Research Article

Orf virus encodes a functional dUTPase gene

Journal of General Virology 2002; 83(5):1043

PubMed

Abstract

The present study is the first report on the functional activity of a parapoxvirus-encoded dUTPase. The dUTPase gene of the attenuated orf virus (ORFV), strain D1701, was expressed as a bacterial thioredoxin fusion protein. In vitro assays showed that ORFV dUTPase was highly specific for dUTP as substrate. The enzyme was active over a broad pH range (pH 6·09·0), with maximal enzymatic activity at pH 7·0 in the presence of Mg2+ cations. Kinetic studies of the recombinant ORFV dUTPase revealed an apparent Km of 4·0 µM, which is more similar to that of the mammalian or African swine fever virus enzyme than to the Km of vaccinia virus dUTPase. Enzyme activity was also found with purified ORFV particles, indicating its virion association.



Orf virus (ORFV), the prototypic member of the parapoxviruses (PPV), is the causative agent of contagious ecthyma (orf) in sheep and goats (Robinson & Balassu, 1981 ) and can also infect humans (Haig & Mercer, 1998 ; Hunskaar, 1986 ). It exhibits gene homologies with other poxviruses, such as vaccinia virus (VACV) (Fleming et al., 1993 ; Rziha et al., 1999 ) but, unlike other poxvirus infections, which can be systemic, ORFV infection is locally restricted to the skin. ORFV strain D1701 was originally isolated from sheep and adapted to growth in cell culture. The resulting highly attenuated virus strain is used as a live vaccine against orf in sheep (Mayr et al., 1981 ). PPV, and in particular ORFV, are promising candidates for viral gene vectors (Robinson & Lyttle, 1992 ) and the non-pathogenic strain D1701 appears to be ideal for the construction of an ORFV recombinant vector (Rziha et al., 1999 , 2000 ).

Little is known about the factors and mechanisms involved in ORFV virulence. Several putative virulence genes have been identified, such as the vascular endothelial growth factor homologue (Lyttle et al., 1994 ; Savory et al., 2000 ), an interleukin (IL)-10 homologue (Fleming et al., 1997 ), a double-stranded RNA-binding protein (McInnes et al., 1998 ) and a factor inhibiting the cytokines granulocyte-macrophage colony-stimulating factor and IL-2 (Deane et al., 2000 ). Sequence homology has indicated the presence of a dUTPase gene in both the virulent ORFV strain NZ2 (Fleming et al., 1995 ; Mercer et al., 1989 ) and the attenuated ORFV strain D1701 (Cottone et al., 1998 ), although in the latter strain, the transcription stop motif of the dUTPase gene is missing due to a genomic rearrangement that also resulted in the loss of a gene, termed E2L (Cottone et al., 1998 ), of unknown function.

The ubiquitous enzyme dUTPase catalyses the hydrolysis of dUTP to dUMP and pyrophosphate, thereby preventing incorporation of uracil into DNA (Kornberg & Baker, 1991 ; Tye et al., 1977 ). In some organisms, dUMP is essential for the de novo synthesis of dTTP (Bertani et al., 1963 ). Many viruses are known to encode a dUTPase, including several lentiviruses (Elder et al., 1992 ; Lichtenstein et al., 1995 ; Nord et al., 1997 ; Petursson et al., 1998 ; Threadgill et al., 1993 ; Turelli et al., 1997 ; Wagaman et al., 1993 ), herpesviruses (Fisher & Preston, 1986 ; Jöns et al., 1996 ; Liang et al., 1993 ; Ross et al., 1997 ; Sommer et al., 1996 ; Williams, 1984 ) and African swine fever virus (ASFV) (Dixon et al., 1994 ). Poxvirus dUTPase homologues have been described for VACV (Slabaugh & Roseman, 1989 ) and swinepox virus (SWPV) (Massung et al., 1993 ). Although the dUTPases share both sequence and some functional homology, species-specific enzymatic properties and structural differences can be identified (McGeoch, 1990 ; Cedergren-Zeppezauer et al., 1992 ; Hokari & Sakagishi, 1987 ).

Mutants of alphaherpesviruses negative for dUTPase were found to be attenuated in vivo, suggesting a role for this enzyme in virulence (Jöns et al., 1997 ; Liang et al., 1997 ; Pyles et al., 1992 ). The occurrence of cell culture-derived, attenuated ORFV variants with spontaneous deletions of the dUTPase and at least two adjacent genes indicated that the dUTPase is not essential for ORFV growth in vitro (Fleming et al., 1995 ; McInnes et al., 2001 ) and could represent a virulence gene in ORFV. The predicted amino acid sequence of the D1701 ORFV protein revealed the presence of the five major conserved motifs, which are characteristic for most of the known dUTPases and suggested to be important for enzyme activity (data not shown). Protein sequence identity to other dUTPases ranges between 94% for ORFV NZ2, 60% for adenovirus, 56% for VACV (strain Copenhagen), 56% for cowpox virus, 52% for SWPV dUTPase and 71·5% for human cell dUTPase.

This study addressed the question of whether or not ORFV strain D1701 encodes a functional dUTPase. The ORFV dUTPase was expressed as a prokaryotic fusion protein and used for functional assays in vitro. To this end, the 474 bp coding region of the dUTPase gene of ORFV strain D1701 was amplified by PCR using the primers 5' CTCGCCACGGTACCCATGGAGTTCTG 3', which contains the start codon and the N-terminal sequence of the dUTPase gene together with a KpnI site (underlined), and 5' GGGACTCCTGCAGTTTGATTAGCTGA 3', which covers the C-terminal coding region with the translation stop codon and a PstI site (underlined). The PCR fragment was purified (QIAEX; Qiagen), digested with the restriction enzymes KpnI and PstI (New England Biolabs) and cloned into the pTrxFus vector plasmid (Invitrogen). Sequencing confirmed the in-frame fusion with thioredoxin (Trx) as the 14 kDa N-terminal fusion partner. The soluble TrxdUTPase protein (31 kDa) was purified from bacteria by affinity chromatography on a phenylarsine oxide-containing resin column, as recommended by the manufacturer (ThioBond Resin; Invitrogen). The resin-bound fusion protein could be eluted with 50500 mM β-mercaptoethanol, as shown by SDSPAGE and immunoblotting of the elutes using a Trx-specific monoclonal antibody (mAb) (data not shown). The elutes containing fusion protein were dialysed, concentrated using a Centripep-30 mini-concentrator (Millipore) and, after determination of the protein concentration (Bio-Rad), stored in 50% glycerol at -20 °C.

Quantification of the [5-3H]dUTP hydrolysis to [5-3H]dUMP was determined by filter-binding assays, as described (Williams & Cheng, 1979 ). Using deoxy[5-3H]uridine 5' triphosphate as substrate, standard assays (reaction volume 25 µl) containing 1·2 pmol fusion protein, 0·1 nmol [5-3H]dUTP and 20 mM MgCl2 were performed in 50 mM Tris (pH 7·0) at 37 °C for 30 min. All filter-binding assays were performed in triplicate and the hydrolysis of [5-3H]dUTP was quantified by scintillation counting of a 5 µl aliquot of each reaction, spotted onto filter discs (NA45; Schleicher & Schüll) after a reaction time of 0 and 30 min. The products from the dUTPase reaction were identified by thin-layer chromatography (TLC) on polyethyleniminecellulose plates (Merck), which were treated with En3Hance (NEN Life Science) and exposed to X-ray films. The comparison of the chromatographic spots with those of individual, pure authentic compounds allowed the identification of the substances (Beardsley & Abelson, 1980 ). As negative controls, a TrxE2L fusion protein and Trx protein were expressed and purified identically to the TrxdUTPase; no dUTP hydrolysis was observed (data not shown). The Trx part of the fusion protein could be removed by enterokinase digestion from the resin-bound fusion protein and subsequent treatment with a soybean trypsin inhibitor resin (EKMax; Invitrogen). Comparative experiments demonstrated the same enzymatic activity of the complete fusion protein but substantial losses of the enzyme after removal of the Trx fusion partner (data not shown). Therefore, most of the functional assays were performed with the TrxdUTPase fusion protein.

Purified ORFV dUTPase showed activity over a pH range from 6·0 to 9·0. At pH 9·0, dUTP hydrolysis still accounted for 50% of the maximum value measured at neutral conditions, demonstrating the stability of the enzyme at alkaline pH. Optimal activity was observed in 50 mM Tris (pH 7·0), decreasing rapidly under acidic conditions. No activity at all was found at pH 5·0 (data not shown). Raising the reaction temperature from 25 to 37 °C increased the hydrolysis rate of dUTP. dUMP production was maximal at 37 °C and decreased with increasing temperatures of incubation. At 41 °C, dUTPase activity was significantly reduced, probably due to the heat denaturation of the protein (data not shown).

The biological activity of the ORFV dUTPase required the presence of certain divalent cations. Highest dUTPase enzymatic activity was found at 20 mM MgCl2 (92% activity) or at 5 mM MnCl2 (90% activity) (Fig. 1). The dUTPase reaction could also be stimulated by the addition of 30 mM ZnCl2, although to a clearly lesser degree (56% activity). All other divalent cations tested (Cu2+, Ca2+ and Ni2+) had little or no effect on enzymatic activity (data not shown). Increasing the concentration of EDTA inhibited dUTP hydrolysis. Using standard assay conditions (20 mM MgCl2), the addition of 50 mM EDTA reduced hydrolysis by 50% and 100 mM EDTA completely inhibited enzyme activity (data not shown). Hydrolysis of dTTP, dGTP, dATP, dCTP and UTP as substrates was not detectable by TLC (data not shown), indicating a high specificity for dUTP as substrate. Kinetic studies of the reaction catalysed by ORFV dUTPase were performed under standard assay conditions with various substrate concentrations, ranging from 0·5 to 10 µM dUTP, in the presence of 20 mM MgCl2 (Fig. 2). LineweaverBurk analysis of these results revealed a Km for the enzyme of approximately 4·0 µM (Fig. 2b).



(16K):

Fig. 1. MgCl2 and MnCl2 promote the activity of ORFV dUTPase. The influence of divalent cations (, MgCl2; , MnCl2) on dUTPase activity was determined under standard assay conditions by filter-binding assays. The percentages of hydrolysis of dUTP to dUMP are plotted against the molar concentration of cations.


(8K):

Fig. 2. (a) Substrateproduct relationship of dUTPase reaction. Tests were performed under standard assay conditions in the presence of 20 mM MgCl2 and variable concentrations of [5-3H]dUTP as substrate. The concentration of dUMP produced is plotted against the different substrate concentrations to show the linearity of the reaction. (b) Double reciprocal LineweaverBurk plot for determination of the Km of the ORFV dUTPase (4·0 µM).

Collectively, the results demonstrate that the ORFV dUTPase has a high specificity for dUTP as substrate, functioning over a broad pH range (pH 6·09·0), with an optimum at pH 7·0, similar to that of VACV dUTPase and human dUTPase (Broyles, 1993 ; Williams & Cheng, 1979 ). The activity of the ORFV enzyme was dependent on the presence of divalent cations, with an optimum at 20 mM MgCl2 or 5 mM MnCl2, with ZnCl2 (optimum 30 mM) being less effective as a co-factor, in contrast to the VACV enzyme, which was stimulated most by the addition of Zn2+ ions (Broyles, 1993 ). In addition, the calculated Km of the recombinant ORFV dUTPase was low (4·0 µM) compared to that reported for VACV dUTPase (100 µM; Broyles, 1993 ) or for mouse mammary tumour virus (28 µM; Köppe et al., 1994 ) but resembled those reported for human dUTPase (2·6 µM; Climie et al., 1994 ), ASFV dUTPase (1·0 µM; Oliveros et al., 1999 ), equine infectious anaemia virus dUTPase (1·1 µM; Nord et al., 1997 ), Escherichia coli dUTPase (1·0 µM; Larsson et al., 1996 ) and herpes simplex virus type 1 dUTPase (0·3 µM; Bergman et al., 1998 ), although a variety of different expression systems were used in each of these studies.

Recently, ORFV dUTPase was reported to be more similar to mammalian dUTPases and was separated from other known poxvirus counterparts (Baldo & McClure, 1999 ). The author suggested that ORFV has probably acquired the corresponding gene independently from other poxviruses via horizontal gene transfer from the host cell genome. This is supported by data on sequence homology and the biochemical properties of the ORFV dUTPase presented here. Although mammalian and viral dUTPases share some enzymatic properties that reflect their close phylogenetic linkage, minor variations might have developed due to the adaptation to their specific microenvironments.

Functionally active dUTPase was found to be associated with the virion of both the attenuated ORFV strain D1701 and the virulent ORFV field isolate BO15 (Table 1). Viruses were propagated and purified as described previously (Cottone et al., 1998 ; Joklik, 1962 ) and the purity of the virion preparations verified by electron microscopy. Different amounts were incubated with dUTP (100 pmol) under standard assay conditions, with the dUTPase fusion protein included as a control. Comparable amounts of dUTP hydrolysis (6979%) were found with 40 ng TrxdUTPase and 1·7 µg purified BO15, which could be completely inhibited by the addition of 100 mM EDTA. D1701 virions displayed considerably lower turnover rates of dUTP (Table 1). The presence of dUTPase in the virions may be not surprising in view of the fact that poxviruses include various metabolic enzymes in this compartment. Moreover, it has been shown that the dUTPase of the alphaherpesvirus pseudorabies virus represents an integral part of the outer virus membrane and is considered to play a role in infection or during assembly of progeny virions (Jöns et al., 1996 ). The possibly higher dUTPase activity found in virions of the virulent ORFV strain BO15 as compared to the attenuated strain D1701 might be caused by different relative quantities of the enzyme present in the two ORFV strains. Differences in expression of the gene could be one possibility. As reported previously, the original transcription stop motif is absent in ORFV strain D1701, leading to a relatively long non-coding 3' end of the mRNA (Cottone et al., 1998 ). Analyses of enzymatic activity of infected and non-infected cells were performed; however, the results were not unequivocal due to intrinsic cellular dUTPase activity (5060% activity). Therefore, different efficiency of incorporation of the enzyme into virus particles cannot be excluded.


Table 1. Detection of virion-associated dUTPase activity


This study represents the first functional characterization of the dUTPase encoded by a PPV. Whether this early gene of ORFV might be involved in virus pathogenesis remains to be determined. Several dUTPases encoded by herpesviruses and lentiviruses are thought to determine virulence and cell tropism and represent a potential target for antiviral drug therapy (McIntosh & Haynes, 1997 ; Kremmer et al., 1999 ). Naturally occurring ORFV infection is restricted to terminally differentiated, non-dividing keratinocytes of the epidermis with low intracellular dUTPase activity (Mahagaokar et al., 1980 ; Pardo & Gutierrez, 1990 ). To prevent incorporation of uracil ribonucleoside into the viral genome, it may be favourable for ORFV to express its own dUTPase. High dUTPase activity was demonstrated in actively dividing, cultured cells (Duker & Grant, 1980 ), which might favour the selection of ORFV variants during cell culture adaptation. Those ORFV with lower dUTPase activity or deleted dUTPase genes could be less virulent in vivo due to a possible deficiency in replication. The generation of a dUTPase knockout mutant of, for example, the virulent ORFV strain BO15 will finally help to elucidate the role and importance of this enzyme for the attenuation of ORFV. The possibility of substituting the non-essential dUTPase gene as a potential virulence factor is also of considerable interest for the use of PPV as recombinant vectors.
The excellent technical assistance of B. Bauer and A. Braun is gratefully acknowledged. The authors would like to thank David Haig, Moredun Research Institute, for his contribution and support to the work, and F. Weiland and K. Mildner, Federal Research Centre for Virus Diseases of Animals, for electron microscopy analyses. Part of the studies has been financially supported by BAYER AG, Leverkusen, FRG.

References

Baldo, A. M. & McClure, M. A. (1999). Evolution and horizontal transfer of dUTPase-encoding genes in viruses and their hosts. Journal of Virology 73, 7710-7721.[Abstract/Free Full Text]

Beardsley, G. P. & Abelson, H. T. (1980). A thin-layer chromatographic method for separation of thymidine and deoxyuridine nucleotides. Analytical Biochemistry 105, 311-318.[Medline]

Bergman, A. C., Nyman, P. O. & Larsson, G. (1998). Kinetic properties and stereospecificity of the monomeric dUTPase from herpes simplex virus type 1. FEBS Letters 441, 327-330.[Medline]

Bertani, L. E., Häggmark, A. & Reichard, P. (1963). Enzymatic synthesis of deoxyribonucleotides. II. Formation and interconversion of deoxyuridine phosphates. Journal of Biological Chemistry 238, 3407-3413.[Free Full Text]

Broyles, S. S. (1993). Vaccinia virus encodes a functional dUTPase. Virology 195, 863-865.[Medline]

Cedergren-Zeppezauer, E. S., Larsson, G., Nyman, P. O., Dauter, Z. & Wilson, K. S. (1992). Crystal structure of a dUTPase. Nature 355, 740-743.[Medline]

Climie, S., Lutz, T., Radul, J., Sumner-Smith, M., Vandenberg, E. & McIntosh, E. (1994). Expression of trimeric human dUTP pyrophosphatase in Escherichia coli and purification of the enzyme. Protein Expression and Purification 5, 252-258.[Medline]

Cottone, R., Büttner, M., Bauer, B., Henkel, M., Hettich, E. & Rziha, H.-J. (1998). Analysis of genomic rearrangement and subsequent gene deletion of the attenuated Orf virus strain D1701. Virus Research 56, 53-67.[Medline]

Deane, D., McInnes, C. J., Percival, A., Wood, A., Thomson, J., Lear, A., Gilray, J., Fleming, S., Mercer, A. & Haig, D. (2000). Orf virus encodes a novel secreted protein inhibitor of granulocyte-macrophage colony-stimulating factor and interleukin-2. Journal of Virology 74, 1313-1320.[Abstract/Free Full Text]

Dixon, L. K., Twigg, S. R. F., Baylis, S. A., Vydelingum, S., Bristow, C., Hammond, J. M. & Smith, G. L. (1994). Nucleotide sequence of a 55 kbp region from the right end of the genome of a pathogenic African swine fever virus isolate (Malawi LIL20/1). Journal of General Virology 75, 1655-1684.[Abstract/Free Full Text]

Duker, N. J. & Grant, C. L. (1980). Alterations in the levels of deoxyuridine triphosphatase, uracil-DNA glycosylase and AP endonuclease during the cell cycle. Experimental Cell Research 125, 493-497.[Medline]

Elder, J. H., Lerner, D. L., Hasselkus-Light, C. S., Fontenot, D. J., Hunter, E., Luciw, P. A., Montelaro, R. C. & Phillips, T. R. (1992). Distinct subsets of retroviruses encode dUTPase. Journal of Virology 66, 1791-1794.[Abstract/Free Full Text]

Fisher, F. B. & Preston, V. G. (1986). Isolation and characterization of herpes simplex virus type 1 mutants which fail to induce dUTPase activity. Virology 148, 190-197.[Medline]

Fleming, S. B., Blok, J., Fraser, K. M., Mercer, A. A. & Robinson, A. J. (1993). Conservation of gene structure and arrangement between vaccinia virus and orf virus. Virology 195, 175-184.[Medline]

Fleming, S. B., Lyttle, D. J., Sullivan, J. T., Mercer, A. A. & Robinson, A. J. (1995). Genomic analysis of a transposition-deletion variant of orf virus reveals a 3·3 kbp region of non-essential DNA. Journal of General Virology 76, 2969-2978.[Abstract/Free Full Text]

Fleming, S. B., McCaughan, C. A., Andrews, A. E., Nash, A. D. & Mercer, A. A. (1997). A homolog of interleukin-10 is encoded by the poxvirus orf virus. Journal of Virology 71, 4857-4861.[Abstract]

Haig, D. M. & Mercer, A. A. (1998). Ovine diseases. Orf. Veterinary Research 29, 311-326.[Medline]

Hokari, S. & Sakagishi, Y. (1987). Purification and characterization of deoxyuridine triphosphate nucleotidohydrolase from anemic rat spleen: a trimer composition of the enzyme protein. Archives of Biochemistry and Biophysics 253, 350-356.[Medline]

Hunskaar, S. (1986). Giant orf in a patient with lymphocytic leukaemia. British Journal of Dermatology 114, 631-634.[Medline]

Joklik, W. K. (1962). The purification of four strains of poxvirus. Virology 18, 9-18.[Medline]

Jöns, A., Granzow, H., Kuchling, R. & Mettenleiter, T. C. (1996). The UL49.5 gene of pseudorabies virus codes for an O-glycosylated structural protein of the viral envelope. Journal of Virology 70, 1237-1241.[Abstract]

Jöns, A., Gerdts, V., Lange, E., Kaden, V. & Mettenleiter, T. C. (1997). Attenuation of dUTPase-deficient pseudorabies virus for the natural host. Veterinary Microbiology 56, 47-54.[Medline]

Köppe, B., Menendez-Arias, L. & Oroszlan, S. (1994). Expression and purification of the mouse mammary tumor virus gag-pro transframe protein p30 and characterization of its dUTPase activity. Journal of Virology 68, 2313-2319.[Abstract/Free Full Text]

Kornberg, A. & Baker, T. (editors) (1991). DNA Replication, 2nd edn. New York: W. H. Freeman.

Kremmer, E., Sommer, P., Holzer, D., Galetsky, S. A., Molochkov, V. A., Gurtsevitch, V., Winkelmann, C., Lisner, R., Niedobitek, G. & Grässer, F. A. (1999). Kaposis sarcoma-associated herpesvirus (human herpesvirus-8) ORF54 encodes a functional dUTPase expressed in the lytic replication cycle. Journal of General Virology 80, 1305-1310.[Abstract]

Larsson, G., Nyman, P. O. & Kvassman, J.-O. (1996). Kinetic characterization of dUTPase from Escherichia coli. Journal of Biological Chemistry 271, 24010-24016.[Abstract/Free Full Text]

Liang, X., Tang, M., Manns, B., Babiuk, L. A. & Zamb, T. J. (1993). Identification and deletion mutagenesis of the bovine herpesvirus 1 dUTPase gene and a gene homologous to herpes simplex virus UL49.5. Virology 195, 42-50.[Medline]

Liang, X., Chow, B. & Babiuk, L. A. (1997). Study of immunogenicity and virulence of bovine herpesvirus 1 mutants deficient in the UL49 homolog, UL49.5 homolog and dUTPase genes in cattle. Vaccine 15, 1057-1064.[Medline]

Lichtenstein, D. L., Rushlow, K. E., Cook, R. F., Raabe, M. L., Swardson, C. J., Kociba, G. J., Issel, C. J. & Montelaro, R. C. (1995). Replication in vitro and in vivo of an equine infectious anemia virus mutant deficient in dUTPase activity. Journal of Virology 69, 2881-2888.[Abstract]

Lyttle, D. J., Fraser, K. M., Fleming, S. B., Mercer, A. A. & Robinson, A. J. (1994). Homologs of vascular endothelial growth factor are encoded by the poxvirus orf virus. Journal of Virology 68, 84-92.[Abstract/Free Full Text]

McGeoch, D. J. (1990). Protein sequence comparisons show that the pseudoproteases encoded by poxviruses and certain retroviruses belong to the deoxyuridine triphosphatase family. Nucleic Acids Research 18, 4105-4110.[Abstract/Free Full Text]

McInnes, C. J., Wood, A. R. & Mercer, A. A. (1998). Orf virus encodes a homolog of the vaccinia virus interferon-resistance gene E3L. Virus Genes 17, 107-115.[Medline]

McInnes, C. J., Wood, A. R., Nettleton, P. F. & Gilray, J. (2001). Genomic comparison of an avirulent strain of Orf virus with that of a virulent wild type isolate reveals that the Orf virus G2L gene is non-essential for replication. Virus Genes 22, 141-150.[Medline]

McIntosh, E. M. & Haynes, R. H. (1997). dUTP pyrophosphatase as a potential target for chemotherapeutic drug development. Acta Biochimica Polonica 44, 159-171.[Medline]

Mahagaokar, S., Orengo, A. & Rao, P. N. (1980). The turnover of deoxyuridine triphosphate during the HeLa cell cycle. Experimental Cell Research 125, 86-94.[Medline]

Massung, R. F., Jayarama, V. & Moyer, R. W. (1993). DNA sequence analysis of conserved and unique regions of swinepox virus: identification of genetic elements supporting phenotypic observations including a novel G protein-coupled receptor homologue. Virology 197, 511-528.[Medline]

Mayr, A., Herlyn, M., Mahnel, H., Danco, A., Zach, A. & Bostedt, H. (1981). Control of ecthyma contagiosum (pustular dermatitis) of sheep with a new parenteral cell culture live vaccine. Zentralblatt für Veterinarmedizin. Reihe B 28, 535552 (in German).

Mercer, A. A., Fraser, K. M., Stockwell, P. A. & Robinson, A. J. (1989). A homologue of retroviral pseudoproteases in the parapoxvirus, orf virus. Virology 172, 665-668.[Medline]

Nord, J., Larsson, G., Kvassman, J. O., Rosengren, A. M. & Nyman, P. O. (1997). dUTPase from the retrovirus equine infectious anemia virus: specificity, turnover and inhibition. FEBS Letters 414, 271-274.[Medline]

Oliveros, M., Garcia-Escudero, R., Alejo, A., Vinuela, E., Salas, M. L. & Salas, J. (1999). African swine fever virus dUTPase is a highly specific enzyme required for efficient replication in swine macrophages. Journal of Virology 73, 8934-8943.[Abstract/Free Full Text]

Pardo, E. G. & Gutierrez, C. (1990). Cell cycle- and differentiation stage-dependent variation of dUTPase activity in higher plant cells. Experimental Cell Research 186, 90-98.[Medline]

Petursson, G., Turelli, P., Matthiasdottir, S., Georgsson, G., Andresson, O. S., Torsteinsdottir, S., Vigne, R., Andresdottir, V., Gunnarsson, E., Agnarsdottir, G. & Querat, G. (1998). Visna virus dUTPase is dispensable for neuropathogenicity. Journal of Virology 72, 1657-1661.[Abstract/Free Full Text]

Pyles, R. B., Sawtell, N. M. & Thompson, R. L. (1992). Herpes simplex virus type 1 dUTPase mutants are attenuated for neurovirulence, neuroinvasiveness, and reactivation from latency. Journal of Virology 66, 6706-6713.[Abstract/Free Full Text]

Robinson, A. J. & Balassu, T. C. (1981). Contagious pustular dermatitis (orf). Veterinary Bulletin 51, 771-782.

Robinson, A. J. & Lyttle, D. J. (1992). Parapoxviruses. Their biology and potential as recombinant vaccines. In Recombinant Poxviruses , pp. 285-327. Edited by M. M. Binns & G. L. Smith. Boca Raton, FL:CRC Press.

Ross, J., Williams, M. & Cohen, J. I. (1997). Disruption of the varicella-zoster virus dUTPase and the adjacent ORF9A gene results in impaired growth and reduced syncytia formation in vitro. Virology 234, 186-195.[Medline]

Rziha, H.-J., Henkel, M., Cottone, R., Meyer, M., Dehio, C. & Büttner, M. (1999). Parapoxviruses: potential alternative vectors for directing the immune response in permissive and non-permissive hosts. Journal of Biotechnology 73, 235-242.[Medline]

Rziha, H.-J., Henkel, M., Cottone, R., Bauer, B., Auge, U., Götz, F., Pfaff, E., Röttgen, M., Dehio, C. & Büttner, M. (2000). Generation of recombinant parapoxviruses: non-essential genes suitable for insertion and expression of foreign genes. Journal of Biotechnology 83, 137-145.[Medline]

Savory, L. J., Stacker, S. A., Fleming, S. B., Niven, B. E. & Mercer, A. A. (2000). Viral vascular endothelial growth factor plays a critical role in orf virus infection. Journal of Virology 74, 10699-10706.[Abstract/Free Full Text]

Slabaugh, M. B. & Roseman, N. A. (1989). Retroviral protease-like gene in the vaccinia virus genome. Proceedings of the National Academy of Sciences, USA 86, 4152-4155.[Abstract/Free Full Text]

Sommer, P., Kremmer, E., Bier, S., König, S., Zalud, P., Zeppezauer, M., Jones, F. J., Mueller-Lantzsch, N. & Grässer, F. A. (1996). Cloning and expression of the EpsteinBarr virus-encoded dUTPase: patients with acute, reactivated or chronic virus infection develop antibodies against the enzyme. Journal of General Virology 77, 2795-2805.[Abstract/Free Full Text]

Threadgill, D. S., Steagall, W. K., Flaherty, M. T., Fuller, F. J., Perry, S. T., Rushlow, K. E., Le Grice, S. F. J. & Payne, S. L. (1993). Characterization of equine infectious anemia virus dUTPase: growth properties of a dUTPase-deficient mutant. Journal of Virology 67, 2592-2600.[Abstract/Free Full Text]

Turelli, P., Guiguen, F., Mornex, J.-F., Vigne, R. & Querat, G. (1997). dUTPase-minus caprine arthritisencephalitis virus is attenuated for pathogenesis and accumulates G-to-A substitutions. Journal of Virology 71, 4522-4530.[Abstract]

Tye, B. K., Nyman, P. O., Lehman, I. R., Hochhauser, S. & Weiss, B. (1977). Transient accumulation of Okazaki fragments as a result of uracil incorporation into nascent DNA. Proceedings of the National Academy of Sciences, USA 74, 154-157.[Abstract/Free Full Text]

Wagaman, P. C., Hasselkus-Light, C. S., Henson, M., Lerner, D. L., Phillips, T. R. & Elder, J. H. (1993). Molecular cloning and characterization of deoxyuridine triphosphatase from feline immunodeficiency virus (FIV). Virology 196, 451-457.[Medline]

Williams, M. V. (1984). Deoxyuridine triphosphate nucleotidohydrolase induced by herpes simplex virus type 1. Purification and characterization of induced enzyme. Journal of Biological Chemistry 259, 10080-10084.[Abstract/Free Full Text]

Williams, M. V. & Cheng, Y. (1979). Human deoxyuridine triphosphate nucleotidohydrolase. Purification and characterization of the deoxyuridine triphosphate nucleotidohydrolase from acute lymphocytic leukemia. Journal of Biological Chemistry 254, 2897-2901.[Abstract/Free Full Text]

Received 8 October 2001; accepted 17 January 2002.