Research Article

Epstein-Barr virus latent membrane protein 2B (LMP2B) co-localizes with LMP2A in perinuclear regions in transiently transfected cells

Journal of General Virology 2002; 83(5):1025

PubMed

With thanks to our partners for supporting this archive.

Abstract

EpsteinBarr virus is a human gammaherpesvirus that infects and establishes latency in B lymphocytes in vivo. The latent membrane protein 2 (LMP2) gene is expressed in latently infected B cells and encodes two protein isoforms, LMP2A and LMP2B, that are identical except for an additional N-terminal 119 aa cytoplasmic domain which is present in the LMP2A isoform. A panel of fusion proteins was constructed in which the fluorescent enhanced green fluorescent protein and DsRed protein domains were fused to the N- and C-termini of LMP2A and LMP2B. By fluorescence microscopy, LMP2B localized to perinuclear regions of both live and fixed transiently transfected cells. Co-localization was detected with markers for the endoplasmic reticulum and the trans-Golgi network. No evidence of co-localization of LMP2B with endosomes or surface expression was obtained. Transiently expressed LMP2B co-localized with transiently or constitutively expressed LMP2A. Confocal microscopy confirmed that LMP2A proteins localized to intracellular perinuclear compartments with markers for the trans-Golgi network. Only LMP2A proteins with C-terminal truncations were detected in the plasma membrane with extracellular loop1 epitope tags. These results indicate that the transmembrane domain of LMP2 proteins possess intracellular retention signals and suggest that LMP2A-mediated signalling effects are likely to be ectopic, originating from sites inside the cell close to the nucleus.
EpsteinBarr virus (EBV) is the aetiological agent of infectious mononucleosis and is associated with several forms of human cancer (reviewed by Cohen, 1999 ; Kieff, 1996b ; Sugden, 1994 ). In both in vitro-immortalized lymphocytes (LCLs) and several malignant cell types, the 172 kb genome persists as an autonomously replicating episome that expresses a small subset of its genes. EBV induces and controls cellular proliferation through the expression of ten viral genes encoding six nuclear proteins (EBNAs 1, 2, 3A, 3B, 3C and LP), three membrane proteins (LMP1, LMP2A and LMP2B) and two small RNAs (Kieff, 1996a ; Miller, 1990 ; Rowe, 1999 ). In vivo, EBV establishes a persistent latent infection in a population of B cells bearing markers of a non-activated resting memory subset (Miyashita et al., 1997 ; Thorley-Lawson & Babcock, 1999 ; Babcock et al., 1998 , 1999 , 2000 ). Latently infected B cells in situ possess very low numbers of virus episomes that express the mRNA for LMP2A (Khan et al., 1996 ; Miyashita et al., 1995 ; Qu & Rowe, 1992 ; Rowe, 1999 ).

The LMP2 gene encodes two messages of 2·0 and 1·7 kb in length, which are produced by alternative promoter usage (Laux et al., 1988 ; Sample et al., 1989 ). The longer message encodes LMP2A, while the shorter message is initiated from a promoter, approximately 5 kb downstream, that is bidirectional and responsible for LMP1 expression in the leftward direction and LMP2B expression in the rightward direction (Laux et al., 1988 ; Rowe, 1999 ). The mRNAs share eight 3' exons but have unique 5' exons. Initial transcripts cross the fused terminal repeat region of the virus episome with the promoters and 5' exons located near the right end of the genome and the common exons located at the left end of the genome (Laux et al., 1988 ; Sample et al., 1989 ). The eight common exons encode 12 membrane-spanning segments connected by short loops and ending with a 27 aa cytoplasmic C-terminal domain. (Kieff, 1996b ; Longnecker, 2000 ). The difference between the two isoforms is that LMP2A has an N-terminal 119 aa cytoplasmic-signalling domain that is not present in LMP2B.

The restriction of viral gene expression to LMP2A in situ suggests that the protein may have a key role in either the establishment or the maintenance of latency and/or the reactivation of productive infection from the latent state. The focus of most studies has been on the LMP2A product. To date, there has not been a comprehensive phenotypic analysis of the LMP2B isoform. This is partly because of the hydrophobic character of LMP2 proteins. The rabbit polyclonal sera and rat monoclonal antibodies that have been produced have specificities for epitopes in the cytoplasmic domain (Fruehling et al., 1996 ; Longnecker et al., 1991 ; Rowe et al., 1990 ). No sera have been made that unequivocally detect LMP2B. Although mRNAs for both proteins are expressed in immortalized B cells, genetic analyses of the LMP2 gene have shown that neither product is required for immortalization of B cells by the virus. Three different virus recombinants (a stop codon in place of residue 19 in the LMP2A sequence allowing LMP2B expression only, a stop codon at residue 260, truncating both LMP2 proteins after the fifth membrane-spanning segment, and a deletion between residues 120 and 260 that allows only LMP2A cytoplasmic domain expression) gave rise to essentially normal LCLs (Longnecker et al., 1992 , 1993 ; Yates, 1993). Recent studies with pure LMP2A-knockout viruses as inocula for immortalization of primary B cells revealed no discernable defect in their ability to generate immortalized cell lines (Konishi, 2001 ). Virus mutants that interrupt LMP2A exon1 and leave LMP2B intact and, presumably, expressed, indicate that LMP2B possesses no independent role in producing the B cell receptor signalling blockade phenotype of the LMP2 gene.

While the significance of LMP2B and its role in pathogenesis remain unclear, homology studies comparing the LMP2 gene of EBV with that of rhesus and baboon lymphocryptoviruses have revealed that the ability to make the LMP2B transcript is conserved (Rivailler et al., 1999 ). This implies that there is an as yet unrecognized role for LMP2B in the EBV life cycle. In this report, we describe the initial characterization of the localization of the LMP2B protein in transiently transfected cells. LMP2B cDNA expression vectors containing N- or C-terminal enhanced green fluorescent protein (EGFP) or DsRed protein fusions were constructed to allow detection of LMP2B protein expression in living cells. Conventional and confocal fluorescence microscopy revealed that LMP2B localized to perinuclear regions in transiently transfected cells and co-localized with LMP2A.

Cell lines and cell culture.
BJAB is an EBV-negative Burkitt lymphoma cell line; B958CR is an in vitro-established LCL (a gift from A. Rickinson, University of Birmingham, Birmingham, UK); 293T is a human embryonic kidney cell line containing the SV40 large T antigen. All B cell lines were maintained in complete RPMI 1640 medium containing 10% inactivated foetal bovine serum, 2 mM glutamine, 60 µg/ml penicillin and 200 µg/ml streptomycin at 37 °C in 5% CO2. 293T cells were grown in complete Dulbeccos modified Eagles medium (DMEM) under identical growth conditions.

Construction of recombinant LMP2 plasmids.
DNA fragments encoding full-length LMP2A or LMP2B were amplified by PCR from B958 cDNA using the following primers: Exon1 (5' CCCCTCGAGCTCAAGCTTACTACCAT GGGGTCCCTAGAA 3') or Exon2 (5' CCCCTCGAGCTCAAGCTTACTAGTATGAA TCCAGTATGCCTG 3') with LMP2 C-term (5' GCGCGGTACCACAGTGTTGCGATATGG 3'), respectively. Both 5' primers contain an Xho1 restriction site (underlined) and the 3' primer contains a Kpn1 restriction site. PCR products were digested with Xho1/Kpn1 and ligated into pN1EGFP, pC1EGFP or pN1DsRed mammalian expression vectors (Clontech). FLAG epitope-tagged LMP2-expressing vectors were constructed by a multistep cloning approach. Oligonucleotides encoding the FLAG epitope were used to incorporate an iterated 3x FLAG into the open reading frame (ORF) of LMP2. All constructs were sequenced to ensure the correct alignment of the LMP2 ORFs after assembly.

Transfections.
All DNA used for transfection were banded on CsCl2 equilibrium density gradients. For B cell lines, 5x106 cells were washed once in PBS and resuspended at room temperature in 0·4 ml of serum-free, phenol red-free RPMI 1640 containing 20 µg pN1EGFPLMP2A or pN1DsRedLMP2B. Cells were transferred to a sterile electroporation cuvette (0·4 cm electrode gap) (Invitrogen) and pulsed twice; the multiporator (Eppendorf) was set at 400 V for 100 µs. Cells were then settled for 10 min at 37 °C and diluted into 10 ml of complete phenol red-free RPMI 1640. For 293T cells, confluent T225 flasks were trypsinized with 10x trypsin (Gibco) and washed. The cells were then adjusted to a concentration of 1x107 cells/ml in serum-free, phenol red-free DMEM. Approximately 4x106 cells were then pulsed twice in a 0·4 cm cuvette containing 20 µg of plasmid in a multiporator (Eppendorf) set at 280 V for 100 µs. Cells were settled for 10 min at 37 °C and approximately 0·1x106 cells were seeded into chamber slides.

Antibodies and immunofluorescence.
Anti-human IgM antibodies for immunofluorescence were purchased from Biosource International. Anti-human CD19 (BD Biosciences), LAMP-1, EEA-1, γ-adaptin, PDI (Transduction Laboratories) and BIP (StressGen Biotechnologies) antibodies were also purchased. The rat monoclonal antibody anti-human LMP2A (14B7) was kindly provided by R. Longnecker (NorthWestern University, Chicago, USA ). Alexa-fluor 488 and 594 secondary antibodies were purchased from Molecular Probes. Mounting media containing DAPI was purchased from Vector Laboratories. Immunofluorescence was performed by washing transiently transfected B cells twice in PBS. Cells were then fixed to microscope slides using a cytospin (Shanndon) set at 500 r.p.m. for 5 min. Slides were dried for 1 h at room temperature in the dark and fixed in freshly prepared 24% paraformaldehyde, pH 7·4, for 15 min at room temperature. Samples were blocked for 1 h in blocking buffer containing 0·5% BSA, 0·1% NaN3 and 0·1% saponin. Primary antibodies were incubated at varying dilutions in blocking buffer for 30 min at 4 °C. Secondary antibodies were diluted in blocking buffer (1:2000 dilution) for 30 min at 4 °C. Slides were washed and mounted with Vectashield-mounting medium containing DAPI (Vector Laboratories). For cell surface immunostaining, live cells were chilled on ice for 10 min and incubated with anti-FLAG antibody (Sigma) for 30 min at 4 °C. Cells were washed in cold blocking buffer, fixed in 2% phosphonoformic acid and incubated with Alexa-fluor secondary antibodies (Molecular Probes).

Microscopy.
Slides were examined with a Nikon E600 equipped with a SPOTII CCD digital camera. Digital images were composed using METAMORPH software (Universal Imaging). Confocal digital images were taken using BioRad LASERSHARP software coupled with a BioRad RadiancePLUS confocal microscope system. Integrated average pixel area and intensity values for individual cells were measured using METAMORPH software.

Expression of fluorescent LMP2B fusion proteins
The hydrophobic sequences of transmembrane segments make poor epitopes for the generation of specific antisera. Our attempts to produce anti-peptide antisera that recognize the loop regions connecting LMP2 transmembrane segments have yielded high titre antibodies that recognize the peptide but not the proteins. To address these problems of detection, expression vectors with LMP2B proteins bearing fluorescent tags and epitope tags were generated so that LMP2B could be easily detected and tracked within transfected cells. LMP2A and LMP2B sequences were amplified by PCR from B958 cDNA and cloned into pN1EGFP, pC1EGFP or pN1DsRed mammalian expression vectors to create LMP2 protein fusion constructs with N- and C-terminal fluorescent tags. In addition, a 3x FLAG epitope tag was introduced into the first extracellular loop of LMP2, either separately or in combination with the fluorescent tags. Constructs with 1x or 2x FLAG and haemagglutinin tags were also made but only the 3x FLAG was detectable in the internal loop1 site (data not shown). The coding sequences of all of the recombinant LMP2 ORFs were verified by sequencing after construction.

Constructs with DsRed or EGFP fused to the C terminus of LMP2B (LMP2BDsRed and LMP2BEGFP) or the base vectors (pDsRed and pN1EGFP) were transiently transfected into BJAB (lymphocyte) and 293T (epithelial) cells (Fig. 1). Protein expression was examined 12, 24, 48 and 96 h post-transfection. Cells were viewed both live and after fixation in 2% paraformaldehyde. At 24 h post-transfection, transient expression from the control vectors cells was detected as a uniform bright red or green fluorescence that filled the entire volume of the cell and whose appearance was unaltered by fixation (Fig. 1). Only the DsRed fluorescence is shown as the localization of EGFP fusions was identical. LMP2BDsRed-expressing cells, both live and fixed, displayed from one to several distinct patches of fluorescence, which consistently appear to be located proximal to the nucleus. Electroporation typically yielded 1015% positive expressing B cells and 6080% positive expressing 293T cells after 72 h of incubation. Fluorescence was detectable as early as 12 h post-transfection and persisted for more than 2 weeks without selection. At the earliest time-points, the level of LMP2B fluorescence was weaker in intensity but localized to patches in the intracellular perinuclear region. Protein localization was not altered, irrespective of the time post-transfection that the observations were made, the level of LMP2BDsRed fluorescence in a cell or the type of cell transfected. The expression vectors contain a G418 resistance selectable marker but cells lines expressing LMP2BDsRed have been difficult to establish and maintain. Resistant cells lines have a tendency to loose LMP2BDsRed fluorescence and need to be flow-sorted to retain a high proportion of positive cells.



(55K):

Fig. 1. Recombinant LMP2B localizes in perinuclear regions. Localization of pDsRed vector (+) and LMP2BDsRed in transiently transfected BJAB (A) or 293T (B) cells. A schematic representation of the structure of the LMP2B recombinant used is indicated above the micrographs. All micrographs were digitally captured 24 h post-transfection using a SPOTII CCD camera. Bar, 5 µm.

Perinuclear localization of recombinant LMP2B proteins
Perinuclear localization of LMP2BDsRed contrasts with the view of LMP2 proteins as residents of the plasma membrane. One possibility was that there might be a significant difference in localization between LMP2A and LMP2B. It was also possible that the localization of LMP2B was an artefact and a consequence of LMP2BDsRed having a C-terminal fluorescent tag. A series of transient co-transfections were performed in BJAB and 293T cells using LMP2DsRed and expression vectors with the different tags (LMP2BEGFP) and also tags attached at opposite ends (EGFPLMP2B) of the LMP2B molecule. Live cell fluorescence of co-expressing cells revealed that LMP2BDsRed co-localized with LMP2B recombinants containing either N- or C-terminal EGFP fusions (Fig. 2). Image analysis of the area/intensity-averaged overlap was greater than 95% and often in the range of 99%. Neither the type of the tag nor the position of the tag at either end of the molecule changed the perinuclear pattern of LMP2B fluorescence.



(29K):

Fig. 2. Co-localization of LMP2BDsRed with N- and C-termini EGFP-tagged LMP2B. Green fluorescence of LMP2B with EGFP fused to either the N or the C terminus overlaps the red fluorescence of LMP2BDsRed in live transiently transfected cells. BJAB (A, B) and 293T (C, D) cells were co-transfected with LMP2B containing a C-terminal DsRed tag (LMP2BDsRed) and vectors containing EGFP fused to either the N or the C terminus. Red and green channels were digitally collected as separate images and merged in METAMORPH software. All micrographs were taken 24 h post-transfection. The average overlap of red (R) and green (G) signals was calculated using METAMORPH software and is expressed as a percentage of the area/intensity-averaged overlap. Bar, 5 µm.

It was still possible that the presence of fluorescent tags caused LMP2B fusions to take on an anomalous non-plasma membrane localization. LMP2B containing a 3x iteration of an octapeptide FLAG epitope tag in the first extracellular loop of the transmembrane domain was constructed. 293T or BJAB cells singly transfected with the plasmids expressing the FLAG-tagged LMP2B showed similar patterns of perinuclear fluorescence as the EGFP- and DsRed-tagged molecules (data not shown). Cells were transiently co-transfected with FLAG-tagged LMP2B proteins and an LMP2B that had EGFP fused to either the N- or the C-terminal domain. When either 293T or BJAB cells were fixed and immunostained for the FLAG epitope, the co-transfected cells showed 90% co-localization of the EGFP-tagged LMP2B and the epitope-tagged LMP2B species by image analysis of the area/intensity-averaged overlap (Fig. 3A, B). Only the 293T co-localizations are shown as the BJAB results were identical.



(30K):

Fig. 3. Epitope-tagged LMP2B co-localizes with EGFP-tagged LMP2B. (A, B) N-terminal EGFP-fused LMP2B (EGFPLMP2B) and C-terminal EGFP-fused LMP2B (LMP2BEGFP) were co-transfected with loop1 3x FLAG epitope-tagged LMP2B into 293T cells. Fixed cells were probed for FLAG-tagged LMP2B using M2 anti- FLAG antibody (Sigma) and the red fluorescing Alexa-fluor 594 nm goat anti-mouse (Molecular Probes). (C, D) Fixed and live BJAB cells transiently expressing LMP2BDsRed containing a 3x FLAG epitope tag in loop1 were stained for FLAG. The epitope was detected using M2 anti-FLAG antibody (Sigma) and the green fluorescing Alexa-fluor 488 nm goat anti-mouse antibody. Red and green channels were digitally collected as separate images and merged in METAMORPH software. All micrographs were taken 24 h post-transfection. Bar, 5 µm.

BJAB cells expressing an LMP2B construct that contained both the N-terminal epitope tag and the C-terminal DsRed tag on the same molecule showed a complete overlap of the green immunofluorescence from the loop1 3x FLAG tag and the red autofluorescence of the C-terminal DsRed tag (Fig. 3C). This is the expected finding only when the red and green fluorescence is coming from intact proteins. When the antibody probe for the 3x FLAG was applied to live, chilled, non-permeabilized cells to detect surface expression of the FLAG epitopes, no anti-FLAG fluorescence was observed (Fig. 3D). Similar results were obtained with 293T cells. In summary, these results indicated that neither the presence of fluorescent tags at the ends of LMP2B nor the sequence composition of the fluorescent domain seemed to be responsible for directing LMP2B molecules to a perinuclear localization. The presence of a FLAG epitope tag in loop1 of LMP2B did not affect localization. Perinuclear localization in lymphocytes and epithelial cells had the same patchy appearance.

LMP2B co-localization with LMP2A
Because of the high degree of structural relatedness between the LMP2A and LMP2B isoforms, it was anticipated that the molecules should localize to the same cellular compartment. However, the perinuclear localization of LMP2B contrasted with the expected plasma membrane localization of LMP2A. We therefore conducted an analysis of LMP2A membrane localization and assessed whether the two proteins had the same or different fluorescence patterns when co-expressed in our fluorescent molecule-tagging system. For these experiments, LMP2A bore a C-terminal EGFP tag and LMP2B bore a C-terminal DsRed tag. This allowed us to visualize the localization of the two proteins together in live cells in the absence of any potential fixation artefacts (Fig. 4A). Only the results for BJAB cells are shown as they were identical to the results for 293T cells. Co-transfections yielded a mixture of cells that were untransfected, singly transfected or doubly transfected on the same slide preparation. Localizations of LMP2A and LMP2B were not altered by the presence or absence of the other isoform or by paraformaldehyde fixation (Fig. 4B). Both proteins displayed a perinuclear localization in singly transfected cells and co-localized to the same patches when they were co-expressed. Analysis of the area/intensity-averaged overlap indicated that there was >99% overlap of the two proteins in the transfected cells.



(45K):

Fig. 4. LMP2B co-localizes with LMP2A in transiently transfected cells. Live cell fluorescence of BJAB cells transiently transfected with LMP2AEGFP and LMP2BDsRed (schematic) (A, B). B958CR (EBV+) LCLs were transiently transfected with LMP2BDsRed and probed for endogenous LMP2A. LMP2A was detected by epi-fluorescence (C) and confocal microscopy (D) using a rat monoclonal (14B7) and Alexa-fluor 488 nm goat anti-rat antibodies. All images were taken 24 h post-transfection. Bar, 5 µm.

Since LMP2A can be detected as an untagged protein by immunofluorescence on virus-immortalized lymphocytes, it can serve as an important control for the use of the tagged molecules in localization studies. The pattern of immunofluorescence staining of endogenous LMP2A in B958CR cells (a B958 virus-immortalized adult lymphoblastoid cell line) was similar to the pattern of LMP2BDsRed fluorescence in BJAB cells and was also typical of other LMP2A-expressing LCLs (data not shown). B958CR cells were transfected with the LMP2BDsRed expression construct to compare the localization of endogenous LMP2A with co-expressed LMP2B. In transfected cells, LMP2B co-localized with endogenous LMP2A in the perinuclear regions of B958CR cells (Fig. 4C). Analysis of the area/intensity-averaged overlap indicated that 97% of the transiently expressed LMP2B was associated with endogenously expressed LMP2A in these cells, while only 75% of the endogenous LMP2A was co-localized with LMP2B. This suggested that a portion of LMP2A may be localizing to distinct compartments within the cell, possibly the plasma membrane. Confocal images through the middle planes of optically sectioned co-transfected cells confirmed the extent of the LMP2B overlap with the endogenous LMP2A (Fig. 4D).

A probe for LMP2A protein at the surface of live cells with loop1 epitope tags
There has never been a direct observation of LMP2A protein at the surface of live cells because no appropriate reagent for detecting the molecules from outside the cell has been produced. We constructed LMP2A loop1-tagged protein expression vectors for this purpose. After transfection into BJAB or 293T cells, unpermeabilized cells were probed with anti-FLAG antibody. No immunofluorescence was detected (Fig. 5A). Permeabilized cells from the same transfections gave readily detectable FLAG fluorescence signals. A survey of 293T and BJAB cells transfected with a loop1 3x FLAG-tagged LMP2AEGFP fusion to easily identify LMP2A-expressing cells was conducted but no evidence for surface staining for LMP2A was detected (data not shown).



(39K):

Fig. 5. Localization of LMP2A truncation mutants to the cell surface. 293T cells transiently expressing LMP2AEGFP, LMP2ATM2 or LMP2ATM6 truncation mutants (schematic) were chilled and probed for FLAG at the plasma membrane of live cells with anti-FLAG antibodies. Cells were subsequently fixed and incubated with secondary antibodies. Red and green digital micrographs were collected separately and combined using METAMORPH software. Bar, 5 µm.

It was possible that some conformational feature of the FLAG-tagged molecule prevented the epitope from being detected at the surface of live cells. The restriction would then have to be relieved by fixation with paraformaldehyde. On the other hand, confocal sectioning (Fig. 4D) and other localization studies were consistent with the possibility that there might be no protein on the surface to detect. Therefore, we made C-terminal truncation mutants of LMP2A, reasoning that intracellular retention signals were likely to be located within the 12 transmembrane segments of the transmembrane domain. Disrupting these signals should abolish the intracellular retention of LMP2A and allow the protein to be trafficked to the surface. Six and ten transmembrane segments were removed from loop1 3x FLAG-tagged LMP2AEGFP. These constructs were transfected into BJAB and 293T cells and live cells were probed for surface expression of LMP2A with anti-FLAG antibodies (Fig. 5B, C). Compared to full-length LMP2AEGFP, the fluorescence of EGFP in the truncation mutant-transfected cells was diffusely distributed throughout the cytoplasm. The anti-FLAG antibodies readily bound to the surface of the cells. Analysis of the area/intensity-averaged overlap indicated that >98% of the truncated molecules were detected on the surface of transfected cells. These results show that the distribution and intracellular localization of LMP2A is governed, at least in part, by the transmembrane domain. When the loop1 tag is exposed on the surface of live cells, it is detectable by anti-FLAG antibodies.

Subcellular localization of LMP2BDsRed
Immunofluorescence microscopy with a panel of antibodies specific for markers of intracellular compartments was used to investigate the localization of LMP2BDsRed in transiently transfected BJAB cells. At 24 h post-transfection, cells were probed for CD19 (surface marker), LAMP-1 (lysosomes), EEA-1 (early endosomes), γ-adaptin (trans-Golgi network) and BIP-1 (endoplasmic reticulum) (Fig. 6). The greatest overlap in fluorescence was between LMP2BDsRed and γ-adaptin (a component of the trans-Golgi network). Analysis of the area/intensity-averaged overlap indicated that >80% of LMP2B was associated with γ-adaptin. However, there were also significant amounts of γ-adaptin that were not associated with LMP2B. Partial co-localization was observed between LMP2BDsRed and BIP-1 (the endoplasmic reticulum resident protein). There was also a partial overlap between LMP2B and the CD19 surface marker. There was no appreciable overlapping of fluorescence between LMP2B and the markers for endosomes or lysosomes. The pattern of immunofluorescence for all of the cellular compartment markers in LMP2B-expressing cells was essentially indistinguishable from the untransfected cells on the same slide, indicating that LMP2B expression did not appear to significantly alter the functioning of membrane trafficking within the transfected cells.



(40K):

Fig. 6. Subcellular localization of DsRedLMP2B (red) using cell compartment markers. BJAB cells were transiently transfected with LMP2BDsRed, fixed and probed with a panel of antibodies specific for markers of intracellular compartments (green). Cells were analysed 24 h post-transfection and probed for CD19 (surface marker), LAMP-1 (lysosomes), EEA-1 (early endosomes), γ-adaptin (trans-Golgi network) and BIP-1 (endoplasmic reticulum). Bar, 5 µm.

We analysed the localization of endogenous LMP2A in B958CR cells relative to the same collection of membrane compartment markers used for the assessment of LMP2B localization (Fig. 7). Endogenous LMP2A in B958CR cells also co-localized with the trans-Golgi network marker γ-adaptin. Analysis of the area/intensity-averaged overlap indicated that >40% of LMP2A was associated with γ-adaptin. There was also significant localization with EEA-1, the endosome marker. Analysis of the area/intensity-averaged overlap indicated that >60% of LMP2A was associated with EEA-1. There was no significant co-localization with either the BIP-1 endoplasmic reticulum marker, the CD19 plasma membrane marker or the lysosome marker.



(40K):

Fig. 7. Subcellular localization of LMP2A (red) in LCLs using cell compartment markers. B958CR cells were fixed and probed with a panel of antibodies specific for markers of intracellular compartments (green). Cells were analysed 24 h post-transfection and probed for CD19 (surface marker), LAMP-1 (lysosomes), EEA-1 (early endosomes), γ-adaptin (trans-Golgi network) and BIP-1 (endoplasmic reticulum). All micrographs were taken with a 60x oil objective lens. LMP2A was detected using a rat monoclonal (14B7) and Alexa-fluor 594 nm goat anti-rat antibodies. Bar, 5 µm.

Optical sectioning of BJAB cells transiently expressing LMP2AEGFP or LMP2BDsRed by confocal microscopy was used to confirm the localization of epi-fluorescence. Cells were probed for CD19 (Fig. 8A). No plasma membrane co-localization was observed between the cell surface marker CD19 and LMP2A. Similar results were obtained with 293T cells. Epi-fluorescence co-localization studies had suggested that there was some overlap between the LMP2B fluorescence and CD19, despite the inability to detect any surface expression of FLAG-tagged LMP2BDsRed. BJAB cells expressing LMP2BDsRed and probed for CD19 were optically sectioned by confocal microscopy (Fig. 8B). Serial Z-plane sections clearly delineated the plasma membrane localization of CD19 in the transfected cells and also showed that the pattern of LMP2B fluorescence was internal and did not co-localize with surface-expressed CD19. However, in every LMP2B-positive cell examined, there was an intracellular co-localized patch of CD19. Confocal microscopy was also used to confirm that the localization of LMP2B was perinuclear and that there was a significant co-localization with the trans-Golgi membrane marker γ-adaptin (Fig. 8C). Z-Plane series demonstrated that a high degree of perinuclear co-localization between LMP2B and γ-adaptin occurs in BJAB cells transiently expressing LMP2BDsRed. Confocal analysis of B958CR cells probed for both LMP2A and γ-adaptin revealed a similar pattern of co-localization (data not shown).



(41K):

Fig. 8. LMP2B co-localizes with intracellular CD19. Serial laser scanning confocal micrographs were taken of BJAB cells transiently transfected with LMP2AEGFP (A) or LMP2BDsRed (B) and probed for CD19 (red and green, respectively). Z-Plane photomicrographs are indicated numerically through the cell. (C) Confocal micrographs of LMP2BDsRed and TGN marker γ-adaptin in BJAB cells. Bar, 5 µm.
It has been postulated previously that LMP2B may function as a negative regulator of LMP2A because of the nearly identical structure and the critical absence of the signalling domain (Longnecker, 2000 ; Longnecker et al., 1992 ). Analysis of LMP2B has been difficult because of its hydrophobic nature and the lack of a specific anti-LMP2B antiserum. Here, we showed an initial characterization of LMP2B using fluorescent tags to visualize the protein in transiently expressing live and fixed cells. Tagged LMP2B localized to perinuclear membrane compartments in transiently transfected cells (Fig. 2). Localization was not altered by the time post-transfection that the observations were made, the level of LMP2B fluorescence in the transfected cell or the type of cell (lymphocyte or epithelial) receiving the expression vector. Neither was localization altered by which tag (DsRed or EGFP) was present nor where the tags were fused (N or C terminus) onto the LMP2B molecule. LMP2B molecules with FLAG epitope tags had identical localizations. LMP2B molecules with FLAG epitope tags in extracellular loop1 and fluorescent domains fused at the C-terminal end had the same pattern of localization. These results suggest that the tags were not influencing where the LMP2B molecules localized and that the LMP2B sequences in all the tagged molecules were responsible for directing the perinuclear localization. The epitope tags could not be detected on the outside of unpermeabilized cells.

Previous studies showing LMP2A immunofluorescence have described the presence of aggregated proteins and implicated the plasma membrane as a significant site of localization (Longnecker et al., 1991 ; Longnecker & Kieff, 1990 ). Those studies showed no live cell localizations, co-localization with surface markers or detection of the protein in unpermeabilized cells. Nevertheless, differences in the localization of LMP2A and LMP2B would have important implications for the functional role of LMP2B. Our analysis of transiently co-expressed LMP2A and LMP2B proteins showed that there was a high degree of co-localization observed when recombinant LMP2A and LMP2B plasmids were co-transfected into BJAB or 293T cells and viewed simultaneously by live cell fluorescence microscopy. When LMP2BDsRed was transiently transfected into B958CR cells, more than 95% of LMP2B co-localized with the endogenously expressed LMP2A. In these cells, at least one quarter of endogenous LMP2A was not co-localized with LMP2B. This could reflect a real difference in the localization of LMP2A. Since these cells had pre-existing LMP2A proteins at the time that they were transfected, it is possible that only LMP2A synthesized de novo in the post-transfection period was co-localizing with LMP2B. It is possible that only when the two proteins are being made together is LMP2B able to restrict the trafficking of LMP2A. The very high degree of co-localization seen in co-transfection experiments is consistent with this scenario.

LMP2A in the absence of LMP2B might be able to traffic within the endomembrane system and work its way to the surface. The notable difference in LMP2A and LMP2B localization was the significant co-localization of endogenous LMP2A with EEA-1, an endosomal marker in B958CR cells. A similar association was not detected in any LMP2B-transfected cells. This is consistent with a less restricted movement for LMP2A in the absence of LMP2B and leaves open the possibility that some of these molecules are surface bound. However, experiments with the loop1-tagged LMP2A and LMP2B proteins suggest that less than 1% of the detectable LMP2 proteins are on the surface. The appearance of the LMP2A truncation mutants spread across the surface of the transfected cells indicated that the loop1 epitopes are readily detectable when they are in plasma membranes and that an intracellular retention phenotype is associated with sequences in the LMP2 transmembrane domain.

Markers for cellular membrane compartments were used to refine the intracellular location of LMP2B. The most significant co-localization was detected with a protein marker for the trans-Golgi network (γ-adaptin, a scaffolding component involved in vesicle budding from the Golgi endomembrane system). Both epi-fluorescence and confocal sectioning showed the same high degree of localization. There was a detectable, albeit much lower, level of co-localization with BIP-1. These fluorescence results suggest that we might be detecting the synthesis of LMP2B on ER membranes and a very slow movement of LMP2B to and through the Golgi relative to LMP2A, where there is less than 1% BIP-1 association detected. LMP2B then appears to be deposited into an intracellular perinuclear vesicular membrane compartment. Evidence for an association of LMP2B with endosomes or lysosomes was not obtained. About 10% of the LMP2B fluorescence was associated with CD19 in an apparent contradiction to the finding that there was no surface fluorescence from loop1 epitope-tagged LMP2B. Confocal sectioning revealed that the CD19 fluorescence associated with LMP2B was intracellular and perinuclear. LMP2A did not show a similar CD19 co-localization. In contrast to LMP2B, more than half of the LMP2A fluorescence was found associated with the endosomal membrane compartment. Further studies are required to determine if this association represents an important difference in the trafficking of LMP2A and LMP2B.

Our studies show that when co-expressed with LMP2A, LMP2B co-localizes and probably associates with LMP2A in the same compartment within the cell. Neither protein seemed to redirect or dramatically influence the localization of the other molecule. In addition, neither protein showed a pattern of fluorescence consistent with a significant plasma membrane localization or surface presence. Our fluorescence microscopy studies included more controls, more cell lines and more LMP2 constructs than earlier reports. We have performed confocal microscopy studies clearly showing the absence of recombinant LMP2B and LMP2A localization to the surface and a lack of co-localization on the surface with a cell surface marker, CD19. A recent report by C. W. Dawson that used different cells and tagged LMP2 proteins reached similar conclusions (Dawson, 2001 ). In the main finding of their study of epithelial cells, LMP2A and LMP2B were described as intracellular and perinuclear. The conclusions about the sub-cellular compartment localization were not identical to ours but different compartment markers were employed so direct comparison is problematic. In our study, both lymphocytes and epithelial cells are presented and the results from the two cell types are consistent. Taken together, the evidence from the two studies indicates that the LMP2 proteins rarely visit the plasma membrane and that sequences within the transmembrane domain retain the molecules within intracellular membrane compartments. Intracellular localization is compatible with previous genetic and biochemical studies of LMP2 function. It is now necessary to determine what factors affect the localization of LMP2 proteins and whether alterations in the environment of a virus-infected cell change the localization. It will also be important to determine the extent to which LMP2 protein localization affects the localization and functioning of receptors and signal transducers. An intracellular destination for a latency-associated membrane protein offers intriguing possibilities for the control of the latent state and for the triggering mechanism for reactivation of the lytic cycle.

This research was supported in part by CORE grant for vision research EY08098, The Eye and Ear Foundation and Research to Prevent Blindness. We especially thank Dr Paul Kinchington for his assistance with the confocal microscopy.

References

Babcock, G. J., Decker, L. L., Volk, M. & Thorley-Lawson, D. A. (1998). EBV persistence in memory B cells in vivo. Immunity 9, 395-404.[Medline]

Babcock, G. J., Decker, L. L., Freeman, R. B. & Thorley-Lawson, D. A. (1999). EpsteinBarr virus-infected resting memory B cells, not proliferating lymphoblasts, accumulate in the peripheral blood of immunosuppressed patients. Journal of Experimental Medicine 190, 567-576.[Abstract/Free Full Text]

Babcock, G. J., Hochberg, D. & Thorley-Lawson, D. A. (2000). The expression pattern of EpsteinBarr virus latent genes in vivo is dependent upon the differentiation stage of the infected B cell. Immunity 13, 497-506.[Medline]

Cohen, J. I. (1999). The biology of EpsteinBarr virus: lessons learned from the virus and the host. Current Opinion in Immunology 11, 365-370.[Medline]

Dawson, C. W., George, J. H., Blake, S. M. S., Longnecker, R. & Young, L. S. (2001). The EpsteinBarr virus encoded latent membrane protein 2A augments signaling from latent membrane protein 1. Virology 289, 192-207.[Medline]

Fruehling, S., Lee, S. K., Herrold, R., Frech, B., Laux, G., Kremmer, E., Grasser, F. A. & Longnecker, R. (1996). Identification of latent membrane protein 2A (LMP2A) domains essential for the LMP2A dominant-negative effect on B-lymphocyte surface immunoglobin signal transduction. Journal of Virology 70, 6216-6226.[Abstract/Free Full Text]

Khan, G., Miyashita, E. M., Yang, B., Babcock, G. J. & Thorley-Lawson, D. A. (1996). Is EBV persistence in vivo a model for B cell homeostasis? Immunity 5, 173-179.[Medline]

Kieff, E. (1996a). EpsteinBarr virus and its replication. In Fundamental Virology , pp. 1109-1162. Edited by D. M. Knipe, B. N. Fields & P. M. Howley. Philadelphia:LippincottRaven.

Kieff, E. (1996b). Herpesviridae. In Fields Virology , pp. 2343-2396. Edited by B. N. Fields, D. M. Knipe & P. M. Howley. Philadelphia:LippincottRaven.

Kim, O. J. & Yates, J. L. (1993). Mutants of EpsteinBarr virus with a selective marker disrupting the TP gene transform B cells and replicate normally in culture. Journal of Virology 67, 7634-7640.[Abstract/Free Full Text]

Konishi, K. M., Maruo, S., Kato, H. & Takada, K. (2001). Role of EpsteinBarr virus-encoded latent membrane protein 2A on virus-induced immortalization and virus activation. Journal of General Virology 82, 1451-1456.[Abstract/Free Full Text]

Laux, G., Perricaudet, M. & Farrell, P. J. (1988). A spliced EpsteinBarr virus gene expressed in immortalized lymphocytes is created by circularization of the linear viral genome. EMBO Journal 7, 769-774.[Medline]

Longnecker, R. (2000). EpsteinBarr virus latency: LMP2, a regulator or means for EpsteinBarr virus persistence? Advances in Cancer Research 79, 175-200.[Medline]

Longnecker, R. & Kieff, E. (1990). A second EpsteinBarr virus membrane protein (LMP2) is expressed in latent infection and colocalizes with LMP1. Journal of Virology 64, 2319-2326.[Abstract/Free Full Text]

Longnecker, R., Druker, B., Roberts, T. M. & Kieff, E. (1991). An EpsteinBarr virus protein associated with cell growth transformation interacts with a tyrosine kinase. Journal of Virology 65, 3681-3692.[Abstract/Free Full Text]

Longnecker, R., Miller, C. L., Miao, X. Q., Marchini, A. & Kieff, E. (1992). The only domain which distinguishes EpsteinBarr virus latent membrane protein 2A (LMP2A) from LMP2B is dispensable for lymphocyte infection and growth transformation in vitro; LMP2A is therefore nonessential. Journal of Virology 66, 6461-6469.[Abstract/Free Full Text]

Longnecker, R., Miller, C. L., Miao, X. Q., Tomkinson, B. & Kieff, E. (1993). The last seven transmembrane and carboxy-terminal cytoplasmic domains of EpsteinBarr virus latent membrane protein 2 (LMP2) are dispensable for lymphocyte infection and growth transformation in vitro. Journal of Virology 67, 2006-2013.[Abstract/Free Full Text]

Miller, G. (1990). The switch between latency and replication of EpsteinBarr virus. Journal of Infectious Diseases 161, 833-844.[Medline]

Miyashita, E. M., Yang, B., Lam, K. M. C., Crawford, D. H. & Thorley-Lawson, D. A. (1995). A novel form of EpsteinBarr virus latency in normal B cells in vivo. Cell 80, 593-601.[Medline]

Miyashita, E. M., Yang, B., Babcock, G. J. & Thorley-Lawson, D. A. (1997). Identification of the site of EpsteinBarr virus persistence in vivo as a resting B cell. Journal of Virology 71, 4882-4891.[Abstract/Free Full Text]

Qu, L. & Rowe, D. T. (1992). EpsteinBarr virus latent gene expression in uncultured peripheral blood lymphocytes. Journal of Virology 66, 3715-3724.[Abstract/Free Full Text]

Rivailler, P., Quink, C. & Wang, F. (1999). Strong selective pressure for evolution of an EpsteinBarr virus LMP2B homologue in the rhesus lymphocryptovirus. Journal of Virology 73, 8867-8872.[Abstract/Free Full Text]

Rowe, D. T. (1999). EpsteinBarr virus immortalization and latency. Frontiers in Bioscience 4, 346-371.

Rowe, D. T., Hall, L., Joab, I. & Laux, G. (1990). Identification of the EpsteinBarr virus terminal protein gene products in latently infected lymphocytes. Journal of Virology 64, 2866-2875.[Abstract/Free Full Text]

Sample, J., Liebowitz, D. & Kieff, E. (1989). Two related EpsteinBarr virus membrane proteins are encoded by separate genes. Journal of Virology 63, 933-937.[Abstract/Free Full Text]

Sugden, B. (1994). Latent infection of B lymphocytes by EpsteinBarr virus. Seminars in Virology 5, 197-205.

Thorley-Lawson, D. A. & Babcock, G. J. (1999). A model for persistent infection with EpsteinBarr virus: the stealth virus of human B cells. Life Sciences 65, 1433-1453.[Medline]

Received 18 December 2001; accepted 2 February 2002.