Research Article

The C-terminal residues of poliovirus proteinase 2Apro are critical for viral RNA replication but not for cis- or trans-proteolytic cleavage

Journal of General Virology 2001; 82(2):397

PubMed

Abstract

Poliovirus proteinase 2Apro is an essential enzyme involved in cleavages of viral and cellular proteins during the infectious cycle. Evidence has been obtained that 2Apro is also involved in genome replication. All enteroviruses have a negatively charged cluster of amino acids at their C terminus (EE/DE/DAMEQNH2), a common motif suggesting function. When aligned with enterovirus sequences, the 2Apro proteinase of human rhinovirus type 2 (HRV2) has a shorter C terminus (EE...QNH2) and, indeed, the HRV2 2Apro cannot substitute for poliovirus 2Apro to yield a viable chimeric virus. Here evidence is provided that the C-terminal cluster of amino acids plays an unknown role in poliovirus genome replication. Deletion of the EEAME sequence from poliovirus 2Apro is lethal without significantly influencing proteinase function. On the other hand, addition of EAME to HRV2 2Apro, yielding a C terminus of this enzyme of EEEAMEQ, stimulated RNA replication of a poliovirus/HRV2 chimera 100-fold. The novel role of the C-terminal sequence motif is manifested at the level of protein function, since silent mutations in its coding region had no effect on virus proliferation. Poliovirus type 1 Mahoney 2Apro could be provided in trans to rescue the lethal deletion EEAME in the poliovirus variant. Encapsidation studies left open the question of whether the C terminus of poliovirus 2Apro is involved in particle formation. It is concluded that the C terminus of poliovirus 2Apro is an essential domain for viral RNA replication but is not essential for proteolytic processing.
Poliovirus is a prototype of the Picornaviridae, a family of small, non-enveloped plus-stranded RNA viruses. The Picornaviridae have been divided into nine genera as the number of previously recognized genera, Enterovirus, Rhinovirus, Hepatovirus, Parechovirus, Cardiovirus and Aphthovirus, has recently been extended by the three new genera Erbovirus, Kobuvirus and Teschovirus (Rueckert, 1996 ; Pringle, 1999 ). A list of species and their serotypes can be found on the Picornavirus Sequence Database at http://www.iah.bbsrc.ac.uk/virus/picornavaviridae/sequencedatabase/index.html. The genus Enterovirus consists of poliovirus, coxsackie A viruses, coxsackie B viruses, echoviruses and a number of non-classified enteroviruses. The genus Rhinovirus is divided into major and minor receptor group rhinoviruses and contains more than 100 serotypes. The enteroviruses and rhinoviruses share great similarity in virion structure, gene organization and many aspects of their replication cycle, in spite of differences in tissue tropism and disease syndromes (Agol et al., 1999 ; Gromeier et al., 1999 ; Pfister et al., 1999 ).

The enterovirus and rhinovirus genomes are about 7500 nucleotides long, with a small viral protein (VPg) and a poly(A) tail present at their 5' and 3' termini, respectively (Kitamura et al., 1980 , 1981 ; Lee et al., 1977 ; Skern et al., 1985 ). Both enterovirus and rhinovirus genomes encode a single large polyprotein from which the viral structural proteins, expressed as precursor P1, and non-structural proteins, as expressed as P2 and P3, are derived by proteolytic processing (Fig. 1b). The processing steps are catalysed by the virus-encoded proteinases 2Apro, 3Cpro and 3CDpro. The 2Apro proteinases are encoded immediately downstream of the P1 precursor in enterovirus and rhinovirus genomes. This proteinase cleaves the P1P2 junction in cis and cellular proteins in trans. The cis-cleavage activity of the enterovirus and rhinovirus 2Apro proteinases releases the P1 precursor from the non-structural P2P3 precursors (Sommergruber et al., 1989 ; Toyoda et al., 1986 ). The trans-cleavage activity of enterovirus and rhinovirus 2Apro processes cellular factors, including eukaryotic initiation factor eIF-4G (eIF-4γ or p220) (Kräusslich et al., 1987 ; Lamphear et al., 1993 ), TATA-binding protein (Yalamanchili et al., 1997 ), poly(A)-binding protein (PABP) (Joachims et al., 1999 ; Kerekatte et al., 1999 ), dystrophin (Badorff et al., 1999 ) and the viral protein 3CDpro (Lee & Wimmer, 1988 ). With the exception of eIF-4G, the effects of the 2Apro trans-cleavage activity on cellular proteins are not clear. Cleavage of eIF-4G, and possible also of PABP, contributes to the shut-off of host cell protein synthesis (Joachims et al., 1999 ; Kräusslich et al., 1987 ). Translation is thus switched from cap-dependent cellular translation to cap-independent viral translation. Shut-off of host cell protein synthesis can also result in a process of programmed cell death (Barco et al., 2000 ; Goldstaub et al., 2000 ). The precise function of 2Apro in the cleavage of eIF-4G is presently debated. Proteinase 2Apro is definitely responsible for the direct cleavage of cellular proteins (Haghighat et al., 1996 ; Lamphear et al., 1993 ; Liebig et al., 1993 ), but evidence for activation of cellular activities has also been presented in eIF-4G processing (Bovee et al., 1998a , b ). The cleavage of dystrophin of mouse heart muscle cells by coxsackievirus B3 2Apro has been suggested to be the mechanism of dilated cardiomyopathy (Wessely et al., 1998 ). The 2Apro cleavage products of 3CDpro (3C' and 3D') are not essential for poliovirus replication (Lee & Wimmer, 1988 ).



(35K):

Fig. 1. Genomic organization and sequences of poliovirus and derivatives. (a) Amino acid alignments of poliovirus 2Apro and HRV2 2Apro. Identical residues are in white lettering on black. Missing amino acids are indicated by dots. Amino acid positions are given at the end of each line. This alignment is in accordance with that of Palmenberg (1989) . (b) Genotypes of the wild-type and chimeric full-length and replicon poliovirus genomic RNAs, containing different C-terminal domains of PV1(M) and HRV2 2Apro sequences. Non-initiating AUGs are denoted by stars. P1 is the precursor of the structural proteins; P2 and P3 are the precursors of the non-structural proteins. 1A, 1B, 1C and 1D represent capsid proteins VP4, VP2, VP3 and VP1. In the chimeric PV1(M) replicon genomes, the P1 region was replaced by the luciferase gene (shaded) and the sequence of the C-terminal domain of 2Apro was varied as indicated. The modified C-terminal domains of PV1(M) and HRV2 2Apro are enlarged. PV1(M) 2Apro and HRV2 2Apro are depicted as open and filled boxes, respectively. In the Cm4 construct, the wobble positions of the P1P5 residues of poliovirus 2Apro were mutated. C-5 is a deletion of the P2P6 positions of PV1(M) 2Apro. R2A C+4 means that P2P5 of PV1(M) 2Apro were added to the C-terminal region of HRV2 2Apro. P2A and R2A represent the wild-type 2Apro sequences of PV1(M) and HRV2, respectively. The alanine residues marked with asterisks (*) indicate the P4 position favourable for 3Cpro/3CDpro cleavage relative to the QG scissile bond. Underlined regions show mutation sites. Black dots indicate missing amino acids relative to the PV1(M) wild-type sequence.

The crystal structure of human rhinovirus type 2 (HRV2) 2Apro has recently been elucidated and it revealed a unique fold that comprises a four-stranded β-sheet at the N-terminal domain and a six-stranded β-barrel containing a Zn2+ ion at the C-terminal domain (Petersen et al., 1999 ). Site-directed mutagenesis studies on some conserved residues of poliovirus 2Apro indicate that the substrate-binding domains are different for cis- and trans-cleavage activities (Ventoso & Carrasco, 1995 ; Yu et al., 1995 ). Both the poliovirus and rhinovirus 2Apro-encoding sequences have been expressed in yeast, which does not result in cleavage of the yeast homologue of eIF-4G. However, poliovirus 2Apro shuts off yeast cell RNA synthesis by the cleavage of a host transcription factor (Barco & Carrasco, 1995 ; Klump et al., 1996 ), a process distinct from the effect of poliovirus 2Apro in mammalian cells (Ventoso et al., 1998 ). Screening for peptide inhibitors of poliovirus 2Apro by the yeast two-hybrid system revealed a small peptide that inhibits poliovirus 2Apro cleavage activity (Ventoso et al., 1999 ).

Genetic data suggest that 2Apro is an important component for poliovirus RNA replication, but the function remains elusive (Ansardi et al., 1995 ; Molla et al., 1992 , 1993b ; ONeill & Racaniello, 1989 ; Yu et al., 1995 ). Although not endowed with strong hydrophobic sequences, poliovirus 2Apro was found in the detergent-insoluble membranes (Martin-Belmonte et al., 2000 ). Not surprisingly, the 2A proteins of hepatitis A virus and Theilers murine encephalomyelitis virus do not seem to be required for virus RNA replication (Harmon et al., 1995 ; Michiels et al., 1997 ), since these viral polypeptides bear no similarity to the entero- and rhinovirus 2Apro enzymes (Gromeier et al., 1999 ).

In our previous study, we have demonstrated that mutations at the P5 position of coxsackievirus B4 (CBV4) 2Apro promoted viral RNA replication of a chimeric poliovirus in which the cognate poliovirus 2Apro sequence was exchanged for that of CBV4. Chimeric poliovirus genomes with an HRV2 2Apro-encoding sequence did not produce viable virus, but showed both a low level of viral RNA replication (detected by RTPCR) and minor alternations in processing of P2 proteins (Lu et al., 1995b ). Amino acid alignments show that the C terminus of the HRV2 2Apro lacks four amino acids compared with the C terminus of 2Apro from poliovirus type 1 Mahoney [PV1(M)] (Fig. 1a). These four amino acids (EAME) correspond to an acidic domain preserved among enterovirus 2Apro polypeptides. In this paper, we have used site-directed mutagenesis to show that the conserved C terminus of PV1(M) 2Apro plays an important role in viral RNA replication.

Cells, viruses and plasmids.
HeLa R19 monolayers were maintained in Dulbeccos modified Eagles medium (DMEM) supplemented with 5% bovine calf serum (BCS) at 37 °C. OST7-1 is a mouse fibroblast cell line that expresses T7 RNA polymerase in the cytoplasm. OST7-1 cells were maintained in DMEM with 10% foetal bovine serum and G418 (Elroy-Stein & Moss, 1990 ). VV-P1 is a recombinant vaccinia virus containing poliovirus P1-encoding sequences, which was kindly provided to us by C. D. Morrow (Ansardi et al., 1991 ). pT7HRV2 is a full-length cDNA clone of HRV2, which was kindly provided to us by E. Kuechler and T. Skern (Skern et al., 1985 ). pT7PVM is a derivative of pT7XL, a full-length cDNA clone of PV1(M) (van der Werf et al., 1986 ). The plasmid pGL2 (containing the luciferase gene) was purchased from Promega. The plasmid pBS E2A contains the encephalomyocarditis virus (EMCV) IRES sequence followed by the poliovirus 2Apro-encoding sequences (Molla et al., 1993a ). pBS E2A(CH) is the same plasmid with H20A and C109A mutations in the poliovirus 2Apro-encoding sequence (Molla et al., 1993a ). pBS was purchased from Stratagene for construction of pBS E2A and pBS E2A(CH) plasmids.

Oligonucleotides.
The following oligonucleotide primers were used in this study: 5101 (5' CGGAGACGCCAAAAA 3'), 5120 (5' CTGAGCTCCAATTTGGACTTTCCGCC 3'), L2 (5' CCAAGGAGCTCACCAC 3'), 17 (5' GAGGCCTTGTTCGTAGGCATACAAGTC 3'), 25 (5' GAGGCCCTGCTCCATTGCCTCTTCTTCGTAGGCATACAAGTC 3'), 4578 (5' GCGGAGCTCACTACAGCTGGCCCC 3') and 5040 (5' GGAGGCCTTGTTCCATGGCTTCTTCTTCAGCACAAT 3').

DNA manipulations.
Escherichia coli strain DH5α was used for plasmid transformation and propagation. DNA cloning was accomplished by standard procedures (Sambrook et al., 1989 ). Cloning enzymes and reagents were purchased from New England Biolabs or Boehringer Mannheim. pT7PVM(S+E-) is a full-length poliovirus cDNA clone that contains two engineered restriction sites (EcoRI and SacI) downstream of an authentic AUG codon (Mueller & Wimmer, 1998 ). pT7S/2A/S is a full-length poliovirus cDNA clone with a SacI site at the junction of the P1- and 2A-encoding sequences (Lu et al., 1995b ). pT7PVM(S+E-) and pT7S/2A/S were digested by NheI and BglI and ligated to yield the cDNA plasmid pT7S+E-S/2A/S. PCR-amplified luciferase-encoding sequences (primers 5101 and 5120) were used to replace the P1 region between the EcoRI and SacI sites of pT7S+E-S/2A/S to generate a PV1(M) replicon plasmid PVM/Luc. The different 2Apro-encoding sequences were amplified by PCR and cloned into the SacI and StuI sites of the PVM/Luc plasmid. New chimeric poliovirus replicon clones contained wild-type HRV2 2Apro sequences (PVM/Luc R2A), the truncated C-terminal five amino acids (P2P6) of PV1(M) 2Apro (PVM/Luc C-5) (primers L2 and 17) and HRV2 2Apro with four amino acids (P2P5) from the C terminus of PV1(M) 2Apro (PVM/Luc R2A C+4) (primers 4578 and 5040). To determine whether the C-terminal sequences of 2Apro act at the level of RNA or protein, mutations (P1P4) were made at every wobble position, generating silent mutations (PVM/Luc Cm4) (primers L2 and 25). At the same time, the various modified 2Apro sequences were introduced into full-length pT7S/2A/S cDNA clones. The new chimeric PV1(M) full-length clones were named PVM Cm4, PVM C-5 and PVM R2A C+4. PVM R2A is identical to PV/HRV2-2A (Lu et al., 1995b ). The details of the C-terminal modifications are shown in Fig. 1(b).

In vitro transcription, translation and Western blotting.
In order to produce the RNA transcripts in vitro, 0·7 µg of each full-length and replicon cDNA plasmid was linearized by PvuI downstream from the viral genome (Alexander et al., 1994 ; Lu et al., 1995a , b ). RNA transcripts were synthesized from the linear template DNA by use of T7 RNA polymerase in 100 µl of an in vitro transcription reaction mixture. RNA transcripts were purified by phenolchloroform extraction and ethanol precipitation. For each RNA transcript, the optimal RNA concentration was determined for in vitro translation in HeLa cell extracts as described by Molla et al. (1991) . Translation reactions were carried out at 34 °C for 7 h in the presence of 10 µCi of [35S]-translabel (Amersham). SDS12·5% polyacrylamide gels were used to analyse the translation products (Laemmli, 1970 ). The intensity of the VP3 band of each poliovirus full-length RNA translation reaction was measured by using the Un-Scan It program (Silk Scientific Company). Translation efficiency was calculated as described previously (Lu et al., 1995b ). Briefly, the translation efficiency of PVM R2A RNA was taken as 100%. The translation efficiency of each chimeric RNA was calculated from the relative intensity of the VP3 band compared with the intensity of the VP3 band from PVM R2A RNA.

Western blotting was used to detect degradation products of eIF-4G. Briefly, in vitro translation reactions were carried out in 62·5 µl of total translation reactions for each full-length RNA transcript at 30 °C for 24 h. TCA precipitation (8%) was used to reduce the sample volume. The samples were analysed on 7·5% SDSPAGE and transferred overnight at 4 °C to a nitrocellulose membrane (Schleicher & Schuell). The nitrocellulose membrane was incubated at room temperature for 2 h with a rabbit anti-eIF-4G primary antibody (Aldabe et al., 1995 ) and then incubated at room temperature for an additional 2 h with HRP-conjugated goat anti-rabbit antibodies (Cappel) as secondary antibodies. Degradation products of eIF-4G were detected by ECL (Amersham) followed by exposure of the membrane to Kodak X-ray film for 5 min.

RNA transfections.
To perform the RNA transfection, HeLa R19 cells cultured on a 35 mm plate were incubated with 510 µg of RNA transcripts in the presence of 0·5 mg/ml DEAEdextran in HeBSS buffer (42 mM HEPES, 270 mM NaCl, 9·6 mM KCl and 1·4 mM Na2HPO4) at room temperature for 30 min. The transfection mixtures were removed and the cells were cultured in 2 ml DMEM2% BCS at 37 °C (Sambrook et al., 1989 ). HeLa cell monolayers were harvested at different time-points.

Trans-rescue assay.
The trans-rescue assay was performed as described previously (Hambidge & Sarnow, 1992 ). Briefly, the DNA transfection was performed with calcium phosphate by incubating 1 µg of the PV1(M) replicon cDNA plasmids and 10 µg of the pBS, pBS E2A and pBS E2A(CH) cDNA plasmids on OST7-1 monolayers. Glycerol shock was carried out at 6 h after addition of the DNA/calcium phosphate precipitate. Transfected OST7-1 cells were incubated at 37 °C with 5% CO2 for another 12 h (Ausubel et al., 1994 ). The harvested OST7-1 cells were resuspended in PBS for luciferase assays as described below.

Encapsidation assay.
Encapsidation assays were performed according to Ansardi et al. (1991 , 1993 ). The PV1(M) replicon RNA transcripts were transfected into HeLa cell monolayers 2 h after VV-P1 infection. HeLa cell monolayers were cultured in 1·5 ml of DMEM2% BCS at 37 °C for 24 h. HeLa cell lysates were obtained by freezethawing three times. Aliquots of 250 µl of the cell lysates were inoculated onto another set of fresh HeLa cell monolayers, which were harvested at 0, 2, 4, 6, 8 and 10 h post-infection. The cell lysates were analysed for luciferase activity.

Luciferase assay.
After transfections of RNA or DNA containing the luciferase gene, HeLa cell or mouse cell monolayers were harvested by washing three times with PBS and resuspending the cell pellet in 100 µl PBS (Ausubel et al., 1994 ). The cells were lysed immediately by freezethawing three times. Twenty µl of cell lysate was examined by adding 100 µl luciferin to measure luciferase activity in a luminometer (Promega). The protein concentration (125 µg) of each cell lysate was determined by a Micro BCA protein assay (Pierce) as an internal control to normalize the luciferase activities (Ventoso & Carrasco, 1995 ).

Plaque assays.
Plaque assays on HeLa cell monolayers were performed as described previously (Lu et al., 1995b ). The virus was diluted in PBS and placed on the cells. The mixture was incubated for 30 min at room temperature to allow the virus to absorb to the cells and then 3 ml of 1x DMEM plus 10% calf serum (Gibco-BRL) plus 1% agar was added to each plate. After incubation for 2 days, the agar overlays were removed and the cells were stained with crystal violet.

In vivo phenotypes of PV1(M) and HRV2 2Apro C-terminal domains
On the basis of the observed differences between the 2Apro sequences of poliovirus and HRV2 in the C-terminal region (Fig. 1a), we have constructed four virus variants, of which two are chimeras (Fig. 1b). In P2A Cm4, only the nucleotide sequence encoding the C terminus was changed (silent mutation; see below). In P2A C-5, five amino acids have been deleted and an alanine residue in the P4 position of the cleavage site (indicated by an asterisk) was retained to ensure efficient cleavage by 3Cpro/3CDpro. The chimeric constructs contained either wild-type HRV2 2Apro lacking the EAME motif (R2A) or a derivative thereof, in which the EAME was added (R2A C+4). To determine the in vivo phenotype for the C-terminal domains of the PV1(M) and HRV2 2Apro polypeptides, RNA transcripts of full-length PV1(M) and its derivatives (PVM Cm4, PVM C-5, PVM R2A C+4, PVM R2A) were transfected into HeLa cell monolayers and the plates were incubated at 37 °C for 2 days. The cell lysates were harvested and plaque assays were performed. PV1(M) and PV1(M) Cm4 constructs produced progeny virus at 2·4x108 and 2·1x108 p.f.u./ml, respectively. No virus was detected from transfections with PV1(M) C-5, PV1(M) R2A C+4 or PV1(M) R2A RNA transcripts, even after prolonged incubation and serial passages of these cell lysates.

Translation efficiencies and proteolytic activities of viral RNAs with modifications in the 2Apro C-terminal domain
To investigate the pronounced effect of the C-terminal domain of 2Apro on virus proliferation, we have analysed the modified viral genomes by several methods. Firstly, we determined the efficiency with which the RNA could direct faithful protein synthesis. Translation of the RNAs was performed in HeLa cell extracts (Molla et al., 1991 ). Chimeric PV1(M) full-length RNA transcripts with modified 2Apro C termini translated nearly as well as those of wild-type 2Apro (Fig. 2a; lanes 48). This was determined by measuring the VP3 intensity and calculating the translation efficiency for each translation reaction as described in Methods. The translation efficiency of each chimeric PV1(M) RNA is given at the bottom of Fig. 2(a). With PVM Cm4, neither the relative mobility of 2Apro nor the translation efficiency was altered, as expected (Fig. 2a; lanes 4 and 5). PVM C-5 RNA transcripts, in which five amino acids had been deleted, translated as well as PV1(M) and PVM Cm4 RNA transcripts (Fig. 2a; compare lanes 4 and 5 with lane 6). The relative mobility of 2Apro in PVM C-5 increased, however (lane 6). On the other hand, addition of four amino acids to HR2 2Apro (PVM R2A C+4) decreased the relative mobility of HRV2 2Apro and the protein migrated to the same position as PV1(M) 2Apro (lane 7). The translation efficiency of PVM R2A C+4, however, was reduced slightly (Fig. 2a, lane 4 and 7). The cleavage patterns seen in lanes 6, 7 and 8 clearly reveal a few aberrant cleavage products in addition to all the major viral polypeptides.



(52K):

Fig. 2. Cell-free translation and eIF-4G cleavage analysis. (a) In vitro translation of PV1(M) full-length RNA transcripts with or without modified 2Apro sequences. The optimal RNA concentration for each translation was used as follows: PVM RNA transcript (16 µg/ml); PVM Cm4 RNA transcript (16 µg/ml); PVM C-5 RNA transcript (48 µg/ml); PVM R2A C+4 RNA transcript (48 µg/ml) and PVM R2A RNA transcript (64 µg/ml). Relative translation efficiency for each RNA transcript was calculated by measuring the intensity of the VP3 band as described in Methods and is given at the bottom of the autoradiogram. Lane 1, PV1(M) proteins from an infected HeLa cell extract. (b) In vitro translation of PV1(M) replicon RNA transcripts containing the luciferase gene. The optimal RNA concentration for each RNA transcript was used, as indicated above. (c) Western blot analysis of degradation products of eIF-4G. PV1(M) full-length RNA transcripts were translated in HeLa cell extract. Rabbit anti-eIF-4G antibodies and goat anti-rabbit antibodies were used to detect eIF-4G-related products (see Methods).

To examine the cis-cleavage activity of PV1(M) and HRV2 2Apro proteinases in chimeric PV1(M) replicon genomes, PV1(M) replicon RNA transcripts in which the capsid precursor P1 was replaced by luciferase were translated in HeLa cell extracts. No P1 precursors or processed coat proteins were observed in these translations (Fig. 2b; lanes 48), as expected. Bands corresponding to the luciferase protein and non-structural proteins were found to be present, however (Fig. 2b; lanes 48). The migration positions of each modified 2Apro in PV1(M) replicon genomes were altered, as has been seen in Fig. 2(a) with PV1(M) full-length genomes. These results suggest strongly that substitution of the P1 region with the luciferase gene and modifications of PV1(M) and HRV2 2Apro C-terminal domains did not affect the cis-cleavage activity of PV1(M) and HRV2 2Apro significantly, if at all, in the chimeric PV1(M) replicon genomes. This result is in agreement with our previous observation that 2Apro cis-cleavage is not affected by variations of P1 residues (Hellen et al., 1992 ).

The endogenous cellular protein eIF-4G was used to examine the trans-cleavage activity of PV1(M) and HRV2 2Apro proteinases with modified C termini by Western blotting. Intact eIF-4G protein is shown in the no-RNA control (Fig. 2c; lane 1). Completely degraded eIF-4G products were detected in all translation reactions (Fig. 2c; lanes 26). No differences in eIF-4G cleavage were observed between the wild-type 2Apro (Fig. 2c; lanes 2 and 6) and modified 2Apro (Fig. 2c; lanes 35). Thus, the C-terminal modifications did not affect the proteolytic activity in trans of PV1(M) and HRV2 2Apro proteinases.

The function of the C-terminal domain of PV1(M) 2Apro in viral RNA replication
It has been reported that the addition of a foreign gene (Alexander et al., 1994 ) or the replacement of the poliovirus P1 region by a reporter gene does not affect poliovirus replication, including viral protein processing, RNA synthesis or encapsidation in trans (Porter et al., 1998 ; for references see Mueller & Wimmer, 2000 ). Our previous results showed that a chimeric PV1(M) genome with HRV2 2Apro did not produce virus but suggested very low levels of viral RNA replication (Lu et al., 1995b ). Since the pattern of protein synthesis and proteolysis in vitro showed production of all proteins involved in RNA synthesis, we decided to investigate whether the 2Apro C termini have a function in RNA replication. To monitor replication, we constructed PV1(M) replicon genomes containing the luciferase gene. After transfection into HeLa cells, the luciferase activity was measured. The transfected HeLa cell monolayers were incubated at 37 °C and cells were lysed at 0, 4, 8, 12 and 24 h post-transfection. Luciferase activity generated by PVM/Luc and PVM/Luc Cm4 RNA transcripts was detected at 4 h and it reached a peak at 8 h post-transfection (Fig. 3a; open squares). At this time-point, the luciferase activity produced by PVM/Luc R2A was nearly 1000-fold lower than that of PVM/Luc, while a detectable signal emerged only 12 h post-transfection (closed circles). Remarkably, addition of the four amino acids to the C terminus of HRV2 2Apro in PVM/Luc R2A C+4 genomes increased the expression and led to a signal at 8 h post-transfection that was about 100-fold greater than that of PVM/Luc R2A (open circles) (Fig. 3a) and only 10-fold lower than that of PVM/Luc. The luciferase activity of PVM R2A C+4 reached its peak at 12 h post-transfection. No luciferase activity above background could be detected with PVM/Luc C-5 RNA.



(24K):

Fig. 3. Replication of different viral RNA constructs in HeLa cells. (a) Transfections of chimeric PV1(M) replicon RNAs. HeLa cell monolayers were transfected with 5 µg of each replicon RNA. Cell lysates were collected at 0, 4, 8, 12 and 24 h post-transfection and the luciferase activity for each cell lysate was determined. Aliquots of 125 µg total protein from each cell lysate were used as internal controls to normalize luciferase activity. (b) Separation of 2Apro functions. The transfection experiments were repeated as above, but in the presence of 2 mM guanidineHCl.

Expression of luciferase in these transfected cells could conceivably result solely from translation of the incoming RNAs, independent of viral RNA replication. To separate translation from viral RNA replication, the experiments were repeated in the presence of 2 mM guanidineHCl, an inhibitor of poliovirus RNA replication, but not of luciferase activity (Alexander et al., 1994 ). No luciferase activity was detected above the background level in cell lysates transfected with these RNA transcripts over a period of 24 h. This observation suggests strongly that the phenotypes of luciferase activity result from altered viral RNA replication and not from differences in viral RNA translation (Fig. 3b).

Trans-rescue of the C-terminally modified 2Apro with wild-type and mutated poliovirus 2Apro
In order to test whether the C-terminal functions of 2Apro could be rescued in trans, we pursued a trans-rescue assay in a mouse fibroblast cell line, OST7-1, that expresses phage T7 RNA polymerase in the cytoplasm. T7 RNA polymerase can be used to transcribe RNA from transfected cDNA plasmids containing the T7 promoter. Since transcription in all of our cDNA plasmids is driven by the T7 promoter (van der Werf et al., 1986 ), we were able to co-transfect PV1(M) replicon cDNA plasmids, together with expression plasmids for PV1(M) 2Apro cDNA [pBS E2A or pBS E2A(CH)], into OST7-1 cells and assay for complementation by monitoring luciferase activity. Results of such co-transfection experiments are shown in Fig. 4. Transfection with vectors containing no luciferase gene gave background signals (Fig. 4; group A, bars 25). Co-transfection of different poliovirus-expression vectors is presented in groups as follows: (B) wild-type PVM/Luc, (C) PVM/Luc Cm4; (D) PVM/Luc C-5; (E) PVM R2A C+4 and (F) PVM/Luc R2A, involving either pBS or 2A-expressing plasmids, as indicated. If guanidineHCl was omitted at the beginning of co-transfection, all plasmids, with the exception of PVM/Luc C-5 (Fig. 4; group D, bar 14), yielded strong luciferase signals (bars 6, 10, 18 and 22), which can be assumed to be the result of mRNA production by transcription and replication. This is supported by the observation that guanidineHCl reduced the signal obtained in these cells to the level of PVM/Luc C-5 (compare bars 7, 11, 19 and 23 with bar 15). Co-transfection with a plasmid expressing 2Apro under the control of the EMCV IRES stimulated the luciferase signal (see bars 8, 12, 16, 20 and 24), although the increase was barely detectable in group F (bar 24). However, the 12·7-fold increase (bar 16) is highly significant and required expression of active proteinase, since expression of inactive proteinase had no effect on the luciferase signal (bars 9, 13, 17, 21 and 25).



(57K):

Fig. 4. Trans-rescue assay of PV1(M) replicons with wild-type and mutated 2A sequences. P/L, PVM/Luc. E2A is plasmid pBS E2A expressing poliovirus 2Apro under the control of the EMCV IRES and E2A CH is the same plasmid except that two essential amino acids of the catalytic triad of 2Apro have been mutated (H20A and C109A in pBS E2A CH). pBS is a control plasmid. GuanidineHCl (GHCl) was added at the onset of transfection to a concentration of 2 mM.

Is the C-terminal domain of PV1(M) 2Apro involved in virus encapsidation?
The P1 regions of PV1(M) and HRV2 encode the P1 precursors, which are processed by viral proteinases (2Apro and 3CDpro) into capsid proteins VP0, VP3 and VP1 (Kitamura et al., 1981 ; Wimmer et al., 1993 ) during maturation of the procapsid. An unknown mechanism induces VP0 cleavage and produces VP2 and VP4. Sixty copies of each of these four capsid proteins, VP1, VP2, VP3 and VP4, then form an icosahedral virus particle (Wimmer et al., 1993 ). The encapsidation in poliovirus-infected cells is very specific in packaging the viral genomic RNA only. It is assumed that the encapsidation signal is localized in the viral RNA genome. However, available evidence suggests a strong coupling between RNA replication and RNA encapsidation (Molla et al., 1991 ; Nugent et al., 1999 ). If so, it may be possible to establish a correlation between the replication of the poliovirus/HRV2 2A chimera and encapsidation in trans. Accordingly, PV1(M) replicons and VV-P1 vaccinia virus were used in our studies. In these trans-encapsidation studies, the poliovirus capsid precursor P1 is provided by the vaccinia virus expression system (Porter et al., 1998 ). The P1 precursor is then recruited and processed by proteinase from heterologous replicating poliovirus genomes. We assayed for trans encapsidation by analysing luciferase activity after the second round of infection. The chimeric PV1(M) genomes PVM/Luc, PVM/Luc Cm4 and PVM/Luc R2A C+4 could be packaged in trans by P1 precursors provided by vaccinia virus expression, as indicated by the level of luciferase activity in cell lysates. In contrast, PVM/Luc R2A and PVM/Luc C-5 RNAs were not packaged, since no luciferase activity higher than background was detected in secondary infections (Fig. 5).



(18K):

Fig. 5. Encapsidation assay of PV1(M) replicon RNA transcripts. The chimeric PV1(M) replicon RNA transcripts were transfected into HeLa cells after infection with VV-P1. Cell lysates were lysed after overnight incubation at 37 °C. Fresh HeLa cell monolayers were infected with equal amounts of the cell lysates and collected at different time-points. The luciferase activity of each cell lysate was analysed by standard methods.
Genetic data and amino acid alignments indicate that PV1(M) and HRV2 2Apro belong to a group of small cysteine proteinases (Bazan & Fletterick, 1988 ). These enzymes are specified by a cysteine forming the catalytic triad together with aspartate and histidine in both viral 2Apro proteinases (Hellen et al., 1991 ; Petersen et al., 1999 ; Seipelt et al., 1999 ; Sommergruber et al., 1989 ). HRV2 2Apro was found to contain a Zn2+ ion (Sommergruber et al., 1994 ), the function of which is to stabilize the structure of the protein (Petersen et al., 1999 ). Although not proven for poliovirus 2Apro, this enzyme may fold in a fashion similar to HRV2 2Apro and it may also contain a Zn2+ ion. Genetic studies have demonstrated that PV1(M) 2Apro has multiple functions in virus proliferation (protein processing, viral RNA replication, translation activation) (Hambidge & Sarnow, 1992 ; Molla et al., 1993b ; Toyoda et al., 1986 ; Yu et al., 1995 ). It is not yet known whether the multiple functions of 2Apro are due to independent functional domains or to domains involved in proteolysis. There are no biochemical data available that indicate a direct role for 2Apro in viral genome replication. Here, we report studies to dissect the function of the C termini of PV1(M) and HRV2 2Apro in the context of chimeric PV1(M) full-length and replicon genomes.

In our previous studies, we showed that 2Apro of CBV4, another enterovirus, could replace the poliovirus 2Apro in a chimera. However, mutations in the C terminus of CBV4 2Apro were necessary to yield a chimera with wild-type replication properties (Lu et al., 1995b ). These mutations all mapped to precisely the region that is missing in HRV2 2Apro. Thus, we both modified this region in poliovirus 2Apro and added four amino acids to HRV2 2Apro to create an enterovirus-like 2Apro. In all constructs, the P1P2 junction of the PV1(M) polyprotein is LtTY*GfGh, where capital letters represent residues conserved among polioviruses (Hellen et al., 1992 ); ITTA*GPSD is the corresponding sequence in HRV2 (Skern et al., 1991 ). To facilitate 3CDpro cleavage activity at the 2A2B junction, the P4 position for each C-terminal modification was alanine, a residue greatly preferred by poliovirus 3CDpro cleavage activity (Fig. 1b) (Lawson & Semler, 1990 ).

To study the C-terminal functions of PV1(M) and HRV2 2Apro in terms of their proteolytic activities, the RNA transcripts were translated in HeLa cell extracts. Even when five amino acids (P2P6) were deleted at the C-terminal domain of PV1(M) 2Apro (PVM C-5), neither translation efficiency nor the cis- and trans-cleavage activities was affected significantly (Fig. 2a, lanes 4 and 6; Fig. 2c, lanes 2 and 4). Deletion of a further nine amino acids at the C terminus of poliovirus 2Apro abolished the cis-cleavage activity (Toyoda et al., 1986 ). Insertions at the N and C termini also abolished cis-cleavage activity of PV1(M) 2Apro (Bernstein et al., 1986 ; Kräusslich et al., 1987 ). On the other hand, a C-terminal deletion of up to six amino acids of HRV2 2Apro did not interfere with its cis-cleavage activity, whereas a deletion of up to 10 amino acids inactivated the enzyme (Sommergruber et al., 1989 ). Translation with chimeric PVM R2A C+4 and PVM R2A genomes showed that all expected proteins were produced by proteolytic processing (Fig. 2a; lanes 7 and 8). Importantly, none of the 2A modifications at the C terminus impaired the enzymes ability to cleave eIF-4G (Fig. 2c; lanes 5 and 6).

Whereas the C-terminal deletions caused little if any loss of cleavage activity for either PV1(M) or HRV2 2Apro, severe replication phenotypes were observed. We conclude that the C-terminal domain up to amino acid 6 is not critical for proteolytic activities of poliovirus 2Apro, but this conclusion is based solely on in vitro translation assays. A correlation between the structure and the function of poliovirus 2Apro remains to be done.

The involvement of PV1(M) 2Apro in viral RNA replication was suggested by Molla et al. (1993b ) from experiments using dicistronic poliovirus genomes. While the insertion of an EMCV IRES at the P1P2 junction of the poliovirus genome did not interfere with either proteolytic processing or genome replication, deletion of 2Apro in these constructs and even mutation of C109A abolished RNA synthesis (Molla et al., 1992 , 1993b ). Yu and colleagues (Yu et al., 1995 ; Yu & Lloyd, 1991 ) have come to the same conclusion, based on mutations introduced into the catalytic triad or other conserved residues of the 2Apro molecule. So far, two features of PV1(M) 2Apro seem to be important for this protein to promote RNA replication: the identity of C109 of the catalytic triad and the presence of four amino acid residues (P2P5) at the C terminus. Whether the importance of both of these features relates to a specific structure of 2Apro remains to be seen. It is possible that a cluster of negatively charged amino acids involving the sequence EAME may play a role in poliovirus RNA replication. This would explain why the addition of the four amino acids EAME to HRV2 2Apro greatly improved replication of the chimeric replicon PVM/Luc R2A C+4 (Fig. 3a; open circles). A poliovirus genomic chimera in which the cognate 2Apro was replaced with R2A C+4 did not yield viruses, however (data not shown). These observations led originally to our speculation that the nucleotide sequence encoding 2Apro may be involved in encapsidation. A change of four nucleotides of the EAME-encoding nucleotide sequence at the C terminus (2A Cm4) did not yield a replication phenotype, however. The high yield at which PVM/Luc R2A C+4 was encapsidated in trans (Fig. 5, open circles) must, therefore, relate to the ability of PVM/Luc R2A C+4 to replicate, rather than to a specific encapsidation signal. This leaves unexplained the surprising observation that the R2A C+4 RNA does not form virions. Experiments to find escape mutants have failed, but they have not yet involved long-term, blind passages.

Encapsidation signals residing in virus genomes have been identified for several RNA viruses, for example retroviruses (Clever et al., 1995 ; Mansky et al., 1995 ) and a togavirus (Weiss et al., 1989 ). Encapsidation of poliovirus is specific in that the virus particle only contains VPg-linked, positive-sense poliovirus RNA. Thus, the encapsidation process discriminates against virus mRNA, lacking VPg, and minus-sense RNA. An encapsidation signal in poliovirus plus-stranded RNA has not yet been discovered, however. Numerous studies have led to the exclusion of possible signals, such as the IRES element and regions in the coding sequences of P1 and VPg, or VPg itself (Barclay et al., 1998 ; Gromeier et al., 1996 ; Lu & Wimmer, 1996 ; Porter et al., 1998 ; Reuer et al., 1990 ). Studies using the cell-free, de novo synthesis of poliovirus (Molla et al., 1991 ) or genetic analyses of replicons (Nugent et al., 1999 ) have suggested that genome replication is necessary for encapsidation. The data presented here support these previous conclusions. The mechanism by which the plus-stranded viral RNA is selected for encapsidation remains elusive, however. Another less-likely possibility is that an intact, virus-specific 2Apro molecule is involved directly in virus particle formation, since non-structural proteins have been discovered in virus particles of foot-and-mouth disease virus and poliovirus (Newman et al., 1994 ).

Co-transfection of plasmids expressing luciferase-containing replicons with plasmids expressing poliovirus 2Apro resulted in all cases in an increased signal of the reporter gene products (Fig. 4). Such an effect on translation efficiency has been observed before (Hambidge & Sarnow, 1992 ) and may be due to a specific but as yet undefined interaction of the proteinase with the poliovirus IRES element (Macadam et al., 1994 ; Rowe et al., 2000 ) combined with a more rapid degradation of eIF-4G. In agreement with this, co-expression of a mutant enzyme (2Apro CH) had no effect on the luciferase signal. However, the increase in the luciferase signal of the replication-incompetent replicon PVM/Luc C-5 (Fig. 4; bar 16) may reflect trans-activation of RNA replication, since the IRES sequence in this replicon is identical to that in the others.

The 2Apro enzyme of poliovirus has multiple functions, for which stringent structural parameters may be essential. The integrity of the catalytic triad (particularly of C109) appears to play an important role in all functions. We have identified a new structural determinant for genome replication, the C-terminal five amino acids.

We would like to thank Dr C. D. Morrow, who provided the VV-P1 vaccinia virus, Dr B. Moss, who provided the mouse fibroblast cell line OST7-1, Dr L. Carrasco, who provided anti-eIF-4G antibody, and Drs E. Kuechler and T. Skern, who provided HRV2 cDNA for our studies. We are indebted to Dr A. Paul for her suggestions in preparing this manuscript. This work was supported by National Institute of Health grants R37-AI 15122 and R01-AI 32100.

References

Agol, V. I., Paul, A. V. & Wimmer, E.(1999). Paradoxes of the replication of picornaviral genomes. Virus Research 62, 129-147.[Medline]

Aldabe, R., Feduchi, E., Novoa, I. & Carrasco, L.(1995). Efficient cleavage of p220 by poliovirus 2Apro expression in mammalian cells: effects on vaccinia virus. Biochemical and Biophysical Research Communications 215, 928-936.[Medline]

Alexander, L., Lu, H. H. & Wimmer, E.(1994). Polioviruses containing picornavirus type 1 and/or type 2 internal ribosomal entry site elements: genetic hybrids and the expression of a foreign gene. Proceedings of the National Academy of Sciences, USA 91, 1406-1410.[Abstract/Free Full Text]

Ansardi, D. C., Porter, D. C. & Morrow, C. D.(1991). Coinfection with recombinant vaccinia viruses expressing poliovirus P1 and P3 proteins results in polyprotein processing and formation of empty capsid structures. Journal of Virology 65, 2088-2092.[Abstract/Free Full Text]

Ansardi, D. C., Porter, D. C. & Morrow, C. D.(1993). Complementation of a poliovirus defective genome by a recombinant vaccinia virus which provides poliovirus P1 capsid precursor in trans. Journal of Virology 67, 3684-3690.[Abstract/Free Full Text]

Ansardi, D. C., Pal-Ghosh, R., Porter, D. & Morrow, C. D.(1995). Encapsidation and serial passage of a poliovirus replicon which expresses an inactive 2A proteinase. Journal of Virology 69, 1359-1366.[Abstract]

Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A. & Struhl, K. (editors) (1994). Current Protocols in Molecular Biology. New York: John Wiley.

Badorff, C., Lee, G. H., Lamphear, B. J., Martone, M. E., Campbell, K. P., Rhoads, R. E. & Knowlton, K. U.(1999). Enteroviral protease 2A cleaves dystrophin: evidence of cytoskeletal disruption in an acquired cardiomyopathy. Nature Medicine 5, 320-326.[Medline]

Barclay, W., Li, Q., Hutchinson, G., Moon, D., Richardson, A., Percy, N., Almond, J. W. & Evans, D. J.(1998). Encapsidation studies of poliovirus subgenomic replicons. Journal of General Virology 79, 1725-1734.[Abstract]

Barco, A. & Carrasco, L.(1995). Poliovirus 2Apro expression inhibits growth of yeast cells. FEBS Letters 371, 4-8.[Medline]

Barco, A., Feduchi, E. & Carrasco, L.(2000). A stable HeLa cell line that inducibly expresses poliovirus 2Apro: effects on cellular and viral gene expression. Journal of Virology 74, 2383-2392.[Abstract/Free Full Text]

Bazan, J. F. & Fletterick, R. J.(1988). Viral cysteine proteases are homologous to the trypsin-like family of serine proteases: structural and functional implications. Proceedings of the National Academy of Sciences, USA 85, 7872-7876.[Abstract/Free Full Text]

Bernstein, H. D., Sarnow, P. & Baltimore, D.(1986). Genetic complementation among poliovirus mutants derived from an infectious cDNA clone. Journal of Virology 60, 1040-1049.[Abstract/Free Full Text]

Bovee, M. L., Marissen, W. E., Zamora, M. & Lloyd, R. E.(1998a). The predominant elF4G-specific cleavage activity in poliovirus-infected HeLa cells is distinct from 2A protease. Virology 245, 229-240.[Medline]

Bovee, M. L., Lamphear, B. J., Rhoads, R. E. & Lloyd, R. E.(1998b). Direct cleavage of elF4G by poliovirus 2A protease is inefficient in vitro. Virology 245, 241-249.[Medline]

Clever, J., Sassetti, C. & Parslow, T. G.(1995). RNA secondary structure and binding sites for gag gene products in the 5' packaging signal of human immunodeficiency virus type 1. Journal of Virology 69, 2101-2109.[Abstract]

Elroy-Stein, O. & Moss, B.(1990). Cytoplasmic expression system based on constitutive synthesis of bacteriophage T7 RNA polymerase in mammalian cells. Proceedings of the National Academy of Sciences, USA 87, 6743-6747.[Abstract/Free Full Text]

Goldstaub, D., Gradi, A., Bercovitch, Z., Grosmann, Z., Nophar, Y., Luria, S., Sonenberg, N. & Kahana, C.(2000). Poliovirus 2A protease induces apoptotic cell death. Molecular and Cellular Biology 20, 1271-1277.[Abstract/Free Full Text]

Gromeier, M., Alexander, L. & Wimmer, E.(1996). Internal ribosomal entry site substitution eliminates neurovirulence in intergeneric poliovirus recombinants. Proceedings of the National Academy of Sciences, USA 93, 2370-2375.[Abstract/Free Full Text]

Gromeier, M., Wimmer, E. & Gorbalenya, A. E.(1999). Genetics, pathogenesis, and evolution of picornaviruses. In Origin and Evolution of Viruses , pp. 287-343. Edited by E. Domingo, R. G. Webster & J. J. Holland. New York:Academic Press.

Haghighat, A., Svitkin, Y., Novoa, I., Kuechler, E., Skern, T. & Sonenberg, N.(1996). The eIF4G-eIF4E complex is the target for direct cleavage by the rhinovirus 2A proteinase. Journal of Virology 70, 8444-8450.[Abstract]

Hambidge, S. J. & Sarnow, P.(1992). Translational enhancement of the poliovirus 5' noncoding region mediated by virus-encoded polypeptide 2A. Proceedings of the National Academy of Sciences, USA 89, 10272-10276.[Abstract/Free Full Text]

Harmon, S. A., Emerson, S. U., Huang, Y. K., Summers, D. F. & Ehrenfeld, E.(1995). Hepatitis A viruses with deletions in the 2A gene are infectious in cultured cells and marmosets. Journal of Virology 69, 5576-5581.[Abstract]

Hellen, C. U. T., Fäcke, M., Kräusslich, H.-G., Lee, C.-K. & Wimmer, E.(1991). Characterization of poliovirus 2A proteinase by mutational analysis: residues required for autocatalytic activity are essential for induction of cleavage of eukaryotic initiation factor 4F polypeptide p220. Journal of Virology 65, 4226-4231.[Abstract/Free Full Text]

Hellen, C. U., Lee, C. K. & Wimmer, E.(1992). Determinants of substrate recognition by poliovirus 2A proteinase. Journal of Virology 66, 3330-3338.[Abstract/Free Full Text]

Joachims, M., Van Breugel, P. C. & Lloyd, R. E.(1999). Cleavage of poly(A)-binding protein by enterovirus proteases concurrent with inhibition of translation in vitro. Journal of Virology 73, 718-727.[Abstract/Free Full Text]

Kerekatte, V., Keiper, B. D., Badorff, C., Cai, A., Knowlton, K. U. & Rhoads, R. E.(1999). Cleavage of poly(A)-binding protein by coxsackievirus 2A protease in vitro and in vivo: another mechanism for host protein synthesis shutoff? Journal of Virology 73, 709-717.[Abstract/Free Full Text]

Kitamura, N., Adler, C. J., Rothberg, P. G., Martinko, J., Nathenson, S. G. & Wimmer, E.(1980). The genome-linked protein of picornaviruses. Vll. Genetic mapping of poliovirus VPg by protein and RNA sequence studies. Cell 21, 295-302.[Medline]

Kitamura, N., Semler, B. L., Rothberg, P. G., Larsen, G. R., Adler, C. J., Dorner, A. J., Emini, E. A., Hanecak, R., Lee, J. J., van der Werf, S., Anderson, C. W. & Wimmer, E.(1981). Primary structure, gene organization and polypeptide expression of poliovirus RNA. Nature 291, 547-553.[Medline]

Klump, H., Auer, H., Liebig, H. D., Kuechler, E. & Skern, T.(1996). Proteolytically active 2A proteinase of human rhinovirus 2 is toxic for Saccharomyces cerevisiae but does not cleave the homologues of eIF-4 gamma in vivo or in vitro. Virology 220, 109-118.[Medline]

Kräusslich, H. G., Nicklin, M. J. H., Toyoda, H., Etchison, D. & Wimmer, E.(1987). Poliovirus proteinase 2A induces cleavage of eukaryotic initiation factor 4F polypeptide p220. Journal of Virology 61, 2711-2718.[Abstract/Free Full Text]

Laemmli, U. K.(1970). Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227, 680-685.[Medline]

Lamphear, B. J., Yan, R., Yang, F., Waters, D., Liebig, H. D., Klump, H., Kuechler, E., Skern, T. & Rhoads, R. E.(1993). Mapping the cleavage site in protein synthesis initiation factor eIF-4 gamma of the 2A proteases from human coxsackievirus and rhinovirus. Journal of Biological Chemistry 268, 19200-19203.[Abstract/Free Full Text]

Lawson, M. A. & Semler, B. L.(1990). Picornavirus protein processing enzymes, substrates, and genetic regulation. Current Topics in Microbiology and Immunology 161, 49-87.[Medline]

Lee, C.-K. & Wimmer, E.(1988). Proteolytic processing of poliovirus polyprotein: elimination of 2Apro-mediated, alternative cleavage of polypeptide 3CD by in vitro mutagenesis. Virology 166, 405-414.[Medline]

Lee, Y. F., Nomoto, A., Detjen, B. M. & Wimmer, E.(1977). A protein covalently linked to poliovirus genome RNA. Proceedings of the National Academy of Sciences, USA 74, 59-63.[Abstract/Free Full Text]

Liebig, H.-D., Ziegler, E., Yan, R., Hartmuth, K., Klump, H., Kowalski, H., Blaas, D., Sommergruber, W., Frasel, L., Lamphear, B., Rhoads, R., Kuechler, E. & Skern, T.(1993). Purification of two picornaviral 2A proteinases: interaction with eIF-4γ and influence on in vitro translation. Biochemistry 32, 7581-7588.[Medline]

Lu, H. H. & Wimmer, E.(1996). Poliovirus chimeras replicating under the translational control of genetic elements of hepatitis C virus reveal unusual properties of the internal ribosomal entry site of hepatitis C virus. Proceedings of the National Academy of Sciences, USA 93, 1412-1417.[Abstract/Free Full Text]

Lu, H. H., Alexander, L. & Wimmer, E.(1995a). Construction and genetic analysis of dicistronic polioviruses containing open reading frames for epitopes of human immunodeficiency virus type 1 gp120. Journal of Virology 69, 4797-4806.[Abstract]

Lu, H. H., Li, X., Cuconati, A. & Wimmer, E.(1995b). Analysis of picornavirus 2Apro proteins: separation of proteinase from translation and replication functions. Journal of Virology 69, 7445-7452.[Abstract]

Macadam, A. J., Stone, D. M., Almond, J. W. & Minor, P. D.(1994). The 5' noncoding region and virulence of poliovirus vaccine strains. Trends in Microbiology 2, 449-454.[Medline]

Mansky, L. M., Krueger, A. E. & Temin, H. M.(1995). The bovine leukemia virus encapsidation signal is discontinuous and extends into the 5' end of the gag gene. Journal of Virology 69, 3282-3289.[Abstract]

Martin-Belmonte, F., Lopez-Guerrero, J. A., Carrasco, L. & Alonso, M. A.(2000). The amino-terminal nine amino acid sequence of poliovirus capsid VP4 protein is sufficient to confer N-myristoylation and targeting to detergent-insoluble membranes. Biochemistry 39, 1083-1090.[Medline]

Michiels, T., Dejong, V., Rodrigus, R. & Shaw-Jackson, C.(1997). Protein 2A is not required for Theilers virus replication. Journal of Virology 71, 9549-9556.[Abstract]

Molla, A., Paul, A. V. & Wimmer, E.(1991). Cell-free, de novo synthesis of poliovirus. Science 254, 1647-1651.[Abstract/Free Full Text]

Molla, A., Jang, S. K., Paul, A. V., Reuer, Q. & Wimmer, E.(1992). Cardioviral internal ribosomal entry site is functional in a genetically engineered dicistronic poliovirus. Nature 356, 255-257.[Medline]

Molla, A., Hellen, C. U. T. & Wimmer, E.(1993a). Inhibition of proteolytic activity of poliovirus and rhinovirus 2A proteinases by elastase-specific inhibitors. Journal of Virology 67, 4688-4695.[Abstract/Free Full Text]

Molla, A., Paul, A. V., Schmid, M., Jang, S. K. & Wimmer, E.(1993b). Studies on dicistronic polioviruses implicate viral proteinase 2Apro in RNA replication. Virology 196, 739-747.[Medline]

Mueller, S. & Wimmer, E.(1998). Expression of foreign proteins by poliovirus polyprotein fusion: analysis of genetic stability reveals rapid deletions and formation of cardiovirus-like open reading frames. Journal of Virology 72, 20-31.[Abstract/Free Full Text]

Mueller, S. & Wimmer, E.(2000). Picornaviruses as tools of antigen delivery. In Viral Vectors: Basic Science and Gene Therapy , pp. 543-562. Edited by A. Cid-Arregui & A. Garcia-Carranca. Natick, MA:Eaton Publishing.

Newman, J. F., Piatti, P. G., Ryan, M. D. & Brown, F.(1994). Function of minor polypeptides in foot-and-mouth disease virus and poliovirus. Trends in Microbiology 2, 494-497.[Medline]

Nugent, C. I., Johnson, K. L., Sarnow, P. & Kirkegaard, K.(1999). Functional coupling between replication and packaging of poliovirus replicon RNA. Journal of Virology 73, 427-435.[Abstract/Free Full Text]

ONeill, R. E. & Racaniello, V. R.(1989). Inhibition of translation in cells infected with a poliovirus 2Apro mutant correlates with phosphorylation of the alpha subunit of eucaryotic initiation factor 2. Journal of Virology 63, 5069-5075.[Abstract/Free Full Text]

Palmenberg, A. C.(1989). Sequence alignments of picornavirus capsid proteins. In Molecular Aspects of Picornavirus Infection and Detection , pp. 211-241. Edited by B. Semler & E. Ehrenfeld. Washington, DC:American Society for Microbiology.

Petersen, J. F., Cherney, M. M., Liebig, H. D., Skern, T., Kuechler, E. & James, M. N.(1999). The structure of the 2A proteinase from a common cold virus: a proteinase responsible for the shut-off of host-cell protein synthesis. EMBO Journal 18, 5463-5475.[Medline]

Pfister, T., Mirazayan, C. & Wimmer, E.(1999). Polioviruses: molecular biology. In Encyclopedia of Virology , pp. 1330-1348. Edited by A. Granoff & R. Webster. London:Academic Press.

Porter, D. C., Ansardi, D. C., Wang, J., McPherson, S., Moldoveanu, Z. & Morrow, C. D.(1998). Demonstration of the specificity of poliovirus encapsidation using a novel replicon which encodes enzymatically active firefly luciferase. Virology 243, 1-11.[Medline]

Pringle, C. R.(1999). Virus taxonomy at the XIth International Congress of Virology, Sydney, Australia, 1999. Archives of Virology 144, 2065-2070.[Medline]

Reuer, Q., Kuhn, R. J. & Wimmer, E.(1990). Characterization of poliovirus clones containing lethal and nonlethal mutations in the genome-linked protein VPg. Journal of Virology 64, 2967-2975.[Abstract/Free Full Text]

Rowe, A., Ferguson, G. L., Minor, P. D. & Macadam, A. J.(2000). Coding changes in the poliovirus protease 2A compensate for 5'NCR domain V disruptions in a cell-specific manner. Virology 269, 284-293.[Medline]

Rueckert, R. R.(1996). Picornaviridae and their replication. In Fundamental Virology , pp. 507-548. Edited by B. N. Fields, D. M. Knipe & P. M. Howley. Philadelphia:LippincottRaven.

Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning: a Laboratory Manual, 2nd edn. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.

Seipelt, J., Guarne, A., Bergmann, E., James, M., Sommergruber, W., Fita, I. & Skern, T.(1999). The structure of picornaviral proteinases. Virus Research 62, 159-168.[Medline]

Skern, T., Sommergruber, W., Blaas, D., Gruendler, P., Fraundorfer, F., Pieler, C., Fogy, I. & Kuechler, E.(1985). Human rhinovirus 2: complete nucleotide sequence and proteolytic processing signals in the capsid protein region. Nucleic Acids Research 13, 2111-2126.[Abstract/Free&