Research Article

Elevated expression of c-myc in lymphoblastoid cells does not support an Epstein-Barr virus latency III-to-I switch

Journal of General Virology 2001; 82(12):3051

PubMed

With thanks to our partners for supporting this archive.

Abstract

EpsteinBarr virus (EBV) transforms primary B cells in vitro. Established cell lines adopt a lymphoblastoid phenotype (LCL). In contrast, EBV-positive Burkitts lymphoma (BL) cells, in which the proto-oncogene c-myc is constitutively activated, do not express a lymphoblastoid phenotype in vivo. The two different phenotypes are paralleled by two distinct programmes of EBV latent gene expression termed latency type I in BL cells and type III in LCL. Human B cell lines were established from a conditional LCL (EREB2-5) by overexpression of c-myc and inactivation of EBV nuclear protein 2 (EBNA2). These cells (A1 and P493-6) adopted a BL phenotype in the absence of EBNA2. However, the EBV latency I promoter Qp was not activated. Instead, the latency III promoter Cp remained active. These data suggest that the induction of a BL phenotype by overexpression of c-myc in an LCL is not necessarily paralleled by an EBV latency III-to-I switch.



Burkitts lymphoma (BL) is a human B-cell neoplasia that occurs classically as a childhood malignancy with high incidence in areas with holoendemic malarial infection (Nesbit et al., 1999 ). BL cells are characterized by reciprocal chromosomal translocations involving the gene loci of the proto-oncogene c-myc (myc) and of immunoglobulin genes. The juxtaposition of immunoglobulin gene enhancers results in the oncogenic activation of myc (Henriksson & Lüscher, 1996 ).

BL is frequently associated with EpsteinBarr virus (EBV), a lymphotropic γ-herpesvirus. Infection of primary B cells in vitro with EBV results in cell transformation and the establishment of lymphoblastoid cell lines (LCL) that express six viral latent nuclear antigens (EBNAs) and three latent membrane proteins (LMPs). In BL cells in vivo, the expression of EBV latent proteins is restricted to EBNA1 (Rickinson & Kieff, 1996 ). The two different programmes of EBV latent gene expression are termed EBV latency type I in BL and type III in LCL (Rowe et al., 1987 ). Different promoters regulate EBNA1 expression in latency I and III. EBNA1 is expressed from the Qp promoter (Schaefer et al., 1995 ) in BL whereas, in LCL, all EBNA genes are expressed from the Cp promoter. The individual mRNAs are generated by alternative splicing of long primary transcripts (Kieff, 1996 ).

Immortalization of B cells by EBV is assumed to be an important step during the pathogenesis of BL. Therefore, an intriguing question is which factors implement the restricted EBV gene expression programme found in BL; i.e. which factors induce the switch from EBV latency type III to type I. Several regulatory factors of the EBNA1 promoter Qp, active in BL cells, have been identified so far, among them viral proteins (EBNA1), immune response-dependent factors (IRFs, STATs) and cell-cycle regulating proteins (E2F, Rb) (Chen et al., 1999 ; Davenport & Pagano, 1999 ; Nonkwelo et al., 1997 ; Ruf & Sample, 1999 ; Schaefer et al., 1997b ; Zhang & Pagano, 1997 , 1999 ). Methylation of the EBV genome has been demonstrated to be a prerequisite for the maintenance of latency type I by inhibiting the activation of the Cp promoter, which is active in LCL (Robertson, 2000 ). Until now, a latency III-to-I switch in B cells has not been observed in vitro.

In order to investigate the genetic events that contribute to the pathogenesis of BL, we overexpressed the proto-oncogene myc in the conditional LCL EREB2-5 (Pajic et al., 2000 ; Polack et al., 1996 ). This cell line carries the EBNA2 deletion mutant P3HR-1 and an expression plasmid for an EBNA2oestrogen receptor fusion protein, which renders EBNA2 function and EBV immortalization dependent on the presence of oestrogen (Kempkes et al., 1995 ). Ectopic overexpression of myc in EREB2-5 cells allows the establishment of cell lines that proliferate independently of EBNA2 and express features typical of BL cells (in vivo phenotype) (Polack et al., 1996 ). Here, we asked whether the observed switch from an LCL phenotype to a BL phenotype was accompanied by an EBV latency III-to-I switch. The activities of the EBNA promoters Qp and Cp were analysed in the cell lines A1, in which myc is overexpressed under the control of Igκ enhancer elements (Polack et al., 1996 ), and P493-6, in which myc expression can be controlled by a tetracycline-responsive promoter (Pajic et al., 2000 ).

Qp- and Cp-initiated EBNA1 transcripts can be detected and distinguished by RTPCR (Schaefer et al., 1996 ; Schlager et al., 1996 ). Reverse transcription was performed with 5·0 µg total RNA, 0·5 µg oligo(dT) primer, 0·5 mM dNTPs, 200 U reverse transcriptase (Superscript II, Gibco BRL), 75 mM KCl, 3 mM MgCl2, 10 mM DTT, 50 mM TrisHCl (pH 8·3) and 20 U RNase inhibitor (RNasin) in 20 µl at 42 °C for 50 min. The reaction was stopped by heating at 70 °C for 15 min.

A 1/50 aliquot of the RT reaction was subjected to 25 cycles of PCR. For amplification of Qp-initiated transcripts, PCR was performed with 5 pmol primer, 0·1 mM dNTPs, 2·5 U Taq DNA polymerase, 1 mM MgCl2, 0·1% Triton X-100 and 10 mM TrisHCl (pH 9·0) in 50 µl. Each thermocycle was composed of 1 min denaturation at 94 °C, 30 s primer hybridization at 58 °C and 1 min synthesis at 72 °C. For amplification of Cp-initiated transcripts, PCR was performed with 10 pmol primer, 0·2 mM dNTPs and 5 U Taq DNA polymerase (Promega) in 1·5 mM MgCl2, 0·1% Triton X-100 and 10 mM TrisHCl (pH 9·0). The PCR programme was as above except that the primer hybridization and DNA synthesis phases were extended to 1 and 3 min, respectively.

PCR products were resolved by agarose gel electrophoresis and subjected to Southern blotting according to standard protocols (Sambrook et al., 1989 ). Blots were hybridized with a 32P-labelled U-exon probe. Radiolabelling of DNA was performed by random-primed labelling according to the protocols of the manufacturer.

A QK primer pair was applied for the detection of Qp activity in A1 and P493-6 cells (Schaefer et al., 1995 ). During the lytic cycle, the Fp promoter generates transcripts that overlap Qp-initiated transcripts and may mimic Qp activity in RTPCR analysis (Fig. 1). Therefore, we controlled for the presence of lytic, Fp-initiated EBNA1 transcripts by a separate PCR with an FK primer pair. Neither Qp- nor Fp-initiated EBNA1 transcripts were present in A1 and P493-6 cells. In control cells, these transcripts could be detected easily (Fig. 2). In order to exclude the possibility that the negative results in our cellular system were due to point mutations in the primer-binding sites, we sequenced the respective regions in A1 cells. No mutations were found in the sequences covering the F, Q and K primer-binding sites (data not shown).



(18K):

Fig. 1. Schematic illustration of typical EBNA1 transcripts generated during the various stages of EBV infection in B cells. The viral genome is shown in linear form at the top. The positions of major elements like the origin of replication (oriP) and the terminal (TR) and internal (IR) repeats are indicated. Exons are depicted as black bars. The shaded bar indicates the deletion in the genome of the EBV mutant virus P3HR-1 that was used as the helper virus in the establishment of the cell lines EREB2-5, A1 and P493-6. At the bottom, the exon composition of the various EBNA1 transcripts is summarized.


(32K):

Fig. 2. EBNA1 is expressed from Cp, and Qp-initiated EBNA1 transcripts are absent in EREB2-5, A1 and P493-6 cells. EREB2-5 cells were cultured in the presence of EBNA2 function. A1 and P493-6 cells were grown in the absence of EBNA2 function and the presence of elevated myc expression. In addition, EBNA2 activity and myc expression were altered in P493-6 cells for 4 days as indicated. RTPCR was performed with a 5' primer in exon Q (Q primer: 5' AAGGCGCGGGATAGCGT 3'), F (F primer: 5' ATATGAGCTCGGTGAGGCCACGCTT 3') or C1 (C1 primer: 5' CACTACAAGACCTACGCC 3') and a 3' primer in the K exon (K primer: 5' CCCCTCGTCAGACATGAT 3'). The results were analysed on a Southern blot, which was hybridized with a 32P-labelled U-exon probe derived from an EBV cosmid by restriction with HincII (bases 6672268619 of the B95-8 viral genome). N, Negative control (DG75; EBV-negative BL line); Q, positive control for Qp-initiated EBNA1 transcription (BL29; EBV-positive BL line, latency I); F, positive control for Fp-initiated EBNA1 transcription [HH514; EBV-positive BL line P3HR-1, in which the lytic cycle was induced by treatment with sodium butyrate and 12-O-tetradecanoylphorbol 13-acetate (TPA)]; C, positive control for Cp-initiated EBNA1 transcription (Jijoye; EBV-positive cell line, latency III). The positions of size markers are shown.

As Qp was not responsible for EBNA1 transcription in A1 and P493-6 cells, we asked whether EBNA1 transcription was driven by Cp (Fig. 1). A C1K primer pair was applied for the detection of Cp-initiated EBNA1 transcripts. In A1 and P493-6 cells, two transcripts could be detected that differed in size by about 200 bp (Fig. 2). Additionally, the transcripts in A1 cells were about 400 bp smaller than those in P493-6 cells. As the size of a W-exon unit is 198 bp, these differences could reflect different contents of W-exon units. Activation of EBNA2 resulted in increased expression of EBNA1 (Fig. 2 and data not shown). This observation was in agreement with previous reports that EBNA2 enhances Cp activity (Evans et al., 1996 ). The LCL EREB2-5, the parental line of A1 and P493-6, expressed Cp-initiated EBNA1 transcripts of uniform size, whereas the EBV-positive BL line BL29 (latency I) did not show any Cp activity (data not shown).

In LCL, Cp-initiated transcripts are spliced to generate the mRNA of all EBNA genes (Rickinson & Kieff, 1996 ). We asked whether the observed Cp activity in A1 and P493-6 cells would also result in the expression of other EBNAs and analysed the expression of EBNA3 transcripts (EBNA3A, B and C). PCR was performed with a 5' primer in the W2 exon that is common for all EBNA3 transcripts and 3' primers in the unique EBNA3A, B or C coding regions. In EREB2-5, A1 and P493-6 cells, transcripts of EBNA3A, B and C were detected. The results of the EBNA3C analysis are shown in Fig. 3 as a representative of all EBNA3 genes.



(18K):

Fig. 3. EBNA3C is transcribed in EREB2-5, A1 and P493-6 cells. (a) Transcripts of the EBNA3 genes are illustrated schematically; the symbols are the same as those used in Fig. 1. (b) Cells were cultured as described in the legend to Fig. 2. RTPCR was performed with a 5' primer in the W2 exon (W2 primer: 5' AGAGGAGGTGGTAAGCGGTTC 3') and a 3' primer in the E4 exon (E4 primer: 5' GAGAGCCACACAGTTCTATC 3'). The results were analysed on a Southern blot, which was hybridized with a 32P-labelled U-exon probe. N, Negative control (DG75; EBV-negative BL line); C, positive control (Jijoye; EBV-positive cell line, latency III). The positions of size markers are shown.

Our observation that myc induces the expression of a surface antigen pattern characteristic of BL cells and downregulates surface molecules expressed on EBV-immortalized LCL contradicts the results of previous studies (Cutrona et al., 1995 ; Hotchin et al., 1990 ; Lombardi et al., 1987 ). However, the activities of the EBV promoters Cp and Qp were not tested in those studies. We now show that the EBV latency I promoter Qp is not active in A1 or P493-6 cells or in the parental LCL EREB2-5. Instead, the EBV latency III promoter Cp drives transcription of EBNA1 and EBNA3 genes in these cells. This transcription is independent of EBNA2. The data presented suggest that the elevated expression of myc in LCL is not sufficient to promote an EBV latency III-to-I switch.

Kerr et al. (1992) studied somatic cell hybrids and observed a downregulation of Wp/Cp and an upregulation of Qp in hybrid cell lines that had lost the LCL phenotype and acquired the phenotype of the non-B cell fusion partners. However, all cell hybrids that retained the LCL-like phenotype also kept the EBV latency III programme. This was always the case when a BL cell line was fused with an LCL, showing that the LCL phenotype was dominant over the BL phenotype (Wolf et al., 1993 ).

In contrast, our system allows the switching from an LCL to a BL phenotype in the same cells. Similar phenotypic changes were observed after the transition of Jijoye BL cells to the P3HR-1 daughter cell line. Jijoye cells show an LCL phenotype, including the EBV latency III transcription programme, whereas P3HR-1 cells have acquired an EBNA2 deletion and have lost the expression of typical LCL surface antigens. EBNA1 is expressed exclusively from Wp in P3HR-1 cells. This is in contrast to the cell system used here. However, the factors that determine the use of Wp rather than Cp are unknown in P3HR-1 cells. It is also unclear whether there is a difference in virus promoter regulation if EBNA2 is expressed from an episome in trans, as in our cellular system (Kempkes et al., 1996 ), or from the same genome in cis. This can be overcome by generating recombinant EBV with a conditional EBNA2 based on the EBV B95-8 strain (Delecluse et al., 1998 , 1999 ).

In another analysis, cells of an EBV-negative BL line were infected with the P3HR-1 virus (Schlager et al., 1996 ). The activities of the EBNA promoters were monitored during a time-course of several hours after infection. It was observed that both Qp and Cp were activated. These data suggested that the environment of a BL cell might support the activity of both EBV latency I (Qp) and III (Cp) promoters and that the P3HR-1 EBV strain does not contain defective Qp or Cp promoters.

We intended to construct an EBV latency III-to-I switch in vitro by overexpressing myc and inactivating EBNA2 in parallel. It is striking that the EBNA transcription programme characteristic of LCL remained active despite the enormous phenotypic changes. Repression of Wp and Cp by methylation has been demonstrated to be a prerequisite for Qp activation in B cells (Schaefer et al., 1997 a). It is likely that the EBV genome is not methylated in the same way in A1 and P493-6 cells as in BL cells. At present it is not clear which factors trigger methylation of EBV promoters in B cells. Our data imply that the overexpression of myc and inactivation of EBNA2 are not sufficient for Wp/Cp methylation.

It has been reported that elevated levels of EBNA1 can inhibit Qp activity (Sample et al., 1992 ). A1 and P493-6 cells expressed higher levels of EBNA1 protein than did EREB2-5 cells. However, the levels of EBNA1 protein in A1 and P493-6 cells were comparable with levels found in BL phenotype I cells Rael and MutuI. Additionally, MutuIII cells, representing Mutu cells in EBV latency III, expressed levels of EBNA1 protein comparable to those of EREB2-5 cells (data not shown). These data suggest that the higher EBNA1 protein levels in A1 and P493-6 cells may not be inhibitory for Qp activity.

EBNA3A, -B and -C transcripts were also detected in A1 and P493-6 cells. However, the presence of EBNA3 proteins could not be verified, due to the lack of antibodies that recognize EBNA3 proteins of the EBV type 2 P3HR-1 strain specifically. Members of the EBNA3 protein family have been demonstrated to modulate EBNA2-dependent transcription and are also likely to contribute to transcriptional regulation in the absence of EBNA2 (Cludts & Farrell, 1998 ; Marshall & Sample, 1995 ). It remains unclear whether EBNA3 proteins could contribute to the activation of Cp in A1 and P493-6 cells. The answer to these questions could be provided by establishing a similar cell system based on a B95-8 recombinant EBV, for which the appropriate reagents are available.

This work was supported by the Deutsche Forschungsgemeinschaft (La948/2-2 and SFB455) and the Fonds der Chemischen Industrie.

Footnotes

b Present address: Martin-Luther-Universität HalleWittenberg, Forschungslabor der Klinik für Kinder- und Jugendmedizin, Biozentrum, D-06120 Halle (Saale), Germany.

c Present address: Universität Köln, Institut für Physiologie, Robert-Koch-Str. 39, D-50931 Köln, Germany.

References

Chen, H., Lee, J. M., Wang, Y., Huang, D. P., Ambinder, R. F. & Hayward, S. D. (1999). The EpsteinBarr virus latency BamHI-Q promoter is positively regulated by STATs and Zta interference with JAK/STAT activation leads to loss of BamHI-Q promoter activity. Proceedings of the National Academy of Sciences, USA 96, 9339-9344.[Abstract/Free Full Text]

Cludts, I. & Farrell, P. J. (1998). Multiple functions within the EpsteinBarr virus EBNA-3A protein. Journal of Virology 72, 1862-1869.[Abstract/Free Full Text]

Cutrona, G., Ulivi, M., Fais, F., Roncella, S. & Ferrarini, M. (1995). Transfection of the c-myc oncogene into normal EpsteinBarr virus-harboring B cells results in new phenotypic and functional features resembling those of Burkitt lymphoma cells and normal centroblasts. Journal of Experimental Medicine 181, 699-711.[Abstract/Free Full Text]

Davenport, M. G. & Pagano, J. S. (1999). Expression of EBNA-1 mRNA is regulated by cell cycle during EpsteinBarr virus type I latency. Journal of Virology 73, 3154-3161.[Abstract/Free Full Text]

Delecluse, H. J., Hilsendegen, T., Pich, D., Zeidler, R. & Hammerschmidt, W. (1998). Propagation and recovery of intact, infectious EpsteinBarr virus from prokaryotic to human cells. Proceedings of the National Academy of Sciences, USA 95, 8245-8250.[Abstract/Free Full Text]

Delecluse, H. J., Pich, D., Hilsendegen, T., Baum, C. & Hammerschmidt, W. (1999). A first-generation packaging cell line for EpsteinBarr virus-derived vectors. Proceedings of the National Academy of Sciences, USA 96, 5188-5193.[Abstract/Free Full Text]

Evans, T. J., Farrell, P. J. & Swaminathan, S. (1996). Molecular genetic analysis of EpsteinBarr virus Cp promoter function. Journal of Virology 70, 1695-1705.[Abstract]

Henriksson, M. & Lüscher, B. (1996). Proteins of the Myc network: essential regulators of cell growth and differentiation. Advances in Cancer Research 68, 109-182.[Medline]

Hotchin, N. A., Allday, M. J. & Crawford, D. H. (1990). Deregulated c-myc expression in EpsteinBarr-virus-immortalized B-cells induces altered growth properties and surface phenotype but not tumorigenicity. International Journal of Cancer 45, 566-571.

Kempkes, B., Spitkovsky, D., Jansen-Durr, P., Ellwart, J. W., Kremmer, E., Delecluse, H. J., Rottenberger, C., Bornkamm, G. W. & Hammerschmidt, W. (1995). B-cell proliferation and induction of early G1-regulating proteins by EpsteinBarr virus mutants conditional for EBNA2. EMBO Journal 14, 88-96.[Medline]

Kempkes, B., Zimber-Strobl, U., Eissner, G., Pawlita, M., Falk, M., Hammerschmidt, W. & Bornkamm, G. W. (1996). EpsteinBarr virus nuclear antigen 2 (EBNA2)oestrogen receptor fusion proteins complement the EBNA2-deficient EpsteinBarr virus strain P3HR1 in transformation of primary B cells but suppress growth of human B cell lymphoma lines. Journal of General Virology 77, 227-237.[Abstract/Free Full Text]

Kerr, B. M., Lear, A. L., Rowe, M., Croom-Carter, D., Young, L. S., Rookes, S. M., Gallimore, P. H. & Rickinson, A. B. (1992). Three transcriptionally distinct forms of EpsteinBarr virus latency in somatic cell hybrids: cell phenotype dependence of virus promoter usage. Virology 187, 189-201.[Medline]

Kieff, E. (1996). EpsteinBarr virus and its replication. In Fields Virology , pp. 2343-2396. Edited by B. N. Fields, D. M. Knipe & P. M. Howley. Philadelphia:LippincottRaven.

Lombardi, L., Newcomb, E. W. & Dalla-Favera, R. (1987). Pathogenesis of Burkitt lymphoma: expression of an activated c-myc oncogene causes the tumorigenic conversion of EBV-infected human B lymphoblasts. Cell 49, 161-170.[Medline]

Marshall, D. & Sample, C. (1995). EpsteinBarr virus nuclear antigen 3C is a transcriptional regulator. Journal of Virology 69, 3624-3630.[Abstract]

Nesbit, C. E., Tersak, J. M. & Prochownik, E. V. (1999). MYC oncogenes and human neoplastic disease. Oncogene 18, 3004-3016.[Medline]

Nonkwelo, C., Ruf, I. K. & Sample, J. (1997). Interferon-independent and -induced regulation of EpsteinBarr virus EBNA-1 gene transcription in Burkitt lymphoma. Journal of Virology 71, 6887-6897.[Abstract]

Pajic, A., Spitkovsky, D., Christoph, B., Kempkes, B., Schuhmacher, M., Staege, M. S., Brielmeier, M., Ellwart, J., Kohlhuber, F., Bornkamm, G. W., Polack, A. & Eick, D. (2000). Cell cycle activation by c-myc in a burkitt lymphoma model cell line. International Journal of Cancer 87, 787-793.

Polack, A., Hortnagel, K., Pajic, A., Christoph, B., Baier, B., Falk, M., Mautner, J., Geltinger, C., Bornkamm, G. W. & Kempkes, B. (1996). c-myc activation renders proliferation of EpsteinBarr virus (EBV)-transformed cells independent of EBV nuclear antigen 2 and latent membrane protein 1. Proceedings of the National Academy of Sciences, USA 93, 10411-10416.[Abstract/Free Full Text]

Rickinson, A. B. & Kieff, E. (1996). EpsteinBarr virus. In Fields Virology , pp. 2397-2446. Edited by B. N. Fields, D. M. Knipe & P. M. Howley. Philadelphia:LippincottRaven.

Robertson, K. D. (2000). The role of DNA methylation in modulating EpsteinBarr virus gene expression. Current Topics in Microbiology and Immunology 249, 21-34.[Medline]

Rowe, M., Rowe, D. T., Gregory, C. D., Young, L. S., Farrell, P. J., Rupani, H. & Rickinson, A. B. (1987). Differences in B cell growth phenotype reflect novel patterns of EpsteinBarr virus latent gene expression in Burkitts lymphoma cells. EMBO Journal 6, 2743-2751.[Medline]

Ruf, I. K. & Sample, J. (1999). Repression of EpsteinBarr virus EBNA-1 gene transcription by pRb during restricted latency. Journal of Virology 73, 7943-7951.[Abstract/Free Full Text]

Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning: A Laboratory Manual, 2nd edn. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.

Sample, J., Henson, E. B. & Sample, C. (1992). The EpsteinBarr virus nuclear protein 1 promoter active in type I latency is autoregulated. Journal of Virology 66, 4654-4661.[Abstract/Free Full Text]

Schaefer, B. C., Strominger, J. L. & Speck, S. H. (1995). Redefining the EpsteinBarr virus-encoded nuclear antigen EBNA-1 gene promoter and transcription initiation site in group I Burkitt lymphoma cell lines. Proceedings of the National Academy of Sciences, USA 92, 10565-10569.[Abstract/Free Full Text]

Schaefer, B. C., Strominger, J. L. & Speck, S. H. (1996). A simple reverse transcriptase PCR assay to distinguish EBNA1 gene transcripts associated with type I and II latency from those arising during induction of the viral lytic cycle. Journal of Virology 70, 8204-8208.[Abstract]

Schaefer, B. C., Strominger, J. L. & Speck, S. H. (1997a). Host-cell-determined methylation of specific EpsteinBarr virus promoters regulates the choice between distinct viral latency programs. Molecular and Cellular Biology 17, 364-377.[Abstract]

Schaefer, B. C., Paulson, E., Strominger, J. L. & Speck, S. H. (1997b). Constitutive activation of EpsteinBarr virus (EBV) nuclear antigen 1 gene transcription by IRF1 and IRF2 during restricted EBV latency. Molecular and Cellular Biology 17, 873-886.[Abstract]

Schlager, S., Speck, S. H. & Woisetschlager, M. (1996). Transcription of the EpsteinBarr virus nuclear antigen 1 (EBNA1) gene occurs before induction of the BCR2 (Cp) EBNA gene promoter during the initial stages of infection in B cells. Journal of Virology 70, 3561-3570.[Abstract]

Wolf, J., Pawlita, M., Klevenz, B., Frech, B., Freese, U. K., Muller-Lantzsch, N., Diehl, V. & zur Hausen, H. (1993). Down-regulation of integrated EpsteinBarr virus nuclear antigen 1 and 2 genes in a Burkitt lymphoma cell line after somatic cell fusion with autologous EBV-immortalized lymphoblastoid cells. International Journal of Cancer 53, 621-627.

Zhang, L. & Pagano, J. S. (1997). IRF-7, a new interferon regulatory factor associated with EpsteinBarr virus latency. Molecular and Cellular Biology 17, 5748-5757.[Abstract]

Zhang, L. & Pagano, J. S. (1999). Interferon regulatory factor 2 represses the EpsteinBarr virus BamHI Q latency promoter in type III latency. Molecular and Cellular Biology 19, 3216-3223.[Abstract/Free Full Text]

Received 26 March 2001; accepted 9 August 2001.