JCV, does not share receptor specificity with SV40 on human glial cells. Journal of Neurovirology 4, 49-58.[Medline]

Moreland, R. B. & Garcea, R. L. (1991). Characterization of a nuclear localization sequence in the polyomavirus capsid protein VP1. Virology 185, 513-518.[Medline]

Moreland, R. B., Montross, L. & Garcea, R. L. (1991). Characterization of the DNA-binding properties of the polyomavirus capsid protein VP1. Journal of Virology 65, 1168-1176.[Abstract/Free Full Text]

Ou, W., Wang, M., Fung, C., Tsai, R., Chao, P., Hseu, T. & Chang, D. (1999). The major capsid protein, VP1, of human JC virus expressed in Escherichia coli is able to self-assemble into a capsid-like particle and deliver exogenous DNA into human kidney cells. Journal of General Virology 80, 39-46.[Abstract]

Pawlita, M., Müller, M., Oppenlander, M., Zentgraf, H. & Herrmann, M. (1996). DNA encapsidation by virus-like particles assembled in insect cells from the major capsid protein VP1 of B-lymphotropic papovavirus. Journal of Virology 70, 7517-7526.[Abstract]

Roden, R. B. S., Greenstone, H. L., Kirnbauer, R., Booy, F. P., Jessie, J., Lowy, D. R. & Schiller, J. T. (1996). In vitro generation and type specific neutralization of a human type 16 virion pseudotype. Journal of Virology 70, 5875-5883.[Abstract]

Sandalon, Z., Dalyot-Herman, N. & Oppenheim, A. (1997). In vitro assembly of SV40 virions and pseudo-virions: vector for gene therapy. Human Gene Therapy 8, 834-839.

Schiller, J. T. & Roden, R. B. (1995). Papillomavirus-like particles. Papillomavirus Report 6, 121-128.

Seif, I., Khoury, G. & Dhar, R. (1979). The genome of human papovavirus BK. Cell 18, 963-977.[Medline]

Stokrova, J., Palkova, Z., Fischer, L., Richterova, Z., Korb, J., Griffin, B. E. & Forstova, J. (1999). Interactions of heterologous DNA with polyomavirus major structural protein, VP1. FEBS Letters 445, 119-125.[Medline]

Touzé, A. & Coursaget, P. (1998). In vitro gene transfer using human papillomavirus-like particles. Nucleic Acids Research 26, 1317-1323.[Abstract/Free Full Text]

Touzé, A., El Mehdaoui, S., Sizaret, P. Y., Mougin, C., Muñoz, N. & Coursaget, P. (1998). The L1 major capsid protein of HPV-16 variants affects the yield of virus-like particles produced in an insect cell expression system. Journal of Clinical Microbiology 36, 2046-2051.[Abstract/Free Full Text]

Unckell, F., Streeck, R. E. & Sapp, M. (1997). Generation of pseudovirions of human papillomavirus type 33. Journal of Virology 71, 2934-2939.[Abstract]

Zanta, M. A., Belguise-Valladier, P. & Behr, J. P. (1999). Gene delivery: a single nuclear localization signal peptide is sufficient to carry DNA to the cell nucleus Proceedings of the National Academy of Sciences, USA 96, 91-96.[Abstract/Free Full Text]

Received 8 June 2001; accepted 15 August 2001.