Abstract
IFN-γ is a pleiotropic cytokine that promotes the Th1 immune response and also has direct antiviral activity (Farrar & Schreiber, 1993 ). It is a secreted, 17 kDa glycoprotein that binds to the IFN-γR on the surface of cells. This interaction triggers dimerization of the receptor (Fountoulakis et al., 1991 , 1992 ; Greenlund et al., 1993 ), leading to signal transduction. The crystal structure of IFN-γ showed that the protein is largely α-helical and exists as a dimer (Ealick et al., 1991 ; Samudzi et al., 1991 ; Walter et al., 1995 ). The IFN-γR is an 8590 kDa glycoprotein with a type I membrane topology, it has 2 fibronectin type III repeats and is a member of the class II cytokine receptor superfamily (Farrar & Schreiber, 1993 ). Only a single IFN-γR exists and transgenic mice lacking this protein show an enhanced sensitivity to infection with VV and other viruses (Huang et al., 1993 ). Likewise, treating animals with IFN-γ increases their resistance to virus infection (Karupiah et al., 1993 ; van den Broek et al., 1995 ).
The VV B8R protein has amino acid similarity to the T7 protein of myxoma virus (Howard et al., 1991 ) that binds and inhibits rabbit IFN-γ (Upton et al., 1992 ). Subsequently, the VV B8R gene was shown to encode a 43 kDa secreted glycoprotein that inhibits IFN-γ from human, cow, rabbit, rat and chicken but not mouse (Alcamí & Smith, 1995 ; Mossman et al., 1995 ; Puehler et al., 1998 ). The broad species specificity was unexpected because IFN-γ and IFN-γR from cells are largely species-specific. Nonetheless, deletion of the B8R gene from VV was reported to cause virus attenuation in a mouse model (Verardi et al., 2001 ). Recently, the VV B8R protein was shown to be a homodimer in the absence of ligand, unlike the cellular IFN-γR that dimerizes upon ligand binding (Alcamí & Smith, 2002 ).
Here we have studied the role of the VV IFN-γR in virus virulence by the construction of WT and deletion viruses and a recombinant virus expressing a soluble form of the mouse IFN-γR. These viruses replicated normally in cell culture but showed differences in vivo.
Cells and viruses.BS-C-1, RK13, HeLa D980R, TK-143 and Cos-7 cells were grown in Dulbeccos modified Eagles medium (DMEM) containing 10% foetal bovine serum (FBS). Equine dermal cells were grown in minimal essential medium (MEM) containing 10% FBS and were obtained from Dr Jay Patel (Akzo Nobel). The Western Reserve (WR) strain of VV was used throughout and was grown, titrated and purified as described (Mackett et al., 1985 ). Cocal virus was obtained from Dr W. James (Sir William Dunn School of Pathology, University of Oxford) and Semliki Forest virus (SFV) was obtained from Dr Jay Patel (Akzo Nobel).
Reagents.
Radioiodinated human IFN-γ (125I-hIFN-γ; specific activity 50125 µCi/µg) was obtained from New England Nuclear Life Science Products. Purified recombinant hIFN-γ (3x107 U/mg) was obtained from PeproTech Ltd (London, UK) and recombinant mouse IFN-γ (5x106 U/mg) was obtained from Genzyme and R&D Systems. Equine IFN-γ was obtained by transfection of Cos-7 cells with pCIneo/Eq-IFNγ (a gift from Dr Jay Patel). The supernatant was harvested 5 days later, centrifuged at 10000 g to remove cellular debris and the equine IFN-γ was titrated as described below. One unit of equine IFN-γ was defined as that which reduced SFV plaque formation by 50%. Typically Cos-7 supernatants contained approximately 70 U/ml IFN-γ.
Hamster monoclonal antibody (mAb) against the mIFN-γ receptor (alpha chain) was obtained from Genzyme. Biotinylated goat anti-hamster IgG was obtained from Vector Laboratories and streptavidinhorseradish peroxidase was from Amersham.
Primer extension analysis.
RNA was isolated from RK13 cells that had been mock-infected or infected with VV at 10 p.f.u. per cell for 6 h in the presence or absence of 100 µg/ml cycloheximide or for 16 h in the presence or absence of 40 µg/ml cytosine arabinoside (AraC) as described previously (Ausubel et al., 1990 ). Oligonucleotide 5' CTTATAACTAGTTATTTTAGCGTGTATAC 3' was labelled at the 5' end with 32P by incubation with [γ-32P]ATP (10 µCi/ml, 3000 Ci/mM, Amersham) and T4 polynucleotide kinase (New England Biolabs) and hybridized to 10 µg of denatured RNA samples. The nucleotide primer was extended with reverse transcriptase (RNase H-) (GibcoBRL) and the sample was electrophoresed on a 6% polyacrylamide gel alongside a 35S-labelled DNA sequencing ladder and detected by autoradiography.
Isolation of RNA and preparation of cDNA from EL-4 cells.
Total cellular RNA was isolated from the murine thymoma cell line EL-4.NOB1 using RNAzol (Biogenesis Ltd, Poole, UK), following the manufacturers instructions. Complementary DNA was synthesized using 5 µg of RNA, oligo(dT) and avian myeloblastosis virus reverse transcriptase (Promega).
Construction of recombinant viruses.
A virus deletion mutant lacking 96% of the B8R ORF was constructed using transient dominant selection (Falkner & Moss, 1990 ). A plasmid was assembled that contained the DNA flanking the 5' and 3' regions of the B8R ORF. These fragments were amplified by PCR using Pyrococcus furiosus DNA polymerase and VV WR DNA as template. The left flanking region was amplified with oligonucleotides 5' CTAGAATTCAACGCAGAGGTCACACG 3' (B8R1F) and 5' ATCCCCGGGTGTTGTTTGTTATTTGAC 3' (B8R1R) that contain EcoRI and SmaI sites, respectively (underlined). The right flanking region was amplified with oligonucleotides 5' CCAGGATCCTTAGCATGCTTAACTTGAC 3' (B8R2F) and 5' TCAAAGCTTCACTTGCAGTTGGG 3' (B8R2R) that contain BamHI and HindIII sites (underlined), respectively. These fragments were digested with the appropriate restriction enzymes and cloned sequentially into plasmid pSJH7 (Hughes et al., 1991 ) that had been cut with the same enzymes. The resultant plasmid, termed pΔB8R, contained 319 and 302 nucleotides of the 5' and 3' flanking sequence, respectively, including 30 nucleotides of coding sequence at the 3' end of the gene. The DNA sequence was determined and shown to be correct.
Plasmid pΔB8R was transfected into VV-infected cells and mycophenolic acid (MPA)-resistant recombinant viruses were isolated as described (Falkner & Moss, 1990 ). These were grown on hypoxanthine guanine phosphoribosyltransferase-negative D980R cells in the presence of 6-thioguanine (TG) (Kerr & Smith, 1991 ) and plaque isolates corresponding to WT (vB8R) or deletion mutant (vΔB8R) were identified by PCR using oligonucleotides that span the B8R gene locus.
A revertant virus (vB8R-R) was constructed by transfecting a plasmid (pB8R-R) into vΔB8R-infected cells. This plasmid was constructed by digesting pSTH1 (Engelstad & Smith, 1993 ) with PstI and SphI and the resulting 1003 bp fragment containing the entire B8R ORF and flanking regions was cloned into pΔB8R that had been cut with the same enzymes. The DNA sequence was determined and shown to be correct. MPA-resistant intermediate viruses were isolated as above and resolved into deletion mutant and revertant viruses (vB8R-R) on D980R cells in the presence of 6-TG as described.
A recombinant virus that expressed a soluble version of the mouse IFN-γR (vsmIFN-γR) was constructed as follows. The extracellular domain of the mouse IFN-γR alpha chain (amino acids 1257) was amplified by PCR with EL-4.NOB1 cDNA as a template using the primers 5' ACAACACCATGGGCCCGCAGGCGGC 3' (IFN-γR/B8R5') and 5' AAATTAGTTATGAATCCTTTCTGTCATC 3' (IFN-γR/B8R3'). This was fused to the B8R promoter using splicing by overlap extension (Horton et al., 1989 ). The 5' and 3' flanking regions of the B8R ORF were amplified by PCR with VV WR DNA as a template using the primers 5' GCCGCCTGCGGGCCCATGGTGTTGTTTGTTATTTG 3' (B8R5'/IFN-γR) and B8R1F (above) and 5' GATGACAGAAAGGATTCATAACTAATTTTTATTAATGATACAAAAACG 3' (B8R3'/IFN-γR) and B8R2R (above). VV sequences are shown in plain type, mouse IFN-γR alpha chain sequences in bold type and initiation and stop codons are underlined. These three PCR products were reamplified using the B8R1F and B8R2R primers and the assembled DNA fragment was then digested with EcoRI and HindIII and cloned into pSJH7 that had been cut with the same enzymes, to form plasmid pB8R/smIFNγR. DNA sequence analysis showed the sequence was correct.
Plasmid pB8R/smIFNγR was transfected into vΔB8R-infected cells and a virus expressing the soluble murine IFN-γR alpha chain (vsmIFN-γR) under control of the B8R promoter was isolated by transient dominant selection as above. This virus was used to generate a vΔB8R-revertant virus (vΔB8R-R) in which the mouse vIFN-γR gene was removed and the B8R locus was restored to that of the parental virus vΔB8R. Cells infected with vsmIFN-γR were transfected with pΔB8R and the revertant virus was generated by transient dominant selection as above.
Preparation of supernatants from virus-infected cells.
TK-143B cells were infected at 5 p.f.u. per cell. At the indicated times supernatants were harvested and centrifuged at 3000 r.p.m. for 10 min at 4 °C to remove cellular debris. Virus particles were removed by centrifugation at 16500 r.p.m. in an SW41 Ti rotor for 60 min at 4 °C and the supernatants were stored at -20 °C.
Construction and expression of a B8RFc fusion protein.
The VV WR B8R gene fused to the Fc region of human IgG1 was constructed in pCOSFCLINK (a generous gift from Dr Peter R. Young, SmithKline Beecham Pharmaceuticals, King of Prussia, PA, USA). The chimaera was obtained by PCR using VV WR DNA as template and the oligonucleotides 5' GTCGAATTCCAAACAACACCATGAG 3' (EcoRI site, underlined) and 5' ATTGGTACCTGAATATTTAGTCAAG 3' (that inserts a Gly and Thr via a KpnI site, underlined, after amino acid 272 of the B8R protein before the hinge region of human IgG1 that was provided by the pCOSFCLINK plasmid). The resultant plasmid was called pCOS B8R-Fc. The sequence of the B8R gene was confirmed as identical to that reported previously. The plasmid was transfected into DHFR- CHO cells and stable transfectants were selected in increasing concentrations of methotrexate (MTX; Sigma) up to a final concentration of 10 µM. B8RFc fusion protein production was quantified using an ELISA for human IgG1 Fc. CHO cells expressing B8RFc fusion protein were adapted to grow in defined medium (CHO-S-SFM II; GibcoBRL) and the B8RFc fusion protein was purified from the supernatant on a protein ASepharose column (Pharmacia). Expression of the 35KFc fusion protein has been described (Alcamí et al., 1998 ).
Biological assays for IFN.
The biological activity of hIFN-γ was measured by the inhibition of cocal virus plaque formation as described (Alcamí & Smith, 1995 ). The biological activity of equine IFN-γ was measured by the inhibition of SFV plaque formation on equine dermal cells. Cells were pretreated with 10 U of equine IFN-γ for 24 h. The cells were then infected with 100 p.f.u. of SFV and plaques were stained and counted 48 h p.i.
Binding assays.
Covalent cross-linking of 125I-hIFNγ to supernatants from VV-infected cells was performed as described (Alcamí & Smith, 1995 ).
BIAcore analysis.
Surface plasmon resonance (SPR) experiments used a BIAcore 2000 (BIAcore, St. Albans, UK) (Nicholson et al., 1998 ). The purified mAb R10ZD9 (anti-human IgGFc; a gift from Dr P. Anton van der Merwe) was immobilized to CM5 sensor chips (BIAcore) using the Amine Coupling Kit (BIAcore) with a flow rate of 10 µl/min. Immobilized R10ZD9 was regenerated with no loss of IgGFc binding by sequential injections of 10 mM NaOH and 0·1 M glycine, pH 2·5. B8RFc and 35KFc (control) fusion proteins were coupled by injection at 30 µg/ml for 10 min at a flow rate of 5 µl/min. For kinetic experiments, mouse and human IFN-γ were injected in 50 µl at 50 µl/min at various concentrations between 100 pM and 1·0 µM. Kinetic constants were derived using the curve-fitting facility of the BIAevaluation program (version 3.0, BIAcore) using a simple 1:1 binding model. To correct for refractive index changes, binding responses generated in the control surface (35KFc) were subtracted from responses generated in the B8RFc surface.
Ligand blotting.
Proteins from supernatants from VV- or baculovirus-infected cells and purified Fc fusion proteins were resolved by SDSPAGE under non-reducing conditions on a 10% gel and transferred onto 0·45 µM nitrocellulose (Schleicher and Schuell). The filters were blocked in 3 % (w/v) non-fat skimmed milk in 10 mM TrisHCl (pH 7·4), 140 mM NaCl, 0·02% (w/v) NaN3 overnight at 4 °C, and then probed with 5 ng/ml 125I-hIFN-γ in blocking buffer with or without 1 mg/ml cold IFN-γ for 4 h at room temperature. Blots were then washed, dried in air and exposed to X-ray film.
Immunoblotting for mouse IFN-γR alpha chain.
Virus-free supernatants from 6x104 cells were resolved by SDSPAGE under non-reducing conditions on a 12·5% polyacrylamide gel and transferred onto nitrocellulose (Hybond-ECL; Amersham). After blocking in 5% (w/v) nonfat skimmed milk in PBS0·1 % (v/v) Tween 20, the membrane was incubated sequentially with a hamster mAb against mouse IFN-γR alpha chain (Genzyme) at 1 µg/ml, biotinylated anti-hamster IgG conjugate (Vector Laboratories) at 1·5 µg/ml, and finally streptavidinhorseradish peroxidase conjugate (1:1500; Amersham). Immunoreactive bands were visualized by enhanced chemiluminescence.
Assays of viral virulence.
Intranasal infection of female, BALB/c mice (56 weeks old) was performed as described (Symons et al., 1995 ). Each day, mice were weighed individually and monitored for signs of illness. Those having lost 30% of their initial body weight were sacrificed.
For intradermal infection, 104 p.f.u. of recombinant VV in 10 µl of PBS was injected into the ear pinnae of female BALB/c mice between 8 and 12 weeks of age. The diameter of lesions was measured daily as described (Tscharke & Smith, 1999 ).
Female New Zealand White rabbits (1·5 kg) were injected intradermally with 104, 105 or 106 p.f.u. of the indicated viruses/site in 0·1 ml of PBS along the flanks of the animal. Animals were monitored daily for signs of illness and the lesion size was measured with fine calipers. At 3 and 5 days p.i. animals were sacrificed and lesions excised for immunohistochemical analysis.
Immunohistochemistry.
Rabbit dermal samples were prepared and immunostained using anti-rabbit CD43 antibody (IgG1; Serotec) to detect rabbit T cells, monocytes and macrophages, or mouse mAb 5B4/2F2 against the VV A27L protein (Czerny & Mahnel, 1990 ) as described previously (Ng et al., 2001 ). Sections were counterstained with 0·1% (w/v) cresyl violet acetate, dehydrated, mounted and examined as described previously (Ng et al., 2001 ). Several 10 µm sections were examined to ensure that those shown are representative.
|
Construction of deletion and revertant viruses
The role of the B8R gene in VV replication in vitro and in vivo was investigated using WT (vB8R), deletion mutant (vΔB8R) and revertant (vB8R-R) viruses. The relative contributions of the VV IFN-γR and soluble mouse IFN-γR to VV virulence in mice was compared by constructing a recombinant virus (vsmIFN-γR) that expressed the mouse IFN-γR alpha chain truncated after Ser-257 so that it would be secreted from the cell. The vsmIFN-γR was compared with parental (vΔB8R) and revertant (vΔB8R-R) viruses.
The genomes of these five viruses were analysed by Southern blot analysis (see supplementary data 1 at JGV Online: http://vir.sgmjournals.org). This showed that the genomes of the recombinant viruses were as predicted.
Growth properties of the recombinant viruses in vitro
The plaque phenotype of all viruses was normal on BS-C-1 cells (data not shown). However, this analysis might not detect minor differences in virus replication and therefore the growth properties were investigated after infection of BS-C-1 cells at 0·01 p.f.u. per cell. Over a 48 h period the rate of increase in virus titre and the final titre attained were indistinguishable for all viruses (Fig. 2).
|
Expression of IFN-γRs by recombinant viruses
The ability of the viruses to express soluble proteins that bound IFN-γ was measured by ligand blotting and bioassay. First, proteins in the supernatants of mock-infected cells or cells infected with vB8R, vΔB8R and vB8R-R were tested for binding to human IFN-γ by cross-linking with EDC followed by SDSPAGE and autoradiography. vB8R and vB8R-R expressed a protein that cross-linked with human IFN-γ and the formation of this complex was inhibited by a 100-fold excess of cold human IFN-γ but not IFN-α (data not shown). In contrast, vΔB8R did not express this protein, confirming that B8R was the only VV gene encoding such an activity.
The expression of soluble mouse IFN-γR by vsmIFN-γR was demonstrated by bioassay (Fig. 3a). Mouse IFN-γ prevented the formation of plaques by cocal virus on mouse L929 cells and this activity was inhibited in a dose-dependent manner by the supernatants from cells infected with vsmIFN-γR but not by those from WR- or vΔB8R-infected cells. This showed that vsmIFN-γR expressed a soluble protein that inhibited mouse IFN-γ and confirmed that the IFN-γR made by VV WR does not inhibit mouse IFN-γ. Immunoblotting with a mAb specific for the mouse IFN-γR alpha chain confirmed expression of the mouse soluble IFN-γR (3840 kDa) (Fig. 3b). The mouse IFN-γR gene was expressed from the VV B8R promoter to mimic the temporal regulation of the B8R gene. Early expression was confirmed by infecting cells with vsmIFN-γR with or without AraC and observing similar levels of protein.
|
Expression of B8R as an Fc-fusion protein
To produce recombinant B8R protein from a mammalian source, the B8R protein was fused to the Fc domain of human IgG1 and expressed from transfected COS cells using methodology described previously for the CC chemokine-binding protein of VV strain Lister (Alcamí et al., 1998 ). Supernatants from cells transfected with B8RFc, or from mammalian cells infected with WR or vΔB8R, or from Sf21 insect cells infected with a recombinant baculovirus that expresses the VV IFN-γR, AcB8R (Alcamí & Smith, 1995 ), were analysed by ligand blotting after electrophoresis in the absence of reducing agent (Fig. 4a). Cells infected with VV WR, but not vΔB8R, expressed an 8590 kDa protein, consistent with the B8R protein existing as a homodimer (Alcamí & Smith, 2002 ). The size of the VV IFN-γR made by insect cells (∼67 kDa) or as a B8RFc fusion (nearly 200 kDa) also indicated B8R was a homodimer. The specificity of each protein for IFN-γ was demonstrated by the inhibition of binding with a 100-fold excess of cold IFN-γ. The biological activity of purified B8RFc was demonstrated by its ability to inhibit the activity of human IFN-γ in a dose-dependent manner (Fig. 4b). Equivalent concentrations of 35KFc had no such inhibitory activity.
|
Affinity of B8R for human and mouse IFN-γ
The affinity of B8R for human and mouse IFN-γ was determined by surface plasmon resonance using BIAcore. B8RFc was bound to the surface of the sensor chip via the Fc domain that was recognized by an anti-Fc mAb. Different concentrations of human or mouse IFN-γ were then passed across the chip surface and the association, dissociation and Kd values were calculated from the association and dissociation kinetics. Although the association rates for human and mouse IFN-γ (5x106 and 1x106 mol/s, respectively) differed by only 5-fold, the dissociation rate for human IFN-γ (4·3x10-4 mol/s) was approximately 100-fold slower than for mouse IFN-γ (4x10-2 mol/s). Consequently, B8R had a much higher affinity constant (9x10-11 M) for human IFN-γ than mouse IFN-γ (4x10-8 M) and this was consistent with the ability of B8R to inhibit human but not mouse IFN-γ in bioassay (Alcamí & Smith, 1995 ).
Contribution of B8R and mouse soluble IFN-γR in vivo
Although the B8R protein was dispensable for virus replication in cell culture it was likely to play a role in vivo and this was tested in three models. In a mouse intranasal infection model the mortalities (data not shown), weight loss (Fig. 5a) and signs of illness (not shown) of vB8R, vΔB8R and vB8R-R were not statistically different (P<0·05, Students t-test) from each other on any day following infection with 104 or 105 p.f.u. Similarly, in a murine intradermal model (Tscharke & Smith, 1999 ) the resultant lesion size was indistinguishable for all three viruses (Fig. 5b). These results were consistent with the low affinity of the VV vIFN-γR for mouse IFN-γ and its inability to inhibit the biological activity of mouse IFN-γ in vitro.
|
Next the role of the VV IFN-γR was examined in a rabbit intradermal model, because the virus protein is known to inhibit the biological activity of the rabbit IFN-γ. At 3 days p.i. with 106 p.f.u. the lesions were examined histologically (Fig. 6). Infection with vΔB8R caused a greater infiltration of CD43+ inflammatory cells than infection with WT or revertant viruses, although changes in lesion sizes were not apparent. Conversely, the level of VV antigen as measured using a mAb to the A27L gene product showed that after infection with vΔB8R there was a reduced level of VV antigen in the dermis.
|
To study the contribution of a soluble IFN-γR to VV virulence in a mouse model we constructed a recombinant virus expressing the soluble mouse IFN-γR from the B8R locus under control of the B8R promoter. After intranasal infection, vsmIFN-γR was more virulent than vΔB8R and vΔB8R-R control viruses. On days 4, 5, 6 and 8 p.i. with 104 p.f.u. there was a statistically significant (P<0·05, Students t-test) greater weight loss following infection with vsmIFN-γR than with each control virus (Fig. 7a). Furthermore, after infection with 104 or 105 p.f.u. the signs of illness (Alcamí & Smith, 1992 ) appeared sooner and were more severe with significant differences from controls on days 4, 5, 6 and 7 p.i. with each dose. In the intradermal mouse model, there was a slight reduction in mean lesion size after infection with vsmIFN-γR compared to controls but this difference was not statistically significant (Fig. 7b).
|
Inhibition of equine IFN-γ
Finally, we tested the ability of the VV IFN-γR to inhibit equine IFN-γ. Data presented show that the supernatants from cells infected with VV strain WR, but not vΔB8R, possess an activity that inhibits the biological activity of equine IFN-γ in a dose-dependent manner as measured by the reversal of the inhibition of SFV plaque formation by equine IFN-γ on equine dermal cells (Fig. 8). The VV IFN-γR has now been demonstrated to inhibit IFN-γ from man, cow, rat, rabbit, horse and chicken but not mouse.
|
Previously, the VV B8R protein was shown to inhibit IFN-γ from a wide range of species, although it distinguished between the closely related mouse and rat IFN-γ. Here the range of IFN-γs that B8R inhibits is extended to equine IFN-γ. The rationale for investigating equine IFN-γ was that early vaccinators took material from horses and used this for smallpox vaccination when cowpox virus was scarce. In addition the Ankara strain of VV, from which MVA was derived, was isolated from a horse in Turkey. This prompted Baxby (1981) to suggest that the unknown host of VV might be horses. If this is true, then the terms vaccinia, vaccine and vaccination might have been equinia, equine and equination!
The Kd for human and mouse IFN-γ was determined. As expected from the biological inhibition of human but not mouse IFN-γ, the B8R protein had a much higher affinity for human than mouse IFN-γ. The Kd for human IFN-γ (9x10-11 M) compares favourably with the affinity of human and mouse IFN-γR for their ligands (10-1110-10 M) (Aguet et al., 1988 ; Hemmi et al., 1989 ) thus explaining the ability of B8R to block the biological activity of human IFN-γ. In contrast, the affinity of B8R for mouse IFN-γ (4x10-8 M) is unlikely to be high enough to compete with the natural mouse cell surface receptor. The affinity of the soluble IFN-γR α chain is lower than that of the cell surface receptor (Kd=10-9 M) (Walter et al., 1995 ). This is consistent with the finding that although the IFN-γR beta chain does not form an independent binding site for IFN-γ, it does contribute to the binding affinity for IFN-γ.
The low affinity for mouse IFN-γ was consistent with the lack of virus attenuation in two mouse models after deletion of the B8R gene. In contrast, in a rabbit model there was an increase in infiltration of CD43+ leukocytes after infection with the deletion mutant compared to controls. This enhanced infiltration was accompanied by a corresponding decrease in the level of VV antigen. Our study has a different conclusion to another paper that reported that disruption of B8R reduced VV strain WR virulence after intranasal infection of CB6F1 mice or intraperitoneal injection of nude mice (Verardi et al., 2001 ). Possible reasons for this discrepancy are that different mouse strains were utilized, or that the insertion of strong, bidirectional, synthetic VV promoters and the β-galactosidase gene into the B8R locus affected virulence, or that the deletion mutants described by Verardi et al. contained an additional mutation that contributed to the attenuated phenotype. The latter possibility was not addressed by the construction of revertant viruses.
To study the contribution of an IFN-γR in a mouse model, we constructed a virus that expresses the mouse IFN-γR. To make the situation as analogous as possible to the VV B8R protein, the mouse IFN-γR gene was expressed from the B8R promoter and was truncated before the region encoding the transmembrane anchor so that the protein was secreted from the cell. However, one difference between the mouse soluble IFN-γR and the VV IFN-γR is the ability of the latter protein to dimerize in the absence of IFN-γ (Alcamí & Smith, 2002 ). This property may give the VV protein enhanced ability to neutralize IFN-γ. The secreted smIFN-γR inhibited the biological activity of the mouse IFN-γ and the recombinant virus expressing this protein had enhanced virulence in a mouse model. The changes in vivo observed by either insertion of mouse soluble IFN-γR (in the mouse model) or deletion of VV B8R (in the rabbit model) were modest compared to changes in virulence resulting from the deletion of genes encoding proteins affecting the egress of virus from infected cells, such as A34R (McIntosh & Smith, 1996 ), A36R (Parkinson & Smith, 1994 ) and F12L (Zhang et al., 2000 ), but were similar to changes resulting from deletion of other immunomodulators (Moore & Smith, 1992 ; Alcamí & Smith, 1996 ).
The B8R protein affects the outcome of infection in rabbits but not in mice and deletion of the gene would be predicted to be an attenuating mutation in other species in which the host IFN-γ was inhibited by the VV protein. Consistent with this, VV MVA does not make an IFN-γR (Blanchard et al., 1998 ) and is attenuated in man compared to other VV strains, although the contribution of B8R to this phenotype has not been determined. It will be interesting to examine the immune response to infection with viruses lacking the B8R protein (in rats or rabbits) or containing the mouse IFN-γR (in mice).
In conclusion, the VV B8R protein is shown to be a non-essential immunomodulator that affects virus virulence in a rabbit but not mouse model of infection. The Kd values of the B8R protein are consistent with the observed inhibition of human but not mouse IFN-γ by this protein.
We thank P. Anton van der Merwe for expert advice on surface plasmon resonance experiments and Liz Darley for technical assistance with immunohistochemistry.This work was supported by a programme grant from The Wellcome Trust. D.C.T. was a Wellcome Trust Travelling Fellow and G.L.S is a Wellcome Trust Principal Research Fellow.
Footnotes
b Present address: Roche Bioscience, 3401 Hillview Avenue, Palo Alto, CA 94304, USA.c Present address: Cell Biology and Viral Immunology Sections, Laboratory of Viral Diseases, NIAID, NIH, Bethesda, MD 20892, USA.
d Present address: Birmingham Heartlands Hospital, Bordesley Green East, Birmingham B9 5SS, UK.
References
Alcamí, A. & Smith, G. L. (1992). A soluble receptor for interleukin-1 beta encoded by vaccinia virus: a novel mechanism of virus modulation of the host response to infection. Cell 71, 153-167.[Medline]
Alcamí, A. & Smith, G. L. (1995). Vaccinia, cowpox, and camelpox viruses encode soluble gamma interferon receptors with novel broad species specificity. Journal of Virology 69, 4633-4639.[Abstract]
Alcamí, A. & Smith, G. L. (1996). A mechanism for the inhibition of fever by a virus. Proceedings of the National Academy of Sciences, USA 93, 11029-11034.
Alcamí, A. & Smith, G. L. (2002). The vaccinia virus soluble interferon-γ receptor is a homodimer. Journal of General Virology 83, 545-549.
Alcamí, A., Symons, J. A., Collins, P. D., Williams, T. J. & Smith, G. L. (1998). Blockade of chemokine activity by a soluble chemokine binding protein from vaccinia virus. Journal of Immunology 160, 624-633.
Alcamí, A., Symons, J. A. & Smith, G. L. (2000). The vaccinia soluble IFN-α/β receptor binds to the cell surface and protects cells from the anti-viral effects of IFN. Journal of Virology 74, 11230-11239.
Antoine, G., Scheiflinger, F., Dorner, F. & Falkner, F. G. (1998). The complete genomic sequence of the modified vaccinia Ankara strain: comparison with other orthopoxviruses. Virology 244, 365-396.[Medline]
Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A. & Struhl, K. (1990). Current Protocols in Molecular Biology, Unit 4.2.1. New York: John Wiley and Sons.
Baxby, D. (1981). Jenners Smallpox Vaccine. London: Heinemann.
Blanchard, T. J., Alcamí, A., Andrea, P. & Smith, G. L. (1998). Modified vaccinia virus Ankara undergoes limited replication in human cells and lacks several immunomodulatory proteins: implications for use as a human vaccine. Journal of General Virology 79, 1159-1167.[Abstract]
Colamonici, O. R., Domanski, P., Sweitzer, S. M., Larner, A. & Buller, R. M. L. (1995). Vaccinia virus B18R gene encodes a type I interferon-binding protein that blocks interferon α transmembrane signaling. Journal of Biological Chemistry 270, 15974-15978.
Czerny, C. P. & Mahnel, H. (1990). Structural and functional analysis of orthopoxvirus epitopes with neutralizing monoclonal antibodies. Journal of General Virology 71, 2341-2352.[Abstract]
Davison, A. J. & Moss, B. (1989). Structure of vaccinia virus early promoters. Journal of Molecular Biology 210, 749-769.[Medline]
Ealick, S. E., Cook, W. J., Vijay-Kumar, S., Carson, M., Nagabhushan, T. L., Trotta, P. P. & Bugg, C. E. (1991). Three-dimensional structure of recombinant human interferon-gamma. Science 252, 698-702.[Medline]
Engelstad, M. & Smith, G. L. (1993). The vaccinia virus 42-kDa envelope protein is required for the envelopment and egress of extracellular virus and for virus virulence. Virology 194, 627-637.[Medline]
Falkner, F. G. & Moss, B. (1990). Transient dominant selection of recombinant vaccinia viruses. Journal of Virology 64, 3108-3111.[Medline]
Farrar, M. A. & Schreiber, R. D. (1993). The molecular cell biology of interferon-γ and its receptor. Annual Review of Immunology 11, 571-611.[Medline]
Fountoulakis, M., Schlaeger, E.-J., Gentz, R., Juranville, J.-F., Manneberg, M., Ozmen, L. & Garotta, G. (1991). Purification and biochemical characterization of a soluble mouse interferon-γ receptor produced in insect cells. European Journal of Biochemistry 198, 441-450.[Abstract]
Fountoulakis, M., Zulauf, M., Lustig, A. & Garotta, G. (1992). Stoichiometry of interaction between interferon γ and its receptor. European Journal of Biochemistry 208, 781-787.[Abstract]
Goebel, S. J., Johnson, G. P., Perkus, M. E., Davis, S. W., Winslow, J. P. & Paoletti, E. (1990). The complete DNA sequence of vaccinia virus. Virology 179, 247-266.[Medline]
Greenlund, A. C., Schreiber, R. D., Goeddel, D. V. & Pennica, D. (1993). Interferon-γ induces receptor dimerization in solution and on cells. Journal of Biological Chemistry 268, 18103-18110.
Hemmi, S., Peghini, P., Metzler, M., Merlin, G., Dembic, Z. & Aguet, M. (1989). Cloning of murine interferon gamma receptor cDNA: expression in human cells mediates high-affinity binding but is not sufficient to confer sensitivity to murine interferon gamma. Proceedings of the National Academy of Sciences, USA 86, 9901-9905.[Abstract]
Horton, R. M., Hunt, H. D., Ho, S. N., Pullen, J. K. & Pease, L. R. (1989). Engineering hybrid genes without the use of restriction enzymes: gene splicing by overlap extension. Gene 77, 61-68.[Medline]
Howard, S. T., Chan, Y. S. & Smith, G. L. (1991). Vaccinia virus homologues of the Shope fibroma virus inverted terminal repeat proteins and a discontinuous ORF related to the tumor necrosis factor receptor family. Virology 180, 633-647.[Medline]
Huang, S., Hendriks, W., Althage, A., Hemmi, S., Bluethmann, H., Kamijo, R., Vilcek, J., Zinkernagel, R. M. & Aguet, M. (1993). Immune response in mice that lack the interferon-gamma receptor. Science 259, 1742-1745.[Medline]
Hughes, S. J., Johnston, L. H., de Carlos, A. & Smith, G. L. (1991). Vaccinia virus encodes an active thymidylate kinase that complements a cdc8 mutant of Saccharomyces cerevisiae. Journal of Biological Chemistry 266, 20103-20109.
Karupiah, G., Fredrickson, T. N., Holmes, K. L., Khairallah, L. H. & Buller, R. M. L. (1993). Importance of interferons in recovery from mousepox. Journal of Virology 67, 4214-4226.[Abstract]
Kerr, S. M. & Smith, G. L. (1991). Vaccinia virus DNA ligase is nonessential for virus replication: recovery of plasmids from virus-infected cells. Virology 180, 625-632.[Medline]
McIntosh, A. A. & Smith, G. L. (1996). Vaccinia virus glycoprotein A34R is required for infectivity of extracellular enveloped virus. Journal of Virology 70, 272-281.[Abstract]
Mackett, M., Smith, G. L. & Moss, B. (1985). The construction and characterization of vaccinia virus recombinants expressing foreign genes. In DNA Cloning: a Practical Approach., , pp. 191-211. Edited by D. M. Glover. Oxford:IRL Press.
Moore, J. B. & Smith, G. L. (1992). Steroid hormone synthesis by a vaccinia enzyme: a new type of virus virulence factor. EMBO Journal 11, 19731980. [Erratum 11, 3490.].[Abstract]
Moss, B. (2001). Poxviridae: the viruses and their replication. In Fields Virology , pp. 2849-2883. Edited by D. M. Knipe & P. M. Howley. Philadelphia:Lippincott Williams & Wilkins.
Mossman, K., Upton, C., Buller, R. M. & McFadden, G. (1995). Species specificity of ectromelia virus and vaccinia virus interferon-gamma binding proteins. Virology 208, 762-769.[Medline]
Ng, A., Tscharke, D. C., Reading, P. C. & Smith, G. L. (2001). The vaccinia virus A41L protein is a soluble 30 kDa glycoprotein that affects virus virulence. Journal of General Virology 82, 2095-2105.
Nicholson, M. W., Barclay, A. N., Singer, M. S., Rosen, S. D. & van der Merwe, P. A. (1998). Affinity and kinetic analysis of L-selectin (CD62L) binding to glycosylation-dependent cell-adhesion molecule-1. Journal of Biological Chemistry 273, 763-770.
Parkinson, J. E. & Smith, G. L. (1994). Vaccinia virus gene A36R encodes a Mr 4350 K protein on the surface of extracellular enveloped virus. Virology 204, 376-390.[Medline]
Perkus, M. E., Goebel, S. J., Davis, S. W., Johnson, G. P., Norton, E. K. & Paoletti, E. (1991). Deletion of 55 open reading frames from the termini of vaccinia virus. Virology 180, 406-410.[Medline]
Puehler, F., Weining, K. C., Symons, J. A., Smith, G. L. & Staeheli, P. (1998). Vaccinia virus-encoded cytokine receptor binds and neutralizes chicken interferon-gamma. Virology 248, 231-240.[Medline]
Samudzi, C. T., Burton, L. E. & Rubin, J. R. (1991). Crystal structure of recombinant rabbit interferon-gamma at 2·7- resolution. Journal of Biological Chemistry 266, 21791-21797.
Smith, G. L., Chan, Y. S. & Howard, S. T. (1991). Nucleotide sequence of 42 kbp of vaccinia virus strain WR from near the right inverted terminal repeat. Journal of General Virology 72, 1349-1376.[Abstract]
Spriggs, M., Hruby, D. E., Maliszewski, C. R., Pickup, D. J., Sims, J. E., Buller, R. M. L. & Vanslyke, J. (1992). Vaccinia and cowpox viruses encode a novel secreted interleukin-1 binding protein. Cell 71, 145-152.[Medline]
Symons, J. A., Alcamí, A. & Smith, G. L. (1995). Vaccinia virus encodes a soluble type I interferon receptor of novel structure and broad species specificity. Cell 81, 551-560.[Medline]
Tscharke, D. C. & Smith, G. L. (1999). A model for vaccinia virus pathogenesis and immunity based on intradermal injection of mouse ear pinnae. Journal of General Virology 80, 2751-2755.
Upton, C., Mossman, K. & McFadden, G. (1992). Encoding of a homolog of IFN-γ receptor by myxoma virus. Science 258, 1369-1372.[Medline]
van den Broek, M. F., Muller, U., Huang, S., Aguet, M. & Zinkernagel, R. M. (1995). Antiviral defense in mice lacking both alpha/beta and gamma interferon receptors. Journal of Virology 69, 4792-4796.[Abstract]
Verardi, P. H., Jones, L. A., Aziz, F. H., Ahmad, S. & Yilma, T. D. (2001). Vaccinia virus vectors with an inactivated gamma interferon receptor homolog gene (B8R) are attenuated in vivo without a concomitant reduction in immunogenicity. Journal of Virology 75, 11-18.
Walter, M. R., Windsor, W. T., Nagabhushan, T. L., Lundell, D. J., Lunn, C. A., Zauodny, P. J. & Narula, S. K. (1995). Crystal structure of a complex between interferon-gamma and its soluble high-affinity receptor. Nature 376, 230-235.[Medline]
Zhang, W.-H., Wilcock, D. & Smith, G. L. (2000). The vaccinia virus F12L protein is required for actin tail formation, normal plaque size and virulence. Journal of Virology 74, 11663-11670.
Received 15 March 2002; accepted 22 April 2002.