Abstract
The MPs of potex-, carla-, pomo-, peclu-, beny- and hordeiviruses are encoded by a module of three partially overlapping genes (triple gene block, TGB) (Morozov et al., 1989 , 1999 ; Carrington et al., 1996 ; Herzog et al., 1998 ; Lough et al., 1998 ; Morozov & Solovyev, 1999 ; Leisner, 1999 ). The TGB-encoded MPs are referred to as TGBp1, TGBp2 and TGBp3, according to the position of the respective gene in the TGB. The TGBp1 proteins contain an NTPase/helicase domain with sequence motifs similar to those in the DNA helicases of superfamily 1 (Koonin & Dolja, 1993 ), an ATP/GTPase domain and have RNA-binding activities in vitro (Rouleau et al., 1994 ; Kalinina et al., 1996 ; Donald et al., 1995 , 1997 ; Bleykasten et al., 1996 ; Lough et al., 1998 ; Morozov et al., 1999 ; Wung et al., 1999 ). Intact NTPase motifs are required for the functional competence of TGBp1 in vivo (Donald et al., 1995 ; Bleykasten et al., 1996 ; Angell et al., 1996 ; Erhardt et al., 2000 ). TGBp2 and TGBp3 are the membrane proteins that are co-targeted to the cell periphery and influence TGBp1 sorting to cell wall-associated punctate bodies (PD and areas surrounding the PD) (Erhardt et al., 1999 , 2000 ; Solovyev et al., 2000 ; Yang et al., 2000 ).
Participation of virus-encoded NTPases has also been demonstrated for the transport systems of plant poty- and closteroviruses (Roberts et al., 1998 ; Carrington et al., 1998 ; Agranovsky et al., 1997 , 1998 ; Peremyslov et al., 1999 ; Alzhanova et al., 2000 ). Potyvirus CI protein, which is also essential for genomic RNA replication (Lain et al., 1991 ; Carrington et al., 1998 ), represents an RNA helicase/NTPase of superfamily 2 (Koonin & Dolja, 1993 ), whereas the closterovirus HSP70-like proteins are related to a large family of cell chaperones involved in the energy-dependent processes of protein folding and transport (Agranovsky et al., 1997 ). Apart from having NTPase as a key MP, potex-, poty- and closteroviruses share the following features: their particles are flexuous filaments and their CPs are involved in the cell-to-cell movement of virus infection (Chapman et al., 1992 ; Forster et al., 1992 ; Dolja et al., 1995 ; Rojas et al., 1997 ; Santa Cruz et al., 1998 ; Alzhanova et al., 2000 ; Robertson et al., 2000 ). It could be speculated that potyviral CI, closteroviral HSP70-like and TGBp1 proteins generate reversible energy-dependent conformational changes in the filamentous virions or virion-like ribonucleoproteins (RNPs) that are required for the trafficking of viral genomes through the PD (Roberts et al., 1998 ; Santa Cruz et al., 1998 ; Lough et al., 1998 ; Carrington et al., 1998 ; Medina et al., 1999 ; Morozov et al., 1999 ; Peremyslov et al., 1999 ; Alzhanova et al., 2000 ). Direct evidence for the ability of the potato virus X (PVX) TGBp1 NTPase to induce conformational changes in homologous virions in vitro,converting them into a translation-competent form, has recently been reported (Atabekov et al., 2000 ). In closteroviruses, it has also been found that binding of HSP70-like proteins to virions is probably required for the infectivity of virus particles (Napuli et al., 2000 ; Satyanarayana et al., 2000 ).
Potexviral CP is believed to be responsible for the formation of movement-competent complexes with viral RNA, either virions or virion-like RNPs containing both the CP and TGBp1 proteins (Lough et al., 1998 , 2000 ; Santa Cruz et al., 1998 ; Atabekov et al., 2000 ). These complexes are speculated to be targeted to PD by the TGBp2/TGBp3 proteins (Lough et al., 1998 ; Solovyev et al., 2000 ). Similarly, it is proposed that the potyviral CP has a direct role in the formation of CP-RNA transport complexes (perhaps by encapsidation), which are specifically guided to and through PD by conical deposits formed by the potyviral CI protein (Rodriguez-Cerezo et al., 1997 ; Carrington et al., 1998 ; Medina et al., 1999 ). Interestingly, similar structures containing filamentous virions are also found in closterovirus-infected cells (Pinto et al., 1988 ; Medina et al., 1999 ), providing another parallel to cell-to-cell movement of different viruses with long flexuous virions.
To test the possible functional compatibility between individual components of potex-, poty- and closterovirus transport systems, we have previously used transient complementation assays. In these experiments, plant leaves were co-inoculated by microprojectile bombardment with the cauliflower mosaic virus (CaMV) 35S promoter-driven cDNAs of movement-deficient PVX derivatives and vectors expressing genes of potex-, poty- and closterovirus movement-associated proteins (Morozov et al., 1997 , 1999 ; Agranovsky et al., 1998 ; Fedorkin et al., 2000 ). It was shown that in transient complementation tests, cell-to-cell movement deficiency of the PVX CP C-terminally truncated frameshift mutant could be rescued by the co-expressed potyvirus CP genes. Additionally, the PVX CP mutant was able to move from cell to cell in transgenic plants expressing potyvirus CP; however, the PVX RNA was not encapsidated by the potyvirus CP (Fedorkin et al., 2000 ). These data suggest that the CPs of potex- and potyviruses share some movement-associated function(s) that are not related to genome encapsidation. This conclusion has been confirmed by recent data demonstrating that cell-to-cell movement and encapsidation functions of white clover mosaic potexvirus CP can be separated: the movement-deficient C-terminally truncated CP mutant is still able to form virions (Lough et al., 2000 ).
To further understand the role(s) of CPs in virus movement, we performed transient complementation experiments in which two cell-to-cell movement-defective PVX mutants (with either a frameshift mutation in the CP gene or a deletion of this gene) were tested for their capacity to be complemented by the major and minor CPs of beet yellows closterovirus (BYV), the CP of cocksfoot mottle sobemovirus (CfMV) and the TMV MP and its non-functional derivatives. Our data demonstrate that the PVX CP has at least two movement-associated functions, one of which can be complemented by the CPs of unrelated viruses and non-functional deletion mutants of the TMV MP.
Construction of recombinant clones.All recombinant DNA procedures were carried out by standard methods (Sambrook et al., 1989 ). E. coli, strains DH5α, XL1-Blue and SURE were used for cloning of recombinant constructs. pRT-PVX.CP, pRT-PVA.CP, pRT-PVY.CP, pPVX.GUS-Xho, pPVX.GFP.ΔCP and pPVX.GUS-Bsp recombinant constructs were described previously (Morozov et al., 1997 ; Fedorkin et al., 2000 ). To construct clones with BYV CP genes under the control of the CaMV 35S RNA promoter, the BYV-specific insert was excised with NcoI and PvuII from pQE-60-24h(-), a pQE-based expression vector with the insert representing the BYV genome between nt 12919 and 13883, which was then cloned between the NcoI and NruI sites of pRT-BYV.65K to replace the BYV 65 KDa (65K) gene (Agranovsky et al., 1998 ). The resulting plasmid, pRT-BYV.24K, contained the gene for the BYV p24 minor CP under the control of the CaMV 35S promoter and the αβ translational enhancer of PVX (Smirnyagina et al., 1991 ). To obtain a similar construct for the BYV p22 major CP gene (pRT-BYV.22K), the PCR product obtained with primers oligo 22 and oligo 1 (Agranovsky et al., 1994 ) was digested with BglII and XhoI and cloned into the BglII/SalI-digested pRT-BYV.24K to replace the p24 insert. The CfMV CP gene cDNA was amplified by PCR using a full-length CfMV clone (Russian isolate; Ryabov et al., 1996 ; kindly made available by S. Zavriev, Institute of Agricultural Biotechnology, Moscow, Russia). The primers used for PCR were: CfMV-5'-CP-forward, 5' CCGGGATCCGAAATGATGGTGAGGAAAGGAGCAGCAACGAA, containing an underlined BamHI site and corresponding to nt 30893120 of the CfMV genome (base numbering refers to Mäkinen et al., 1995 ) and CfMV-3'-CP-reversed, 5' GCTCTAGAGGTTTGTCATCCCTGCAGTACTTGACTAC, containing an underlined XbaI site and complementary to nt 38533881 of the CfMV (Norwegian isolate; Mäkinen et al., 1995 ). The resulting PCR product was digested with BamHI and XbaI and cloned into a similarly digested pRT-100 (Töpfer et al., 1987 ). For expression in plant cells, the gene of the TMV 30K MP and its mutants from pQE-based E. coli expression vectors pQE-TMV.30K, pQE-TMV.NT96, pQE-TMV.CT11, pQE-TMV.CT33, pQE-TMV.CT86 and pQE-TMV.DEL4 (made available by Yu. L. Dorokhov, Moscow State University, Moscow, Russia) were subcloned into pRT-100 (Töpfer et al., 1987 ) downstream of the 35S promoter. Referring to the amino acid numbering of the TMV vulgare strain MP (Goelet et al., 1982 ), the mutants had the following deletions in the TMV 30K MP-coding sequence: NT96, aa 1106; CT11, aa 258268; CT33, aa 236268; CT86, aa 198268; and DEL4, aa 130186. To obtain pRT-TMV.388, pRT-TMV.CT11 was digested with Bsp120I, blunt-ended by Klenow fragment and religated. To construct pRT-TMV.27K, pRT-TMV.30K was digested with EcoRI and BglII, blunt-ended by Klenow fragment and religated. In pRT-TMV.CT86, 15 non-viral C-terminal extra amino acids (AEGPWNLQKKSLMSS) were added and in variant pRT-TMV.388, 10 non-viral C-terminal extra amino acids (PAHGTYRRSR) were added. In pRT-TMV.147, the 30K MP C-terminal amino acids DSEATVAESDSF were replaced by the non-viral amino acids EAMSPKTIRFNCSQA. To obtain pPVX.GFP-Xho, pPVX.GFP (Fedorkin et al., 2000 ) was partially digested with XhoI, filled in by Klenow enzyme and religated. To construct pRT-dsRed, the ApaIXbaI fragment of pDsRed1-1 (Clontech), containing the gene of the red fluorescent protein, was cloned into similarly digested pRT-100 (Töpfer et al., 1987 ).
Particle bombardment and virus movement detection.
Particle bombardment of detached Nicotiana benthamiana leaves was performed using the flying-disk method with a high-pressure helium-based PDS-1000 apparatus (Bio-Rad) as described by Morozov et al. (1997) . Replication and movement of PVX.GUS was monitored by histochemical detection of glucuronidase (GUS) expression (Jefferson, 1987 ). Samples were infiltrated with the colorimetric GUS substrate modified to limit the diffusion of the intermediate products of the reaction (De Block & Debrouwer, 1992 ). After overnight incubation at 37 °C, the leaves were fixed in 70% ethanol and examined by light microscopy. Green fluorescence protein (GFP) was detected using a Zeiss Axioscope 20 fluorescence microscope (excitation filter BP 450490, chromatic beam splitter FT 510 and either long pass emission filter LP 520 or band pass filter HQ 535/50x).
We have recently reported that cell-to-cell movement of PVX.GUS-Xho, a PVX CP frameshift mutant lacking 18 C-terminal amino acid residues (Fig. 1), can be trans-complemented by potyviral CPs (Fedorkin et al., 2000 ). In the present study, the CPs of the filamentous closterovirus BYV and the spherical sobemovirus CfMV were tested in the co-bombardment assay for their ability to rescue the movement deficiency of the PVX CP mutant. In controls, histochemical detection of GUS activity in N. benthamiana leaves revealed that at 3 days post-infection (p.i.), PVX.GUS-Xho was confined to individual cells or to small groups of cells (Fig. 2a and Table 1; cf. Chapman et al., 1992 , Fedorkin et al., 2000 ). When N. benthamiana leaves were co-bombarded with pPVX.GUS-Xho and the 35S promoter plasmids pRT-BYV.22K, pRT-BYV.24K or pRT-CfMV.CP, which encode the major and minor CPs of BYV and the CP gene of CfMV, respectively, GUS staining revealed infection foci several-fold larger than those in the negative control (Fig. 2bd and Table 1). Similar levels of rescued virus movement have been observed for co-bombardment of pPVX.GUS-Xho with the homologous PVX CP gene (Table 1; Fedorkin et al., 2000 ). Therefore, the CPs of a clostero- and a sobemovirus, similar to the potyvirus CP (Fedorkin et al., 2000 ), were able to complement cell-to-cell movement of the PVX CP frameshift mutant, indicating that these proteins could provide a movement function that was lost by truncated PVX CP.
|
|
Table 1. Complementation of GUS-tagged movement-deficient PVX derivatives in co-bombardment assays
We have previously shown that the frameshift mutant PVX.GUS-Xho behaved differently from the PVX.GFP.ΔCP mutant in which the CP gene was removed completely (Fedorkin et al., 2000 ). To use the same reporter gene for both PVX CP mutants and to analyse virus movement at the cell level, we constructed a GFP-tagged PVX mutant encoding the truncated PVX CP (designated PVX.GFP-Xho), which had the same frameshift mutation as PVX.GUS-Xho (Fig. 1). As expected, PVX.GFP-Xho showed a lack of cell-to-cell movement in bombarded N. benthamiana leaves and pRT-PVX.CP complemented cell-to-cell movement of PVX.GFP.ΔCP and PVX.GFP-Xho with similar efficiency (data not shown). As with the GUS-tagged PVX mutant PVX.GUS-Xho, pRT-BYV.22K, pRT-BYV.24K, pRT-CfMV.CP, pRT-PVY.CP and pRT-PVA.CP were able to rescue the movement defect of PVX.GFP-Xho and were therefore similar to pRT-PVX.CP (Fig. 2e and Table 2). The growth rate of the infection foci was similar in these experiments. For example, GFP fluorescence was detected for the major 22K BYV CP in 4·57±0·25 epidermal cells at 2 days post-bombardment (p.b.), 9·52±1·37 cells at 3 days p.b. and 18·10±1·34 cells at 4 days p.b.; for CfMV CP, fluorescence was in 4·20±0·60 epidermal cells at 2 days p.b., 10·65±1·47 cells at 3 days p.b. and 18·89±0·94 cells at 4 days p.b. (Table 2 and data not shown). At later stages (68 days p.b.), infection foci often coalesced and the underlying palisade mesophyll cells gave a strong fluorescent signal making a precise estimation of their size difficult (data not shown).
Table 2. Complementation of GFP-tagged movement-deficient PVX CP mutants in co-bombardment assays
In contrast, cell-to-cell movement of pPVX.GFP.ΔCP could not be complemented by either pRT-BYV.22K or pRT-BYV.24K (Table 2). Similarly, pPVX.GFP.ΔCP was not complemented by pRT-PVA.CP (Fedorkin et al., 2000 and Table 2). However, pRT-CfMV.CP was able to complement movement of PVX.GFP.ΔCP. In this case, GFP fluorescence was detected in small groups of six to seven cells (Fig. 2h and Table 2) and were therefore smaller than those in complementation of pPVX.GFP-Xho by pRT-CfMV.CP (Fig. 2e and Table 2). In contrast to complementation by the homologous CP, the size of the infection foci in the case of CfMV CP did not increase after 3 days p.i. (data not shown). To provide evidence that we were observing limited virus movement and not diffusion of GFP from the initially infected cells, the plasmid pRT-dsRed was added to the mixture of plasmids pRT-CfMV.CP and pPVX.GFP-Xho or pPVX.GFP.ΔCP precipitated onto the metal particles for co-bombardment. pRT-dsRed carries the gene for the red fluorescent protein from Discosoma species (Clontech) cloned under the control of the 35S promoter. This approach demonstrates that the limited virus spread observed in the case of complementation of PVX.GFP-Xho or PVX.GFP.ΔCP by pRT-CfMV.CP occurs in the absence of dsRed diffusion (Fig. 2ej). Co-bombardment with pRT-dsRed was routinely used in other complementation experiments to label the initially infected cell and to confirm that virus cell-to-cell movement rather than GFP leakage had occurred.
The CPs of potex-, poty- and closteroviruses are distantly related (Koonin & Dolja, 1993 ) and the major and minor closterovirus CPs, like those of potex- and potyviruses, are necessary for virus cell-to-cell movement (Alzhanova et al., 2000 ). These data, and results from previous work (Fedorkin et al., 2000 ), thus indicate that viral CPs in three taxonomic groups of filamentous viruses share some activities that are necessary for cell-to-cell movement. Importantly, both the clostero- and potyvirus CPs are able to complement PVX.Xho but not PVX.ΔCP (Tables 1 and 2). Therefore, these heterologous CPs require the C-terminally truncated PVX CP to complement cell-to-cell movement. Presumably, the truncated PVX CP lacks a movement function that may be provided non-specifically by the CPs of other filamentous viruses in complementation experiments, whereas another movement determinant is provided by the N-terminal PVX CP region retained in the C-terminally truncated mutant CP-Xho. Interestingly, small C-terminal deletions in both the major and minor closterovirus CPs resulted in a movement-deficient phenotype, suggesting C-terminal localization of some movement determinants similar to potex- and potyvirus CPs (Alzhanova & Dolja, 2000 ).
In spherical plant viruses, the requirement of CPs for cell-to-cell movement in plants has been reported (Kaplan et al., 1998 ; Lin & Heaton, 1999 ; Tenllado & Bol, 2000 ). In particular, the CP is one of three proteins required for transport of sobemovirus infections (Sivakumaran et al., 1998 ). As the CP of sobemovirus CfMV complemented not only pPVX.GUS(GFP)-Xho but also pPVX.GFP.ΔCP (Table 2), although to a lesser extent, one could conclude that the CP of spherical sobemovirus differs from the CPs of filamentous poty- and closteroviruses in its ability to complement the whole range of movement functions provided by the PVX CP. Our evidence that the CfMV CP can replace virus-specific movement determinant(s) contained in the region outside the most C-terminal part of the PVX CP indicates that the mechanism of movement complementation could be different in experiments with the CPs of filamentous viruses and CfMV.
Complementation of cell-to-cell transport of PVX CP mutants by TMV MP and its derivatives
To shed light on the movement function associated with the C-terminal region of the PVX CP, an attempt was made to complement cell-to-cell movement of PVX.CP-Xho by a series of mutants of TMV 30K MP, where a number of functional domains have already been identified and mapped (Citovsky et al., 1992 , 1993 ; Gafny et al., 1992 ; Mushegian & Koonin, 1993 ; Waigmann et al., 1994 ; Berna, 1995 ; Haley et al., 1995 ; Hughes et al., 1995 ; Kahn et al., 1998 ; Brill et al., 2000 ; Chen et al., 2000 ).
It has been previously shown that the MP of tomato mosaic tobamovirus (ToMV) was able to transiently complement a movement-deficient PVX derivative with mutated TGBp1 and a double PVX mutant with both a truncated TGBp1 and the frameshift mutation CP-Xho (Morozov et al., 1997 ; Atabekov et al., 1999 ). By using different TMV 30K mutants in complementation analysis, we hoped that the disabled movement function of the truncated PVX CP might be restored by the 30K deletion mutants, although non-functional as MPs, retaining definite functional domain(s) (Fig. 3) that complement the domain(s) missing in the truncated PVX CP.
|
In preliminary control experiments, the expression vector pRT-TMV.30K, carrying the TMV MP gene under control of the 35S promoter, was co-bombarded with pPVX.GUS-Xho and pPVX.GUS-Bsp. As expected, the MP of TMV, similar to that of tobamovirus ToMV (Morozov et al., 1997 ), complemented movement deficiency of both PVX derivatives with truncated TGBp1 and CP genes (Table 1). When pRT-TMV.30K was co-bombarded with pPVX.GFP-Xho, GFP fluorescence was detected in 5·46±0·51 epidermal cells at 2 days p.b., 10·63±1·06 cells at 3 days p.b. and 40·16±2·41 cells at 4 days p.b. (Table 2 and data not shown), demonstrating faster cell-to-cell movement then in complementations with CPs and probably reflecting highly efficient movement of the TMV MP between cells. These data agreed with our previous conclusion that tobamovirus MPs could functionally replace the transport system of PVX (Atabekov et al., 1999 ). Similarly, the MPs of groundnut rosette umbravirus were able to potentiate cell-to-cell movement of PVX with deletions of both TGB genes and CP (Ryabov et al., 1998 ).
In further experiments, expression vectors carrying different deletion mutants of the TMV 30K gene were individually co-bombarded with pPVX.GUS-Xho. GUS staining of the N. benthamiana leaves was carried out 3 days p.i. Step-wise truncation of the TMV 30K MP from the C terminus by 33, 71 and 73 amino acids (mutants TMV.CT33, TMV.CT86 and TMV.388, respectively) resulted in partial inhibition (TMV.CT33) and then in complete loss of complementation (TMV.CT86 and TMV.388) (Table 1) as the deletions entered the internal region containing the domains responsible for cell wall targeting, increase in size exclusion limit (SEL) (Kahn et al., 1998 ; Citovsky, 1999 ; Leisner, 1999 ; Rhee et al., 2000 ) and probably endoplasmic reticulum membrane binding (Brill et al., 2000 ). In contrast, deletion of 11 residues from the C terminus of TMV MP (mutant TMV.CT11) gave rise to an enhancement of complementation as compared to wt MP (Fig. 3 and Table 1). To test whether this effect was due to the deletion of specific C-terminal MP residues, we used an additional frameshift mutant, TMV.147, where the last 12 amino acids of TMV MP were replaced by a 15-residue-long sequence encoded by another reading frame (Fig. 3). Like TMV.CT11, TMV.147 showed enhanced level of pPVX.GUS-Xho complementation (Table 1). This effect could be explained by recent data suggesting that specific phosphorylation of Ser and Thr residues located in the last 10 amino acids of the TMV MP has a role in temporal regulation of its movement activity (Citovsky, 1999 ; Rhee et al., 2000 ; Waigmann et al., 2000 ). Importantly, the mutants TMV.147 and TMV.CT11, like wt TMV MP, were both able to complement movement deficiency of not only PVX.GUS-Xho but also PVX.GUS-Bsp with a truncated TGBp1 gene (Fig. 3 and Table 1). These data indicate that these mutants were functionally similar to the wt TMV MP in their ability to replace the transport system of PVX, as was suggested by Atabekov et al. (1999) .
N-terminal deletions of 26 and 108 residues (mutants TMV.27K and TMV.NT96, respectively) (Fig. 3) had little effect on pPVX.GUS-Xho complementation (Table 1). Importantly, these TMV MP mutants were unable to complement cell-to-cell movement of the TGBp1-deficient PVX derivative PVX.GUS-Bsp (Fig. 3 and Table 1) and pPVX.GFP.ΔCP (data not shown). Although TMV.27K and TMV.NT96 mutants do not function like the wt TMV MPs, they are still able to provide certain functional domain(s) required to trans-complement deficient movement function of the C-terminally truncated PVX CP. Both these mutants lack several important MP functional regions, but retain the main nucleic acid-binding domains and the regions responsible for cell wall targeting and SEL increase (Fig. 3) (Kahn et al., 1998 ; Citovsky, 1999 ; Leisner, 1999 ).
The mutant with an internal deletion (TMV.DEL4) was unable to complement the PVX CP frameshift mutant (Table 1). TMV.DEL4 corresponds to the previously described mutant del-4, which had defects in PD SEL augmentation, binding to the cell wall receptor pectin methylesterase (PME) and a partial defect in RNA binding (Waigmann et al., 1994 ; Karpova et al., 1997 ; Dorokhov et al., 1999 ; Chen et al., 2000 ). Thus, the fact that the internal deletion affects the TMV MPs ability to complement the C-terminally truncated PVX CP suggests that this region of the TMV 30K, which includes a number of overlapping functional domains, is responsible for complementation of the movement function specified by the truncated region of PVX CP.
The following model can be proposed to explain complementation of the PVX CP mutants by the unrelated single MPs. The complementing functional MP can form movement-competent RNPs with PVX genomic RNA that move intracellularly to the cell wall regions enriched in PD (Chen et al., 2000 ) and can be then transported through the PD, which might be pre-modified by TGB proteins or complementing foreign MPs (specific PD receptors bound and the PD dilated) (Lough et al., 1998 ; Kragler et al., 2000 ). This process needs no specific interactions with TGB proteins. The partially functional TMV MP mutants, like the wt 30K protein, might form RNPs, which include PVX RNA, and traffic them to dilated PD, in this case, by TGB proteins. The inability of TMV.DEL4 to complement PVX.GUS-Xho (Table 1) may represent an additional piece of evidence for a role of partially functional TMV MP derivatives in complementation of the truncated PVX CP. It is known that TMV.DEL4 MP has a lower efficiency of RNP formation and is incapable of binding the cell wall receptor PME (Chen et al., 2000 ). Also taking into account the fact that certain viral non-MPs (most probably incapable of PME-binding) with high RNA-binding ability cannot complement PVX.GUS-Xho movement (Fedorkin et al., 2000 ), it is tempting to speculate that cell wall targeting is at least one of the functions absent from the C-terminally truncated PVX CP.
However, another question remains to be solved: what is the functional activity, which is still retained in the truncated CP, required for supporting PVX.GUS(GFP)-Xho movement in complementation experiments with poty- and closterovirus CPs or TMV MP mutants?
Note added in proof.
A potential clue to the understanding of PVX CP movement-related functions was found in two recent articles on the TMV MP interactions with subcellular structures (Boyko et al., Nature Cell Biology 2, 826832, 2000; Boyko et al., Journal of Virology 74, 1133911346, 2000). The mutants of TMV MP lacking the tubulin-binding domain and defective in interaction with microtubules are unable to complement the movement of PVX with the C-terminally truncated CP (this article).
References
Agranovsky, A. A., Folimonova, S. Yu., Folimonov, A. S., Denisenko, O. N. & Zinovkin, R. A.(1997). The beet yellows closterovirus p65 homologue of HSP70 chaperones has ATPase activity associated with its conserved N-terminal domain but does not interact with unfolded protein chains. Journal of General Virology 78, 535-542.[Abstract]
Agranovsky, A. A., Folimonov, A. S., Folimonova, S. Yu., Morozov, S. Yu., Schiemann, J., Lesemann, D. & Atabekov, J. G.(1998). Beet yellows closterovirus HSP70-like protein mediates the cell-to-cell movement of a potexvirus transport-deficient mutant and a hordeivirus-based chimeric virus. Journal of General Virology 79, 889-895.[Abstract]
Alzhanova, D. V. & Dolja, V. V. (2000). Capsid proteins of a closterovirus: mutation analysis of the function in virus movement. American Society for Virology, 19th Annual Meeting. (Fort Collins, Colorado, USA, 812 July, 2000.) Abstracts, W2-7.
Alzhanova, D. V., Hagiwara, Y., Peremyslov, V. V. & Dolja, V. V.(2000). Genetic analysis of the cell-to-cell movement of beet yellows closterovirus. Virology 268, 192-200.[Medline]
Angell, S. M., Davies, C. & Baulcombe, D. C.(1996). Cell-to-cell movement of potato virus X is associated with a change in the size-exclusion limit of plasmodesmata in trichome cells of Nicotiana clevelandii. Virology 216, 197-201.[Medline]
Atabekov, J. G., Malyshenko, S. I., Morozov, S. Yu., Taliansky, M. E., Solovyev, A. G., Agranovsky, A. A. & Shapka, N. A.(1999). Identification and study of tobacco mosaic virus movement function by complementation tests. Philosophical Transactions of the Royal Society of London B Biological Sciences 354, 629-635.
Atabekov, J. G., Rodionova, N. P., Karpova, O. V., Kozlovsky, S. V. & Poljakov, V. Yu.(2000). The movement protein-triggered in situ conversion of potato virus X virion RNA from nontranslatable into a translation form. Virology 271, 259-263.[Medline]
Berna, A.(1995). Involvement of residues within putative α-helix motifs in the behaviour of the alfalfa and tobacco mosaic virus movement proteins. Phytopathology 85, 1441-1448.
Bertens, P., Wellink, J., Goldbach, R. & van Kammen, A.(2000). Mutational analysis of the cowpea mosaic movement protein. Virology 267, 199-208.[Medline]
Bleykasten, C., Gilmer, D., Guilley, H., Richards, K. E. & Jonard, G.(1996). Beet necrotic yellow vein virus 42 kDa triple gene block protein binds nucleic acid in vitro. Journal of General Virology 77, 889-897.
Brill, L. M., Nunn, R. S., Kahn, T. W., Yeager, M. & Beachy, R. N.(2000). Recombinant tobacco mosaic virus movement protein is an RNA-binding, α-helical membrane protein. Proceedings of the National Academy of Sciences, USA 97, 7112-7117.
Carrington, J. C., Kasschau, K. D., Mahajan, S. K. & Schaad, M. C.(1996). Cell-to-cell and long-distance transport of viruses in plants. Plant Cell 8, 1669-1681.[Medline]
Carrington, J. C., Jensen, P. E. & Schaad, M. C.(1998). Genetic evidence for an essential role for potyvirus CI protein in cell-to-cell movement. Plant Journal 14, 393-400.[Medline]
Chapman, S., Hills, G. J., Watts, J. & Baulcombe, D.(1992). Mutational analysis of the coat protein gene of potato virus X: effects of virion morphology and viral pathogenicity. Virology 191, 223-230.[Medline]
Chen, M. H., Sheng, J., Hind, G., Handa, A. K. & Citovsky, V.(2000). Interaction between the tobacco mosaic virus movement protein and host cell pectin methylesterases is required for viral cell-to-cell movement. EMBO Journal 19, 913-920.[Medline]
Citovsky, V.(1999). Tobacco mosaic virus: a pioneer of cell-to-cell movement. Philosophical Transactions of the Royal Society of London B Biological Sciences 354, 637-643.
Citovsky, V., Wong, M. L., Shaw, A. L., Prasad, B. V. & Zambryski, P.(1992). Visualization and characterization of tobacco mosaic virus movement protein binding to single-stranded nucleic acids. Plant Cell 4, 397-411.
Citovsky, V., McLean, B. G., Zupan, J. R. & Zambryski, P.(1993). Phosphorylation of tobacco mosaic virus cell-to-cell movement protein by a developmentally regulated plant cell wall-associated protein kinase. Genes & Development 7, 904-910.
De Block, M. & Debrouwer, D.(1992). In situ enzyme histochemistry on plastic-embedded plant material. The development of an artefact-free β-glucuronidase assay. Plant Journal 2, 261-266.
Deom, C. M., Quan, S. & He, X. Z.(1997). Replicase proteins as determinants of phloem-dependent long-distance movement of tobamovirus in tobacco. Protoplasma 199, 1-8.
Dolja, V. V., Haldeman-Cahill, R., Montgomery, A. E., Vandenbosch, K. A. & Carrington, J. C.(1995). Capsid protein determinants involved in cell-to-cell and long distance movement of tobacco etch potyvirus. Virology 206, 1007-1016.[Medline]
Donald, R. G., Petty, I. T. D., Zhou, H. & Jackson, A. O. (1995). Properties of genes influencing barley stripe mosaic virus movement phenotypes. In Fifth International Symposium on Biotechnology & Plant Protection: Viral Pathogenesis & Disease Resistance, pp. 135147. Singapore: World Scientific.
Donald, R. G., Lawrence, D. M. & Jackson, A. O.(1997). The barley stripe mosaic virus 58-kilodalton βb protein is a multifunctional RNA binding protein. Journal of Virology 71, 1538-1546.
Dorokhov, Yu. L., Mäkinen, K., Frolova, O. Yu., Merits, A., Saarinen, J., Kalkkinen, N., Atabekov, J. G. & Saarma, M.(1999). A novel function for a ubiquitous plant enzyme pectin methylesterase: the host-cell receptor for the tobacco mosaic virus movement protein. FEBS Letters 461, 223-228.[Medline]
Erhardt, M., Stussi-Garaud, C., Guilley, H., Richards, K., Jonard, G. & Bouzoubaa, S.(1999). The first triple gene block protein of peanut clump virus localizes to the plasmodesmata during virus infection. Virology 264, 220-229.[Medline]
Erhardt, M., Morant, M., Ritzenthaler, C., Stussi-Garaud, C., Guilley, H., Richards, K., Jonard, G., Bouzoubaa, S. & Gilmer, D.(2000). P42 movement protein of beet necrotic yellow vein virus is targeted by the movement proteins P13 and P15 to punctate bodies associated with plasmodesmata. Molecular PlantMicrobe Interactions 13, 520-528.
Fedorkin, O. N., Merits, A., Luccesi, J., Solovyev, A. G., Saarma, M., Morozov, S. Yu. & Mäkinen, K.(2000). Complementation of the movement-deficient mutations in potato virus X: potyvirus coat protein mediates cell-to-cell trafficking of C-terminal truncation but not deletion mutant of potexvirus coat protein. Virology 270, 31-42.[Medline]
Forster, R. L., Beck, D. L., Guilford, P. J., Voot, D. M., Van Dolleweerd, C. J. & Andersen, M. T.(1992). The coat protein of white clover mosaic potexvirus has a role in facilitating cell-to-cell transport in plants. Virology 191, 480-484.[Medline]
Gafny, R., Lapidot, M., Berna, A., Holt, C. A., Deom, C. M. & Beachy, R. N.(1992). Effects of terminal deletion mutations on function of the movement protein of tobacco mosaic virus. Virology 187, 499-507.[Medline]
Goelet, P., Lomonossoff, G. P., Butler, P. J., Akam, M. E., Gait, M. J. & Karn, J.(1982). Nucleotide sequence of tobacco mosaic virus RNA. Proceedings of the National Academy of Sciences, USA 79, 5818-5822.
Haley, A., Hunter, T., Kiberstis, P. & Zimmern, D.(1995). Multiple serine phosphorylation sites on the 30 kDa TMV cell-to-cell movement protein synthesized in tobacco protoplasts. Plant Journal 8, 715-724.[Medline]
Herzog, E., Hemmer, O., Hauser, S., Meyer, G., Bouzoubaa, S. & Fritsch, C.(1998). Identification of genes involved in replication and movement of peanut clump virus. Virology 248, 312-322.[Medline]
Hughes, R. K., Perbal, M. C., Maule, A. J. & Hull, R.(1995). Evidence for proteolytic processing of tobacco mosaic virus movement protein in Arabidopsis thaliana. Molecular PlantMicrobe Interactions 8, 658-665.
Jackson, D.(2000). Opening up the communication channels: recent insights into plasmodesmal function. Current Opinion in Plant Biology 3, 394-399.[Medline]
Jefferson, R. A.(1987). Assaying chimeric genes in plants: the GUS gene fusion system. Plant Molecular Biology 5, 387-405.
Kahn, T. W., Lapidot, M., Heinlein, M., Reichel, C., Cooper, B., Gafny, R. & Beachy, R. N.(1998). Domains of the TMV movement protein involved in subcellular localization. Plant Journal 15, 15-25.[Medline]
Kalinina, N. A., Fedorkin, O. N., Samuilova, O. V., Maiss, E., Korpela, T., Morozov, S. Yu. & Atabekov, J. G.(1996). Expression and biochemical analysis of the recombinant potato virus X 25K movement protein. FEBS Letters 397, 75-78.[Medline]
Kaplan, I. B., Zhang, L. & Palukaitis, P.(1998). Characterization of cucumber mosaic virus. V. Cell-to-cell movement requires capsid protein but not virions. Virology 246, 221-231.[Medline]
Karpova, O. V., Ivanov, K. I., Rodionova, N. P., Dorokhov, Yu. L. & Atabekov, J. G.(1997). Nontranslatability and dissimilar behavior in plants and protoplasts of viral RNA and movement protein complexes formed in vitro. Virology 230, 11-21.[Medline]
Koonin, E. V. & Dolja, V. V.(1993). Evolution and taxonomy of positive-strand RNA viruses: implications of comparative analysis of amino acid sequences. Critical Reviews in Biochemistry and Molecular Biology 28, 375-430.[Medline]
Kragler, F., Monzer, J., Xoconostle-Cazares, B. & Lucas, W. J.(2000). Peptide antagonists of the plasmodesmal macromolecular trafficking pathway. EMBO Journal 19, 2856-2868.[Medline]
Lain, S., Martin, M. T., Riechmann, J. L. & Garcia, J. A.(1991). Novel catalytic activity associated with positive-strand RNA virus infection: nucleic acid-stimulated ATPase activity of the plum pox potyvirus helicase-like protein. Journal of Virology 65, 1-6.
Lazarowitz, S. G.(1999). Probing plant cell structure and function with viral movement proteins. Current Opinion in Plant Biology 2, 332-338.[Medline]
Lazarowitz, S. G. & Beachy, R. N.(1999). Viral movement proteins as probes for intracellular and intercellular trafficking in plants. Plant Cell 11, 535-548.
Lee, J. Y., Yoo, B. C. & Lucas, W. J.(2000). Parallels between nuclear-pore and plasmodesmal trafficking of information molecules. Planta 210, 177-187.[Medline]
Leisner, S. M.(1999). Molecular basis of virus transport in plants. In Molecular Biology of Plant Viruses , pp. 161-182. Edited by C. L. Mandahar. Dordrecht:Kluwer.
Lin, B. & Heaton, L. A.(1999). Mutational analyses of the putative calcium binding site and hinge of the turnip crinkle virus coat protein. Virology 259, 34-42.[Medline]
Lough, T. J., Shash, K., Xoconostle-Cazares, B., Hofstra, K. R., Beck, D. L., Balmori, E., Forster, R. L. S. & Lucas, W. J.(1998). Molecular dissection of the mechanism by which potexvirus triple gene block proteins mediate cell-to-cell transport of infectious RNA. Molecular PlantMicrobe Interactions 11, 801-814.
Lough, T. J., Netzler, N. E., Emerson, S. J., Sutherland, P., Carr, F., Beck, D. L., Lucas, W. J. & Forster, R. L. S.(2000). Cell-to-cell movement of potexviruses: evidence for a ribonucleoprotein complex involving the coat protein and first triple gene block protein. Molecular PlantMicrobe Interactions 13, 962-974.
Mäkinen, K., Tamm, T., Næss, V., Truve, E., Puurand, U., Munthe, T. & Saarma, M.(1995). Characterization of cocksfoot mottle sobemovirus genomic RNA and sequence comparison with related viruses. Journal of General Virology 76, 2817-2825.
Medina, V., Peremyslov, V. V., Hagiwara, Y. & Dolja, V. V.(1999). Subcellular localization of the HSP70-homolog encoded by beet yellows closterovirus. Virology 260, 173-181.[Medline]
Melcher, U.(2000). The 30K superfamily of viral movement proteins. Journal of General Virology 81, 257-266.
Morozov, S. Yu. & Solovyev, A. G.(1999). Genome organization in RNA viruses. In Molecular Biology of Plant Viruses , pp. 47-98. Edited by C. L. Mandahar. Dordrecht:Kluwer.
Morozov, S. Yu., Dolja, V. V. & Atabekov, J. G.(1989). Probable reassortment of genomic elements among elongated RNA-containing plant viruses. Journal of Molecular Evolution 29, 52-62.[Medline]
Morozov, S. Yu., Fedorkin, O. N., Jüttner, G., Schiemann, J., Baulcombe, D. C. & Atabekov, J. G.(1997). Complementation of a potato virus X mutant mediated by bombardment of plant tissues with cloned viral movement protein genes. Journal of General Virology 78, 2077-2083.[Abstract]
Morozov, S. Yu., Solovyev, A. G., Kalinina, N. O., Fedorkin, O. N., Samuilova, O. V., Schiemann, J. & Atabekov, J. G.(1999). Evidence for two nonoverlapping functional domains in the potato virus X 25K movement protein. Virology 260, 55-63.[Medline]
Mushegian, A. R. & Koonin, E. V.(1993). Cell-to-cell movement of plant viruses. Insights from amino acid sequence comparisons of movement proteins and from homologies with cellular transport systems. Archives of Virology 133, 239-257.[Medline]
Napuli, A. J., Falk, B. W. & Dolja, V. V.(2000). Interaction between HSP70 homolog and filamentous virions of beet yellows virus. Virology 274, 232-239.[Medline]
Peremyslov, V. V., Hagiwara, Y. & Dolja, V. V.(1999). HSP70 homolog functions in cell-to-cell movement of a plant virus. Proceedings of the National Academy of Sciences, USA 96, 14771-14776.
Pinto, R. L., Hoefert, L. L. & Fail, G. L.(1988). Plasmalemma deposits in tissues infected with lettuce infectious yellows virus. Journal of Ultrastructure and Molecular Structure Research 100, 245-254.
Rhee, Y., Tzfira, T., Chen, M.-H., Waigmann, E. & Citovsky, V.(2000). Cell-to-cell movement of tobacco mosaic virus: enigmas and explanations. Molecular Plant Pathology 1, 33-39.
Roberts, I. M., Wang, D., Findlay, K. & Maule, A. J.(1998). Ultrastructural and temporal observations of the potyvirus cylindrical inclusions (Cls) show that the Cl protein acts transiently in aiding virus movement. Virology 245, 173-181.[Medline]
Robertson, N. L., French, R. & Morris, T. J.(2000). The open reading frame 5A of foxtail mosaic virus is expressed in vivo and is dispensable for systemic infection. Archives of Virology 145, 1685-1698.[Medline]
Rodriguez-Cerezo, E., Findlay, K., Shaw, J. G., Lomonossoff, G. P., Qiu, S. G., Linstead, P., Shanks, M. & Risco, C.(1997). The coat and cylindrical inclusion proteins of a potyvirus are associated with connections between plant cells. Virology 236, 296-306.[Medline]
Rojas, M. R., Zerbini, F. M., Richard, F. A., Gillbertson, R. L. & Lucas, W. J.(1997). Capsid protein and helper component-proteinase function as potyvirus cell-to-cell movement proteins. Virology 237, 283-295.[Medline]
Rouleau, M., Smith, R. J., Bancroft, J. B. & Mackie, G. A.(1994). Purification, properties and subcellular localization of foxtail mosaic potexvirus 26-kDa protein. Virology 204, 254-265.[Medline]
Ryabov, E. V., Krutov, A. A., Novikov, V. K., Zheleznikova, O. V., Morozov, S. Yu. & Zavriev, S. K.(1996). Nucleotide sequence of RNA from the sobemovirus found in infected cocksfoot shows a luteovirus-like arrangement of the putative replicase and protease genes. Phytopathology 86, 391-397.
Ryabov, E. V., Oparka, K. J., Santa Cruz, S., Robinson, D. J. & Taliansky, M. E.(1998). Intracellular location of two groundnut rosette umbravirus proteins delivered by PVX and TMV vectors. Virology 242, 303-313.[Medline]
Sambrook, J., Fritsch, E. F. & Maniatis, T. A. (1989). Molecular Cloning: A Laboratory Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.
Santa Cruz, S., Roberts, A. G., Prior, D. A., Chapman, S. & Oparka, K. J.(1998). Cell-to-cell and phloem-mediated transport of potato virus X. The role of virions. Plant Cell 10, 495-510.
Satyanarayana, T., Gowda, S., Mawassi, M. R., Albiach-Marti, M. R. & Dawson, W. O. (2000). HSP70 homolog and p61 in addition to the two coat protein genes of citrus tristeza closterovirus are required for efficient assembly of infectious virions. American Phytopathological Society, Annual Meeting. (New Orleans, USA). Phytopathology 90, S69.
Sivakumaran, K., Fowler, B. C. & Hacker, D. L.(1998). Identification of viral genes required for cell-to-cell movement of southern bean mosaic virus. Virology 252, 376-386.[Medline]
Smirnyagina, E. V., Morozov, S. Yu., Rodionova, N. P., Miroshnichenko, N. A., Solovyev, A. G., Fedorkin, O. N. & Atabekov, J. G.(1991). Translational efficiency and competitive ability of mRNAs with 5'-untranslated αβ-leader of PVX RNA. Biochimie 73, 587-598.[Medline]
Solovyev, A. G., Stroganova, T. A., Zamyatnin, A. A.Jr, Fedorkin, O. N., Schiemann, J. & Morozov, S. Yu.(2000). Subcellular sorting of small membrane-associated triple gene block proteins: TGBp3-assisted targeting of TGBp2. Virology 269, 113-127.[Medline]
Tenllado, F. & Bol, J. F.(2000). Genetic dissection of the multiple functions of alfalfa mosaic virus coat protein in viral replication, encapsidation and movement. Virology 268, 29-40.[Medline]
Töpfer, R., Matzeit, V., Gronenborn, B., Schell, J. & Steinbiss, H.-H.(1987). A set of plant expression vectors for transcriptional and translational fusions. Nucleic Acids Research 15, 5890.
Waigmann, E., Lucas, W. J., Citovsky, V. & Zambryski, P.(1994). Direct functional assay for tobacco mosaic virus cell-to-cell movement protein and identification of a domain involved in increasing plasmodesmal permeability. Proceedings of the National Academy of Sciences, USA 91, 1433-1437.
Waigmann, E., Chen, M.-H., Bachmaier, R., Ghoshroy, S. & Citovsky, V. Z.(2000). Regulation of plasmodesmal transport by phosphorylation of tobacco mosaic virus cell-to-cell movement protein. EMBO Journal 19, 4875-4884.[Medline]
Weiland, J. J. & Edwards, M. C.(1996). A single nucleotide substitution in the alpha a gene confers oat pathogenicity to barley stripe mosaic virus strain ND18. Molecular PlantMicrobe Interactions 9, 62-67.
Wung, C.-H., Hsu, Y.-H., Liou, D.-Y., Huang, W.-C., Lin, N.-S. & Chang, B.-Y.(1999). Identification of the RNA-binding sites of the triple gene block protein 1 of bamboo mosaic potexvirus. Journal of General Virology 80, 1119-1126.[Abstract]
Yang, Y., Ding, B., Baulcombe, D. C. & Verchot, J.(2000). Cell-to-cell movement of the 25K protein of potato virus X is regulated by three other viral proteins. Molecular PlantMicrobe Interactions 13, 599-605.
Received 21 July 2000; accepted 10 October 2000.