Abstract
Poxvirus immunomodulators have been identified by several methods. Most commonly, computational comparisons of the sequences of proteins deduced from poxvirus genome sequences revealed amino acid similarity with host protein(s) of known function. Soluble inhibitors of TNF (Smith et al., 1990 ), IL-1β (Smith & Chan, 1991 ) and complement factors (Kotwal & Moss, 1988a ) were identified in this manner. Alternatively, proteins that are predicted or demonstrated to be secreted from infected cells have been studied and their ligands sought (Upton et al., 1992 ; Smith et al., 1997 ; Comeau et al., 1998 ; Ng et al., 2001 ). Lastly, functional assays using the supernatants of virus-infected cells have identified virus proteins that can bind to host factors (Graham et al., 1997 ) or inhibit their biological activity (Symons et al., 1995 ). In this way, virus proteins that bind chemokines or type I IFNs were identified and subsequently the encoding gene was mapped.
In this report, we screened the supernatants of orthopoxvirus-infected cells for a soluble inhibitor of IL-12 by testing the ability of these supernatants to inhibit the IL-12-induced production of IFN-γ from mouse splenocytes. IL-12 was selected because this is an important pro-inflammatory cytokine that promotes the Th1 immune response via induction of IFN-γ (Gately et al., 1998 ). IL-12 acts synergistically with another pro-inflammatory cytokine, IL-18 (Robinson et al., 1997 ; Yoshimoto et al., 1998 ), which was originally designated IFN-γ-inducing factor (reviewed by Nakanishi et al., 2001 ; Sims, 2002 ). Both IL-12 and IL-18 bind to specific receptors called IL-12R and IL-18R, respectively. No poxvirus protein with amino acid sequence similarity to the cytokine binding subunits of IL-12R or IL-18R has been identified, but when the human and mouse soluble inhibitors of IL-18, called IL-18 binding protein (IL-18 bp), were identified (Novick et al., 1999 ) related proteins were reported to be encoded by several poxviruses including molluscum contagiosum virus (MCV) (gene MC54L) (Xiang & Moss, 1999a , b ), ectromelia virus, cowpox virus and VV (Born et al., 2000 ; Smith et al., 2000 ), Yaba-like disease virus (Lee et al., 2001 ), monkeypox virus (Shchelkunov et al., 2001 ) and swinepox virus (Afonso et al., 2002 ). Mutagenesis indicated that the human and MCV IL-18 bps have similar functional epitopes (Xiang & Moss, 2001a , b ).
Here we report the identification and mapping of a VV inhibitor of IL-12-induced IFN-γ from mouse splenocytes and the mapping of the activity to VV gene C12L that encodes a protein with amino acid similarity to IL-18 bps. Recombinant C12L protein was shown to inhibit mouse IL-18 in vitro. Finally, the VV WR C12L gene is shown to contribute to virus virulence in a murine intranasal model.
Cells and viruses.Human TK-143B and D98OR cells, and monkey BS-C-1 cells were grown in Dulbecco's modified Eagle's medium (DMEM) containing 10% heat-inactivated foetal bovine serum (FBS). CBA/ca mice were bred and maintained in specific pathogen-free conditions and single cell suspensions of mouse splenocytes were obtained by mechanical disruption in RPMI 1640 containing 10% FBS. Spodoptera frugiperda (Sf)21 cells were cultured as described previously (Symons et al., 1995 ). VV strain Western Reserve (WR) was grown, titrated and purified as described previously (Mackett et al., 1985 ) and the source of other VV strains was as described (Symons et al., 1995 ).
Construction of recombinant vaccinia viruses.
A virus deletion mutant lacking 40% of the C12L ORF was constructed using transient dominant selection (Falkner & Moss, 1990 ). A plasmid was assembled that contained the DNA flanking the 5' and 3' regions of the C12L ORF. These fragments were amplified by PCR using Pyrococcus furiosus DNA polymerase and VV WR DNA as template. The left flanking region was amplified with oligonucleotides 5' CAAGGATCCGTTTCTAATATAATCTGCC 3' (C12L1F) and 5' GTTGAGCTCGGATATGAGATCGGACGAG 3' (C12L1R), which contain BamHI and SacI sites, respectively (underlined). The right flanking region was amplified with oligonucleotides 5' GATGAGCTCCTTGCCAAAATATCACTAGA 3' (C12L2F) and 5' AAAGAATTCTAGGTGGTAATACTATGTTC 3' (C12L2R), which contain SacI and EcoRI sites (underlined), respectively. These fragments were digested with the appropriate restriction enzymes and cloned sequentially into plasmid pSJH7 (Hughes et al., 1991 ) that had been cut with the same enzymes. The resultant plasmid, termed pΔC12L, contained 331 and 315 nucleotides of the 5' and 3' flanking sequence, respectively, including 9 and 216 nucleotides of coding sequence at the 5' and 3' ends of the gene, respectively. All cloned PCR fragments were sequenced to check fidelity.
Plasmid pΔC12L was transfected into VV-infected cells and mycophenolic acid (MPA)-resistant recombinant viruses were isolated as described (Falkner & Moss, 1988 ). These were grown on hypoxanthine guanine phosphoribosyltransferase-negative D980R cells in the presence of 6-thioguanine (TG) (Kerr & Smith, 1991 ) and isolates corresponding to WT (vC12L) or deletion mutant (vΔC12L) were identified by PCR.
A revertant virus (vC12L-R) in which the C12L locus was restored to WT was constructed by transfecting a plasmid (pC12L-R) containing the entire WT C12L gene into cells infected with vΔC12L. Plasmid pC12L-R was constructed by amplifying the entire C12L ORF and flanking regions using primers C12L1F and C12L2R (above). The resulting 677 bp fragment was digested with BamHI and EcoRI and cloned into pSJH7. MPA-resistant intermediate viruses were isolated as above and resolved into deletion mutant and revertant viruses (vC12L-R) on D980R cells in the presence of 6-TG as described. The genome structures of vC12L, vΔC12L and vC12L-R were analysed by PCR and Southern blotting and were found to be as predicted.
To generate a recombinant VV expressing high levels of the C12L protein the C12L ORF was cloned downstream of a strong VV promoter and inserted into the thymidine kinase (TK) locus of VV strain Copenhagen, a virus that lacks the IL-18 bp. The C12L ORF was excised from pAcC12L (see below) using BamHI and StyI and the resulting 400 bp fragment was cloned into pMJ601 (Davison & Moss, 1990 ) that had been cut with BamHI and NheI, generating pMJ601/C12L. Plasmid pMJ601/C12L was transfected into VV strain Copenhagen-infected cells and TK-negative, β-galactosidase-positive recombinant viruses were isolated as described (Chakrabarti et al., 1985 ).
Construction of recombinant baculovirus expressing C12L.
The C12L protein was expressed in recombinant baculovirus (Autographa californica nuclear polyhedrosis virus; AcNPV) using methods described previously (Ng et al., 2001 ). Briefly, the C12L ORF with or without six histidine residues at the C terminus was amplified by PCR using as primers oligonucleotides C12LF (5' AGTAAGCTTGGCAAGATGAGAATCC 3') and C12LR (5' AAACTCGAGCACGCACTACTTCAGCC 3'), which contain HindIII and XhoI sites (underlined) respectively, or C12LF and C12LRhis (5' GCACCTCGAGCTTCAGCCAAATATTC 3'), which contains a XhoI site (underlined), and VV WR DNA as template. The resultant DNA fragments were digested with HindIII and XhoI and cloned into transfer vector pBAC1 that had been digested with the same enzymes. The resultant plasmids, pAcC12L and pAcC12L-his, were used to construct baculovirus recombinants AcC12L and AcC12L-his, respectively.
Preparation of supernatants from virus-infected cells.
Cultures of TK-143B cells were infected with orthopoxviruses at 5 p.f.u. per cell. Alternatively, Sf21 cells were infected with baculoviruses at 10 p.f.u. per cell. Supernatants from poxvirus or baculovirus-infected cells were harvested at 1 or 3 days post-infection (p.i.), respectively, centrifuged at 3000 r.p.m. for 10 min at 4 °C and the pellet was discarded. Virus particles were removed by centrifugation at 16500 r.p.m. in an SW41 Ti rotor for 60 min at 4 °C. Supernatants were stored at -20 °C until use.
IL-12-induced production of IFN-γ.
Microtitre plates (Falcon) were coated overnight at 4 °C with 50 µl of non-neutralizing monoclonal antibodies (mAb) against mouse IL-12 (C15.1.2 and C15.6.7) (gifts from G. Trinchieri, Wister Institute, Philadelphia, USA) each at 15 µg/ml in bicarbonate buffer. Plates were washed three times with PBS and blocked with 100 µl of 10% FBS in PBS for 2 h at 37 °C. After further washing, recombinant mouse IL-12 (R&D Systems) was added and incubated overnight at 4 °C. Plates were washed in PBS and 100 µl of a single cell suspension of mouse (CBA/ca) spleen cells (5x106 cells/ml) were added in RPMI 1640 medium containing 10% FBS in the presence or absence of 100 µl of medium alone or medium from mock- or virus-infected cells or neutralizing mAb to IL-12. Plates were incubated for 48 h at 37 °C and the medium was then harvested and assayed for mouse IFN-γ by ELISA.
Anti-CD3 induced production of IFN-γ.
Microtitre plates (Falcon) were coated for 2 h at 37 °C with 50 µl of anti-CD3 mAb KT3 (Tomonari, 1988 ) at 1 µg/ml. The plates were washed three times with PBS. Single cell suspensions of mouse (CBA/Ca) spleen cells, which had been incubated in plastic vessels for 2 h to deplete macrophages, were added to the wells as above with either medium alone or medium from mock- or virus-infected cells at various concentrations. Plates were incubated for 48 h at 37 °C and the medium was then harvested and assayed for mouse IFN-γ by ELISA.
IL-18-induced production of IFN-γ.
Splenocytes from CBA mice were cultured in RPMI 1640 medium supplemented with 10% FBS and were stimulated with 200 ng/ml concanavalin A and 12·5 ng/ml murine IL-18 for 24 h at 37 °C. The IFN-γ level in the culture medium was determined by ELISA. To test for inhibition of IL-18 by the VV C12L protein, murine IL-18 was incubated for 1 h at room temperature with clarified supernatants from TK-143 cells that had been infected with recombinant VVs or Sf21 cells that had been infected with recombinant baculoviruses.
Measurement of IFN-γ by ELISA.
Microtitre plates were coated with anti-mouse IFN-γ mAb R4-6A2 (Pharmingen) at 10 µg/ml in bicarbonate buffer for 1 h. Plates were washed with PBS containing 0·5% Tween 20 and blocked with PBS containing 10% FBS for 1 h. Supernatants from IL-12, IL-18 or anti-CD3 stimulated splenocytes were then added in duplicate and incubated for 2 h at room temperature. A standard curve of mouse IFN-γ (R&D Systems) was included in each experiment. Plates were washed and bound IFN-γ was detected by incubation with the biotinylated anti-IFN-γ mAb XMG-1.2 (Pharmingen) for 1 h. The plates were washed extensively and then extravidinperoxidase conjugate (Sigma; diluted 1:1000) was added for 1 h. Finally, the ELISA was developed by addition of OPD substrate for 0·5 h, the reaction was stopped by addition of 3 M H2SO4 and the absorbance was read at 492 nm.
Assays for virus virulence.
Groups of female BALB/c mice, between 6 and 8 weeks of age, were anaesthetized and infected intranasally with 104 p.f.u. of VV in 20 µl PBS. Each day, mice were weighed individually and monitored for signs of illness as described previously (Alcamí & Smith, 1992 ), and those suffering a severe infection or having lost >30% of their original body weight were sacrificed. Alternatively, mice were infected by injection of virus into the ear pinna and the lesion size was measured daily as described previously (Tscharke & Smith, 1999 ; Tscharke et al., 2002 ).
Poxviruses encode several proteins that are secreted from infected cells and bind to host proteins involved in the innate response to infection (Introduction). Given that several of these proteins target Th1 cytokines such as IFN-γ, TNF and IL-1β, we were interested to determine if these viruses also expressed an inhibitor of IL-12. To search for an IL-12 inhibitor, supernatants from TK-143 cells infected with different VV strains or other orthopoxviruses were tested in a bioassay that measured the IL-12-induced production of IFN-γ from mouse splenocytes (Fig. 1a). These splenocytes produced IFN-γ if stimulated with IL-12 or if incubated with IL-12 in the presence of supernatants from mock-infected cells, but the production of IFN-γ was inhibited by supernatants taken from cells infected with 13 out of 15 strains of VV, two strains of cowpox virus (Brighton Red and elephantpox virus) and to a lesser extent camelpox virus (CMPV). Notably, VV strains Tashkent and Copenhagen lacked this activity. In addition, supernatants of chick embryo fibroblasts (CEF) infected with VV strain modified vaccinia Ankara (MVA) express an inhibitor of IL-12-induced IFN-γ (Fig. 1b).
|
The inhibition of IFN-γ production by supernatants from WR-infected cells in a dose-dependent manner (Fig. 2a) was not due to a general inhibition of the ability of these cells to produce IFN-γ because splenocytes stimulated with anti-CD3 mAb produced IFN-γ in the presence or absence of supernatants from infected cells (Fig. 2b). Supernatants from cells infected with VV Copenhagen or VV WR strain v6/2 did not inhibit IFN-γ production induced by either IL-12 or anti-CD3.
|
Mapping the gene encoding the inhibitory activity
The sequences of the genomes of VV strains Copenhagen, MVA, WR and Tian Tan did not predict a protein related to the IL-12R alpha chain, which binds IL-12, and so the gene encoding the inhibitor of IL-12-induced IFN-γ production was mapped by molecular genetics. Previously, the gene encoding the VV soluble type I IFN inhibitor was mapped using VV mutants that contained genome deletions adjacent to either terminus (Symons et al., 1995 ). A similar approach was used here. Fortunately, one such deletion mutant of VV strain WR, called v6/2 and containing a large deletion near the left end of the genome (Moss et al., 1981 ), lacked the activity encoded by the parent virus (Fig. 2a), whereas other mutants, vGS100 and vSSK2, with deletions towards the right terminus (Symons et al., 1995 ) expressed the activity (Fig. 3b). This indicated that the gene encoding the inhibitory factor was likely to be present in the left end of the VV WR genome in the region deleted from VV 6/2 (Fig. 3a, second line).
|
To identify the encoding gene, EcoRI fragments of DNA from this region were cloned into plasmid pGS50 (Chakrabarti et al., 1985 ) within the TK gene and, via this vector, were inserted into the TK locus of VV strain Copenhagen (which lacks the activity). The supernatants taken from cells infected with these recombinant viruses were then tested for the biological activity as above. A Copenhagen virus containing an EcoRI fragment of 6·7 kb from the left end of the region deleted in v6/2 (Cop/E6.7) was found to contain the activity, whereas Copenhagen recombinants containing other EcoRI fragments of 4·8 kb and 1·5 kb (Cop/E1.5 and Cop/E4.8) did not (Fig. 3c). The 6·7 EcoRI fragment was analysed further by deletion of sequences from the left, centre or right end. Recombinant Copenhagen viruses that lacked an internal NcoI fragment from the right end of this fragment (Cop/ΔNc), or an internal MluI fragment from the central region (Cop/ΔM), both retained the activity, whereas a virus lacking a NsiIKpnI fragment from the left end (Cop/ΔNs-K) did not (Fig. 3d).
The published sequence of this region from VV WR (Kotwal & Moss, 1988b ) indicated that there was no open reading frame (ORF) likely to encode a secreted protein of greater than 5 kDa, but gel filtration analysis of the supernatants of VV WR-infected cells had revealed that the inhibitor was a polypeptide of approximately 15 kDa (data not shown). Therefore, the NsiIKpnI fragment that encoded the inhibitor was sequenced. This analysis detected differences from the published sequence. In particular, additional nucleotides were detected at two positions that caused frameshift changes and created a larger ORF that we called C12L (accession no. AF510447). This gene was predicted to encode a 126 amino acid protein of 14·5 kDa that contained an N-terminal signal peptide followed by a more hydrophilic domain that included a single putative N-linked glycosylation site (NFS). Without the signal peptide the predicted polypeptide size was 12·6 kDa. Subsequently, the sequences of human and mouse IL-18 bps were published and these showed amino acid similarity to C12L (Novick et al., 1999 ) and related proteins encoded by other poxviruses. A comparison of the WR C12L protein sequence with that of Lister, MVA and cowpox virus GRI-90 showed that whereas the Lister and MVA sequences were virtually identical, the WR sequence differed at 19 amino acids scattered throughout the protein. At 17 of these 19 positions the cowpox virus GRI-90 sequence was identical to WR.
To test if gene C12L encoded the inhibitor detected by bioassays, the C12L ORF was amplified by PCR, cloned into VV transfer plasmid pMJ601 (Davison & Moss, 1990 ) and expressed from VV strain Copenhagen (Cop/C12L). The C12L ORF was also expressed from recombinant baculovirus with or without a C-terminal tag of six histidine residues (AcC12Lhis and AcC12L, respectively). A protein of 13 kDa was detected in the supernatant of Cop/C12L-infected cells but was absent from the supernatants of cells infected with Cop/β-gal or from mock-infected cells (Fig. 4). Additionally, a protein of 13 kDa was detected in the supernatant of Sf21 cells infected with AcC12L but was absent from cells infected with AcNPV, Ac35K or mock-infected cells (data not shown). Moreover, VV strains WR and Cop/C12L (Fig. 5a) and baculovirus strains AcC12L and AcC12L-his (Fig. 5b) each expressed a factor that inhibited the IL-12-induced IFN-γ production from mouse splenocytes in a dose-dependent manner. In contrast, a control Copenhagen virus made with the empty transfer vector (Cop/β-gal) (Fig. 5a), AcNPV or recombinant baculovirus AcB15R expressing the VV WR B15R gene (Fig. 5b) did not express this activity. The level of inhibitor expressed by Cop/C12L was greater than VV WR, consonant with the use of a strong synthetic promoter to drive C12L in the Cop/C12L virus.
|
|
IL-12 and IL-18 act synergistically
To assess the relative contribution of IL-12 or IL-18 to the induction of IFN-γ following the stimulation of mouse splenocytes with IL-12, the splenocytes were incubated with increasing concentrations of IL-12 in the presence of 10 µg/ml of mAb specific for IL-12, IL-18, both mAbs or an isotype-matched control. After 24 h incubation the level of IFN-γ was determined by ELISA (Fig. 5c). These results showed that mAb to IL-12 was more effective than mAb to IL-18 in inhibiting the formation of IFN-γ, but both mAbs together reduced the level of IFN-γ close to background. This shows that IL-12 can induce IFN-γ directly and via induction and release of IL-18 as reported previously (Fantuzzi et al., 1999 ).
Gene C12L is expressed early during infection
The phase during infection at which the C12L gene was expressed by VV WR was determined by preparing supernatants from cultures that had been infected with VV WR in the presence or absence of 40 µg/ml AraC, an inhibitor of virus DNA replication and therefore late gene expression, and measuring whether these samples could inhibit IL-12-induced IFN-γ production in bioassay. The levels of IFN-γ produced from mouse splenocytes incubated with IL-12 and supernatants from cells mock-infected in the presence or absence of AraC were 5·3 and 5·2 ng/ml, respectively. In comparison, the levels of IFN-γ produced by splenocytes incubated with IL-12 and supernatants from cells infected with VV WR in the presence or absence of AraC were 0·61 and 0·93 ng/ml, respectively. In a second experiment, the supernatants from cells infected with VV WR in the presence or absence of AraC reduced the levels of IFN-γ produced from 12·1 ng/ml (supernatant from mock-infected cells) to 0·36 or 0·47 ng/ml, respectively. These data indicate the C12L gene is expressed early during infection.
The C12L gene is non-essential for virus replication
To explore the role of the C12L protein in virus replication we used VV strain WR to make a deletion mutant lacking the C12L gene. A control virus, in which the C12L gene was reinserted into its original locus, was also constructed. Analysis of the genomes of vC12L, vΔC12L and vC12L-R viruses by PCR confirmed that most of the C12L gene had been deleted from vΔC12L only, and that the genes flanking C12L were unchanged in each of the viruses (data not shown). Furthermore, no differences in the plaque morphology (data not shown) or yield of intracellular virus were noted following infection of BS-C-1 cells with vC12L, vΔC12L or vC12L-R (Fig. 6), indicating that C12L is not essential for replication of VV strain WR.
|
Inhibition of IL-18 by the C12L protein
The ability of the C12L protein to inhibit the biological activity of mouse IL-18 was investigated. IL-18 was added to mouse splenocytes in the presence or absence of various doses of supernatants from VV- or baculovirus-infected cells and the levels of IFN-γ in the supernatants were measured 24 h later by ELISA (Fig. 7). VV strains vC12L, vC12L-R and Cop/C12L inhibited IFN-γ-production whereas the deletion mutant vΔC12L and vCop/β-gal did not (Fig. 7a). Similarly, AcC12L and AcC12L-his inhibited IFN-γ production in this assay, whereas AcNPV, AcB15R and Ac35K-his did not (Fig. 7b).
|
Deletion of C12L attenuates VV virulence in mice
The virulence of recombinant VVs with or without the C12L protein was assessed in two murine models of infection. In the intradermal model, the deletion mutant produced the same lesion size as control viruses (data not shown), but in the intranasal model a phenotype was apparent. Groups of five mice were infected with 104 p.f.u. of vC12L, vΔC12L or vC12L-R and each animal was monitored daily for weight loss (Fig. 8a) and signs of illness such as ruffled fur, arched backs, reduced mobility or evidence of pneumonia (Fig. 8b). Mice infected with vΔC12L showed significantly milder signs of illness (P=<0·05, Student's t-test) and lost a maximum of 15% of their body weight. In contrast, animals infected with vC12L or vC12L-R showed more severe signs of illness and lost up to 2025% of their initial body weight. The attenuated phenotype of the deletion mutant was also indicated by reduced mortality data at 14 days p.i. After infection with 105 p.f.u. all animals (5/5) infected with vC12L and vC12L-R were sacrificed at humane endpoints, whereas 2/5 animals infected with vΔC12L survived. Together, these findings indicate that the IL-18 bp contributes to VV virulence in this model.
|
Several poxvirus immunomodulators were identified by computational comparison of proteins predicted from DNA sequence with protein databases. However, biological assays to screen the supernatants of infected cells for inhibitory activity have also been employed (Symons et al., 1995 ). Here we have used the latter method to identify an inhibitor of IL-12-induced IFN-γ production in the supernatant of VV-infected cells. Identification of the gene encoding this inhibitor was aided by a deletion mutant of VV WR called v6/2 that lacked a 12 kb region near the left terminus of the genome (Kotwal & Moss, 1988b ) and which, unlike its parent virus (WR), did not express the activity. By transferring smaller and smaller fragments of DNA from the region deleted in v6/2 to VV Copenhagen and testing for expression of the biological activity, the gene encoding the protein was identified as C12L. The sequence of VV WR DNA from this region indicated that the region corresponding to the C12L ORF was broken into three pieces (Kotwal & Moss, 1988b ). However, we found the sequence of VV WR to contain an additional nucleotide at two positions and to have a complete ORF that encoded a biologically active protein of 13 kDa. Surprisingly, the VV WR C12L protein showed several differences from the corresponding sequences of VV strains MVA (Antoine et al., 1998 ) and Lister (Smith et al., 2000 ) but was very similar to the sequence of cowpox virus strain GRI-90 (Shchelkunov et al., 1998 ).
The C12L protein is closely related to IL-18 bps from other poxviruses, man and mouse, and data presented here show that the C12L protein inhibits the biological activity of IL-18 in bioassays. However, the C12L protein did not prevent the binding of 125I-IL-12 to cells bearing IL-12Rs and could not be chemically cross-linked to 125I-IL-12 (data not shown). Previously, VV WR was shown to encode a protein that binds to human and murine IL-18, but the VV protein, unlike the related protein from ectromelia virus, was not used in bioassays (Smith et al., 2000 ). The identification of an IL-18 bp by mapping an inhibitor of IL-12-induced IFN-γ illustrates the synergy between IL-18 and IL-12 and this was shown further by using mAbs to IL-12, IL-18 or both cytokines in assays measuring IFN-γ production. Either mAb reduced the level of IFN-γ produced but maximum inhibition required both mAbs (Fig. 5c). Supernatants from VV WR- or Copenhagen-infected cells were only able to inhibit the IL-12-induced IFN-γ production if the C12L protein was expressed, indicating that these viruses do not encode another IL-12 soluble inhibitor.
The IL-18 bp is widely distributed in VV strains (14/16 tested), other orthopoxviruses and other poxvirus genera. This is in contrast to some other immunomodulators such as TNF-binding proteins (Alcamí et al., 1999 ) and the intracellular inhibitor of caspase 1 (Kettle et al., 1995 , 1997 ) that are present in only 3/16 and 5/14 strains, respectively. The distribution of the IL-18 bp is more like that of soluble inhibitors of IFN-γ (Alcamí & Smith, 1995 ) and IFN-α/β (Symons et al., 1995 ), which are expressed by the great majority of VV strains. This implies that IL-18 bp is important for virus replication (see below).
The importance of defensive strategies against IFN is illustrated further by the number of proteins encoded by VV that interfere with IFN production or function. Within VV-infected cells, the B13R protein inhibits the activity of caspase 1 (Kettle et al., 1997 ), an enzyme required for the cleavage of pro-IL-1β and pro-IL-18 into the mature cytokines IL-1β and IL-18 (IFN-γ inducing factor). Outside the cell, IL-18 is bound and inhibited by the C12L protein so that IFN-γ production is restricted. Moreover, the binding of IFN-γ to its receptor is inhibited by the B8R protein (Alcamí & Smith, 1995 ), and the action of type I IFNs is inhibited by the VV B18R protein in solution and on the cell surface (Colamonici et al., 1995 ; Symons et al., 1995 ; Alcamí et al., 2000 ). Within infected cells the E3L (Chang et al., 1992 ) and K3L (Beattie et al., 1991 ) proteins inhibit the activity of IFN-induced antiviral proteins. The IL-18 bp represents another VV-encoded protein that is likely to combat IFN by restricting IFN-γ production and thereby diminish the Th1 response to infection. Notably, the IL-18 bp and all the above proteins that combat IFNs are expressed early during infection, consistent with the need for VV to prevent the potent antiviral activity of IFNs as soon as possible. Some other immunomodulators made by VV such as the CC chemokine binding protein (Alcamí et al., 1998 ) and the related secreted protein encoded by A41L (Ng et al., 2001 ) are expressed early but also later during infection, and the IL-1β receptor (Alcamí & Smith, 1992 ) and TNF binding proteins are expressed late in infection (Alcamí et al., 1999 ; Reading et al., 2002 ).
The role of the C12L protein in virus replication was assessed in vitro and in vivo. In vitro the plaque size and growth kinetics (Fig. 6) were unaltered, but in vivo the virulence of the deletion mutant was reduced in the murine intranasal model compared to wild-type and revertant controls (Fig. 8). The importance of IL-18 in combating poxvirus infection is illustrated by the reduced pock formation on the tails of mice inoculated intravenously with VV, as well as augmenting NK and CTL activity (Tanaka-Kataoka et al., 1999 ). Previously, an ectromelia virus mutant engineered to lack the IL-18 binding protein (p13) was injected intraperitoneally into mice (Born et al., 2000 ). An enhanced local NK cell response was reported compared to parental virus but a revertant control was not used and the virulence of the virus was not reported.
The attenuation observed here in the intranasal model may be contrasted with that resulting from deletion of the B13R (Kettle et al., 1995 ) and B8R (Symons et al., 2002 ) genes, which gave no phenotype in this model. In the case of B13R, although no phenotype was observed in the intranasal model, the deletion mutant caused an enhanced lesion size in the intradermal model (Tscharke et al., 2002 ). For B8R, the lack of attenuation in the mouse intranasal model is consistent with the low affinity of this protein for mouse IFN-γ (Symons et al., 2002 ) and the failure to inhibit the biological activity of mouse IFN-γ (Alcamí & Smith, 1995 ).
In summary, we have used a bioassay to identify an inhibitor of IL-12-induced IFN-γ production and molecular genetics to map the inhibitor to gene C12L, which encodes the VV IL-18 bp. This demonstrates the synergy in action of IL-12 and IL-18. A virus deletion mutant grew normally in vitro but was attenuated in a mouse intranasal model illustrating the importance of controlling IL-18 in a systemic poxvirus infection.
This work was supported by a programme grant from The Wellcome Trust. P.C.R. was a Howard Florey Fellow and G.L.S. is a Wellcome Trust Principal Research Fellow.Footnotes
The nucleotide sequence of the vaccinia virus strain Western Reserve C12L gene has been deposited at GenBank and assigned accession no. AF510447.a Present address: Roche Biosciences, 3401 Hillview Avenue, Palo Alto, CA 94304, USA.
b Present address: Laboratory of Viral Diseases, NIAID, NIH, Bethesda, MD 20892, USA.
References
Alcamí, A. & Koszinowski, U. H. (2000). Viral mechanisms of immune evasion. Trends in Microbiology 8, 410-418.[Medline]
Alcamí, A. & Smith, G. L. (1992). A soluble receptor for interleukin-1 beta encoded by vaccinia virus: a novel mechanism of virus modulation of the host response to infection. Cell 71, 153-167.[Medline]
Alcamí, A. & Smith, G. L. (1995). Vaccinia, cowpox, and camelpox viruses encode soluble gamma interferon receptors with novel broad species specificity. Journal of Virology 69, 4633-4639.[Abstract]
Alcamí, A. & Smith, G. L. (1996). A mechanism for the inhibition of fever by a virus. Proceedings of the National of Academy of Sciences, USA 93, 11029-11034.
Alcamí, A. & Smith, G. L. (2002). The vaccinia virus soluble interferon-γ receptor is a homodimer. Journal of General Virology 83, 545-549.
Alcamí, A., Symons, J. A., Collins, P. D., Williams, T. J. & Smith, G. L. (1998). Blockade of chemokine activity by a soluble chemokine binding protein from vaccinia virus. Journal of Immunology 160, 624-633.
Alcamí, A., Khanna, A., Paul, N. L. & Smith, G. L. (1999). Vaccinia virus strains Lister, USSR and Evans express soluble and cell surface tumour necrosis factors receptor. Journal of General Virology 80, 949-959.[Abstract]
Alcamí, A., Symons, J. A. & Smith, G. L. (2000). The vaccinia soluble IFN-α/β receptor binds to the cell surface and protects cells from the anti-viral effects of IFN. Journal of Virology 74, 11230-11239.
Antoine, G., Scheiflinger, F., Dorner, F. & Falkner, F. G. (1998). The complete genomic sequence of the modified vaccinia Ankara strain: comparison with other orthopoxviruses. Virology 244, 365-396.[Medline]
Bartlett, N., Symons, J. A., Tscharke, D. C. & Smith, G. L. (2002). The vaccinia virus N1L protein is an intracellular homodimer that promotes virulence. Journal of General Virology 83, 1965-1976.
Beattie, E., Tartaglia, J. & Paoletti, E. (1991). Vaccinia-virus encoded eIF-2α homolog abrogates the antiviral effect of interferon. Virology 183, 419-422.[Medline]
Born, T. L., Morrison, L. A., Esteban, D. J., VandenBos, T., Thebeau, L. G., Chen, N., Spriggs, M. K., Sims, J. E. & Buller, R. M. L. (2000). A poxvirus protein that binds to and inactivates IL-18, and inhibits NK cell response. Journal of Immunology 164, 3246-3254.
Chakrabarti, S., Brechling, K. & Moss, B. (1985). Vaccinia virus expression vector: coexpression of β-galactosidase provides visual screening of recombinant virus plaques. Molecular and Cellular Biology 5, 3403-3409.
Chang, H.-W., Watson, J. C. & Jacobs, B. L. (1992). The E3L gene of vaccinia virus encodes an inhibitor of the interferon-induced, double-stranded RNA-dependent protein kinase. Proceedings of the National of Academy of Sciences, USA 89, 4825-4829.
Colamonici, O. R., Domanski, P., Sweitzer, S. M., Larner, A. & Buller, R. M. L. (1995). Vaccinia virus B18R gene encodes a type I interferon-binding protein that blocks interferon alpha transmembrane signaling. Journal of Biological Chemistry 270, 15974-15978.
Comeau, M. R., Johnson, R., DuBose, R. F., Petersen, M., Gearing, P., VandenBos, T., Park, L., Farrah, T., Buller, R. M., Cohen, J. I., Strockbine, L. D., Rauch, C. & Spriggs, M. K. (1998). A poxvirus-encoded semaphorin induces cytokine production from monocytes and binds to a novel cellular semaphorin receptor, VESPR. Immunity 8, 473-482.[Medline]
Davison, A. J. & Moss, B. (1990). New vaccinia virus recombination plasmids incorporating a synthetic late promoter for high level expression of foreign proteins. Nucleic Acids Research 18, 4285-4286.
Falkner, F. G. & Moss, B. (1988). Escherichia coli gpt gene provides dominant selection for vaccinia virus open reading frame expression vectors. Journal of Virology 62, 1849-1854.
Falkner, F. G. & Moss, B. (1990). Transient dominant selection of recombinant vaccinia viruses. Journal of Virology 64, 3108-3111.
Fantuzzi, G., Reed, D. A. & Dinarello, C. A. (1999). IL-12-induced IFN-gamma is dependent on caspase-1 processing of the IL- 18 precursor. Journal of Clinical Investigation 104, 761-767.[Medline]
Gardner, J. D., Tscharke, D. C., Reading, P. C. & Smith, G. L. (2001). Vaccinia virus semaphorin A39R is a 5055 kDa secreted glycoprotein that affects the outcome of infection in a murine intradermal model. Journal of General Virology 82, 2083-2093.
Gately, M. K., Renzetti, L. M., Magram, J., Stern, A. S., Adorini, L., Gubler, U. & Presky, D. H. (1998). The interleukin-12/interleukin-12-receptor system: role in normal and pathologic immune responses. Annual Review of Immunology 16, 495-521.[Medline]
Graham, K. A., Lalani, A. S., Macen, J. L., Ness, T. L., Barry, M., Liu, L., Lucas, A., Clark-Lewis, I., Moyer, R. W. & McFadden, G. (1997). The T1/35kDa family of poxvirus-secreted proteins bind chemokines and modulate leukocyte influx into virus-infected tissues. Virology 229, 12-24.[Medline]
Hughes, S. J., Johnston, L. H., de Carlos, A. & Smith, G. L. (1991). Vaccinia virus encodes an active thymidylate kinase that complements a cdc8 mutant of Saccharomyces cerevisiae. Journal of Biological Chemistry 266, 20103-20109.
Kerr, S. M. & Smith, G. L. (1991). Vaccinia virus DNA ligase is nonessential for virus replication: recovery of plasmids from virus-infected cells. Virology 180, 625-632.[Medline]
Kettle, S., Blake, N. W., Law, K. M. & Smith, G. L. (1995). Vaccinia virus serpins B13R (SPI-2) and B22R (SPI-1) encode Mr 38·5 and 40K, intracellular polypeptides that do not affect virus virulence in a murine intranasal model. Virology 206, 136-147.[Medline]
Kettle, S., Alcamí, A., Khanna, A., Ehret, R., Jassoy, C. & Smith, G. L. (1997). Vaccinia virus serpin B13R (SPI-2) inhibits interleukin-1β-converting enzyme and protects virus-infected cells from TNF- and Fas-mediated apoptosis, but does not prevent IL-1β-induced fever. Journal of General Virology 78, 677-685.[Abstract]
Kotwal, G. J. & Moss, B. (1988a). Vaccinia virus encodes a secretory polypeptide structurally related to complement control proteins. Nature 335, 176-178.[Medline]
Kotwal, G. J. & Moss, B. (1988b). Analysis of a large cluster of nonessential genes deleted from a vaccinia virus terminal transposition mutant. Virology 167, 524-537.[Medline]
Kotwal, G. J., Isaacs, S. N., McKenzie, R., Frank, M. M. & Moss, B. (1990). Inhibition of the complement cascade by the major secretory protein of vaccinia virus. Science 250, 827-830.
Lee, H. J., Essani, K. & Smith, G. L. (2001). The genome sequence of Yaba-like disease virus, a yatapoxvirus. Virology 281, 170-192.[Medline]
Mackett, M., Smith, G. L. & Moss, B. (1985). The construction and characterization of vaccinia virus recombinants expressing foreign genes. In DNA Cloning: a Practical Approach , pp. 191-211. Edited by D. M. Glover. Oxford:IRL Press.
Moss, B., Winters, E. & Cooper, J. A. (1981). Deletion of a 9,000-base-pair segment of the vaccinia virus genome that encodes nonessential polypeptides. Journal of Virology 40, 387-395.
Mossman, K., Upton, C., Buller, R. M. & McFadden, G. (1995). Species specificity of ectromelia virus and vaccinia virus interferon-gamma binding proteins. Virology 208, 762-769.[Medline]
Nakanishi, K., Yoshimoto, T., Tsutsui, H. & Okamura, H. (2001). Interleukin-18 regulates both Th1 and Th2 responses. Annual Review of Immunology 19, 423-474.[Medline]
Ng, A., Tscharke, D. C., Reading, P. C. & Smith, G. L. (2001). The vaccinia virus A41L protein is a soluble 30 kDa glycoprotein that affects virus virulence. Journal of General Virology 82, 2095-2105.
Novick, D., Kim, S. H., Fantuzzi, G., Reznikov, L. L., Dinarello, C. A. & Rubinstein, M. (1999). Interleukin-18 binding protein: a novel modulator of the Th1 cytokine response. Immunity 10, 127-136.[Medline]
Reading, P. C., Khanna, A. & Smith, G. L. (2002). Vaccinia virus CrmE encodes a soluble and cell surface tumor necrosis factor receptor that contributes to virus virulence. Virology 292, 285-298.[Medline]
Robinson, D., Shibuya, K., Mui, A., Zonin, F., Murphy, E., Sana, T., Hartley, S. B., Menon, S., Kastelein, R., Bazan, F. & O'Garra, A. (1997). IGIF does not drive Th1 development but synergizes with IL-12 for interferon-gamma production and activates IRAK and NFkappaB. Immunity 7, 571-581.[Medline]
Shchelkunov, S. N., Safronov, P. F., Totmenin, A. V., Petrov, N. A., Ryazankina, O. I., Gutorov, V. V. & Kotwal, G. J. (1998). The genomic sequence analysis of the left and right species-specific terminal region of a cowpox virus strain reveals unique sequences and a cluster of intact ORFs for immunomodulatory and host range proteins. Virology 243, 432-460.[Medline]
Shchelkunov, S. N., Totmenin, A. V., Babkin, I. V., Safronov, P. F., Ryazankina, O. I., Petrov, N. A., Gutorov, V. V., Uvarova, E. A., Mikheev, M. V., Sisler, J. R., Esposito, J. J., Jahrling, P. B., Moss, B. & Sandakhchiev, L. S. (2001). Human monkeypox and smallpox viruses: genomic comparison. FEBS Letters 509, 66-70.[Medline]
Sims, J. E. (2002). IL-1 and IL-18 receptors, and their extended family. Current Opinion in Immunology 14, 117-122.[Medline]
Smith, G. L. (2000). Secreted poxvirus proteins that interact with the immune system. In Effects of Microbes on the Immune System , pp. 491-507. Edited by M. W. Cunningham & R. S. Fujinami. Philadelphia:Lippincott Williams & Wilkins.
Smith, G. L. & Chan, Y. S. (1991). Two vaccinia virus proteins structurally related to the interleukin-1 receptor and the immunoglobulin superfamily. Journal of General Virology 72, 511-518.
Smith, C. A., Davis, T., Anderson, D., Solam, L., Beckmann, M. P., Jerzy, R., Dower, S. K., Cosman, D. & Goodwin, R. G. (1990). A receptor for tumor necrosis factor defines an unusual family of cellular and viral proteins. Science 248, 1019-1023.
Smith, C. A., Smith, T. D., Smolak, P. J., Friend, D., Hagen, H., Gernart, M., Park, L., Pickup, D. J., Torrance, D., Mohler, K., Schooley, K. & Goodwin, R. G. (1997). Poxvirus genomes encode a secreted, soluble protein that preferentially inhibits β chemokine activity yet lacks sequence homology to known chemokine receptors. Virology 236, 316-327.[Medline]
Smith, V. P., Bryant, N. A. & Alcamí, A. (2000). Ectromelia, vaccinia and cowpox viruses encode secreted interleukin-18-binding proteins. Journal of General Virology 81, 1223-1230.
Spriggs, M., Hruby, D. E., Maliszewski, C. R., Pickup, D. J., Sims, J. E., Buller, R. M. L. & Vanslyke, J. (1992). Vaccinia and cowpox viruses encode a novel secreted interleukin-1 binding protein. Cell 71, 145-152.[Medline]
Symons, J. A., Alcamí, A. & Smith, G. L. (1995). Vaccinia virus encodes a soluble type I interferon receptor of novel structure and broad species specificity. Cell 81, 551-560.[Medline]
Symons, J. A., Tscharke, D. C., Price, N. & Smith, G. L. (2002). A study of the vaccinia virus interferon-γ receptor and its contribution to virus virulence. Journal of General Virology 83, 1953-1964.
Tanaka-Kataoka, M., Kunikata, T., Takayama, S., Iwaki, K., Ohashi, K., Ikeda, M. & Kurimoto, M. (1999). In vivo antiviral effect of interleukin 18 in a mouse model of vaccinia virus infection. Cytokine 11, 593-599.[Medline]
Tomonari, K. (1988). A rat antibody against a structure functionally related to the mouse T-cell receptor/T3 complex. Immunogenetics 28, 455-458.[Medline]
Tortorella, D., Gewurz, B. E., Furman, M. H., Schust, D. J. & Ploegh, H. L. (2000). Viral subversion of the immune system. Annual Review of Immunology 18, 861-926.[Medline]
Tscharke, D. C. & Smith, G. L. (1999). A model for vaccinia virus pathogenesis and immunity based on intradermal injection of mouse ear pinnae. Journal of General Virology 80, 2751-2755.
Tscharke, D. C., Reading, P. C. & Smith, G. L. (2002). Dermal infection with vaccinia virus reveals roles for virus proteins not seen using other inoculation routes. Journal of General Virology 83, 1977-1986.
Upton, C., Mossman, K. & McFadden, G. (1992). Encoding of a homolog of IFN-γ receptor by myxoma virus. Science 258, 1369-1372.
Xiang, Y. & Moss, B. (1999a). IL-18 binding and inhibition of interferon gamma induction by human poxvirus-encoded proteins. Proceedings of the National of Academy of Sciences, USA 96, 11537-11542.
Xiang, Y. & Moss, B. (1999b). Identification of human and mouse homologs of the MC51L53L54L family of secreted glycoproteins encoded by the molluscum contagiosum poxvirus. Virology 257, 297-302.[Medline]
Xiang, Y. & Moss, B. (2001a). Correspondence of the functional epitopes of poxvirus and human interleukin-18-binding proteins. Journal of Virology 75, 9947-9954.
Xiang, Y. & Moss, B. (2001b). Determination of the functional epitopes of human interleukin-18-binding protein by site-directed mutagenesis. Journal of Biological Chemistry 276, 17380-17386.
Yoshimoto, T., Takeda, K., Tanaka, T., Ohkusu, K., Kashiwamura, S., Okamura, H., Akira, S. & Nakanishi, K. (1998). IL-12 up-regulates IL-18 receptor expression on T cells, Th1 cells, and B cells: synergism with IL-18 for IFN-gamma production. Journal of Immunology 161, 3400-3407.