Research Article

Characterization of enzootic nasal tumour virus of goats: complete sequence and tissue distribution

, and Marcelo De las Heras1

1 Facultad de Veterinaria, Departamento de Patología Animal, University of Zaragoza, Miguel Servet 177, Zaragoza, Spain
2 Moredun Research Institute, Edinburgh, UK

Correspondence
Marcelo De las Heras
lasheras{at}unizar.es

Journal of General Virology 2003; 84(8):2245 · https://doi.org/10.1099/vir.0.19125-0

View at publisher PubMed

Abstract

The complete genome sequence of a new isolate of enzootic nasal tumour virus (ENTV-2), associated with enzootic nasal adenocarcinoma (ENA) of goats, was determined. The genome exhibits a genetic organization characteristic of β-retroviruses. ENTV-2 is closely related to the retrovirus (ENTV-1) associated with enzootic adenocarcinoma of sheep, and to jaagsiekte retrovirus. The main sequence differences between these viruses reside in orfX, the U3 LTR, two small regions in gag and the transmembrane (TM) region of env. Sequence analysis of the TM region of env from several sheep and goats naturally affected by ENA suggested that ENTV-1 and ENTV-2 are distinct viruses rather than geographical variants. Although both viruses transform secretory epithelial cells of the ethmoid turbinate, the study of their tissue distribution using specific PCRs showed that ENTV-2 establishes a disseminated lymphoid infection whereas ENTV-1 is mainly confined to the tumour.

The GenBank accession numbers of the sequences reported in this paper are: AY197548, AY196354-AY196359, AY196532 and AY196353.

Enzootic nasal adenocarcinoma (ENA; enzootic nasal tumour, ENT) of sheep and goats and ovine pulmonary adenocarcinoma (OPA or jaagsiekte) are contagious diseases characterized by neoplastic transformation of secretory epithelial cells in the respiratory tract. OPA is a tumour derived from type II pneumocytes and Clara cells in the lung, whereas ENA arises from secretory epithelial cells of the ethmoid turbinate. The gross pathology and histology of ENA in sheep and goats appear to be identical (De las Heras et al., 2003). The association between ENA and enzootic nasal tumour virus (ENTV) is well established (Cousens et al., 1996, 1999; De las Heras et al., 1991a, b, 1993; Vitelozzi et al., 1993), although less well characterized than the relationship between OPA and jaagsiekte sheep retrovirus (JSRV) (Palmarini et al., 1999). These viruses are closely related to each other and to sheep endogenous retroviral sequences (ovERVs) at the nucleic acid level (Hecht et al., 1994; Cousens et al., 1996, 1999). The close homology between JSRV, ENTV and ovERVs was a problem for the development of specific detection techniques for these viruses, but this was resolved by the identification of small areas of sequence that differ between them (Bai et al., 1996; Palmarini et al., 1996; Cousens et al., 1996, 1999). The suggestion that ENTV of sheep and ENTV of goats are distinct viruses (De las Heras et al., 2003) led us to undertake the complete sequencing of a goat ENTV isolate, named ENTV-2, using samples from a single ENA-affected goat. Here we present the sequence of the complete genome of ENTV-2, an exogenous retrovirus with a genetic organization characteristic of β-retroviruses. The molecular sequence of this virus is closely related to sequences of JSRV (York et al., 1992; Palmarini et al., 1999) and ENTV isolated from sheep (Cousens et al., 1999), which we termed ENTV-1, but different enough to allow us to develop specific PCRs for ENTV-2 and ENTV-1 in order to study their tissue distribution in sheep and goats naturally affected by ENA. Sequencing of the ENTV-2 genome.
Nasal fluid from a goat with naturally occurring ENA was collected, clarified and concentrated as described previously (De las Heras et al., 1991b). ENTV-2 was purified by isopycnic centrifugation as described previously for JSRV (Herring et al., 1983). Total RNA was extracted by the acid guanidinium thiocyanate/phenol/chloroform method (Chomczynsky et al., 1987) and cDNA was synthesized by random-primed reverse transcription, using the Moloney murine leukaemia virus M-MLV (H-) riboclone cDNA synthesis system (Promega). Genomic DNA was extracted from ENA and kidney using a method for the isolation of high quality genomic DNA (Wu et al., 1995). Sequencing of the complete genome of ENTV-2 was achieved using overlapping PCR amplimers. The positions of the fragments relative to the genome are shown in Fig. 1. The primers and template used to generate these fragments are shown in Table 1. PCR conditions were 23 mM MgCl2 (see Table 1), 1020 mM Tris (see Table 1), 50 mM KCl, 200 µM each dNTP, 0·125 µM of each primer and 1·25 U Taq polymerase in a total volume of 50 µl. Forty cycles were performed of 60 s at 94 °C, 60 s annealing (for temperature see Table 1) and 60 s at 72 °C (except ii, iii and iv which had extension times of 90 s, 120 s and 150 s, respectively), with a final extension of 5 min at 72 °C.



(17K):

Fig. 1. ENTV-2 sequencing scheme. The clones and subclones generated to obtain the complete sequence of ENTV-2 are shown. Numbering of the PCR fragments is as listed in the text. Suffixes ad denote subclones.

Table 1. Primers and PCR conditions for amplification of fragments used for sequencing of ENTV-2


Alignment of the initial RT-PCR-derived ENTV-2 sequence, i, with ovERVs and with the goat endogenous retrovirus sequence (caERV), obtained by amplification of fragment i from kidney DNA, facilitated the design of ENTV-2 specific PCR primers to amplify fragments ii and iii from tumour DNA. The sequences of these fragments then enabled the specific amplification of fragment iv. PCRs iiiv were also applied to kidney DNA from the same animal to confirm that they did not amplify endogenous sequences. The integrity of the kidney DNA was confirmed by PCR for the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene (Palmarini et al., 1996). To complete the sequencing and resolve any ambiguities, primers were designed from the new ENTV-2 sequence data and further PCRs (vix) were carried out on cDNA from gradient-purified ENTV-2. PCR products were gel-purified and DNA was recovered using the Qiagen gel extraction kit according to the manufacturer's instructions. Fragments were ligated into pGEM-T Easy (Promega) as specified by the manufacturer. At least three clones from two independent PCR reactions were sequenced for each PCR fragment. To facilitate sequencing of the longer clones, these were subcloned, as shown in Fig. 1, using standard techniques. Sequencing was done with an ABI automated sequencer using M13 primers, and the sequences were assembled using the GCG GelAssemble package (Genetics Computer Group, 1994).

Sequence variability studies.
The transmembrane (TM) region of env was cloned and sequenced from ENA genomic DNA of three goats and three sheep naturally affected by ENA, which belonged to different flocks from the north of Spain. DNA was extracted from post-mortem tissue using the Qiagen Tissue Amp kit according to manufacturer's instructions. The PCR primers employed were AGCTGCTCATACTGTGGATC and GATCTTATCTGCTTATTTTCAG for ENTV-2, and AAGCAAGTTAAGTAACTTGAGATC and GCTTAGCCGTCCTAAAAGAG for ENTV-1, chosen from env and LTR regions, respectively. The conditions were 100200 ng of template DNA, 2 mM MgCl2, 10 mM Tris pH 8·9 (ENTV-1 pH 8·3), 50 mM KCl, 200 µM each dNTP, 0·125 µM of each primer and 1·25 U Taq polymerase (Gibco) in a total volume of 50 µl. Forty cycles of 94 °C 60 s, 53 °C (ENTV-1 55 °C) 60 s and 72 °C 60 s were performed, with a final extension of 5 min at 72 °C. The products of three independent PCR reactions from each animal were pooled, gel-purified, cloned, and sequenced as above.

Tissue distribution studies.
Specific PCRs amplifying part of the U3 region of ENTV-2 and ENTV-1, respectively, were developed to detect provirus in genomic DNA. For ENTV-2 the first round primers were PCI (GCAAAATGCCAGGACCTTGG) and PCII (GATCTTATCTGCTTATTTTCAG). 2 µl of product from this reaction was reamplified with the latter primer plus PCIII (CCCTCAGGAAGTCTTAAAAG). PCR conditions for both rounds were as follows: 3 mM MgCl2, 10 mM Tris pH 8·3, 50 mM KCl, 200 µM each dNTP, 0·725 µM of each primer and 1·25 U of Taq polymerase (Amplitaq Gold, Applied Biosystems) in a total volume of 50 µl. The cycles performed were 10 min at 95 °C, followed by 35 cycles of 94 °C for 60 s, 55 °C (53 °C in second round) for 60 s and 72 °C for 30 s and with a final extension of 3 min at 72 °C. For detection of ENTV-1, primers POI (TCAGGAAGTCTTAAGAGCTTTTGG) and POII (AAGCAAGTTAAGTAACTTGAGATC) were employed in the first round and, for the second (hemi-nested) round, the latter was paired with POIII (AATGTGTTTTGGTTTTGCAACATG). PCR conditions were 2·5 mM MgCl2, 20 mM Tris pH 8·4, 50 mM KCl, 200 µM each dNTP, 6·25 pmol of each primer and 1·25 U of Taq Polymerase (Gibco) in a final volume of 50 µl per reaction. The conditions for the second round were the same except MgCl2 was 1 mM and Tris was 10 mM (pH 9·2). The cycles were as follows: 94 °C for 1 min, 40 cycles of 94 °C for 60 s, 57 °C (55 °C in 2nd round) for 60 s, 72 °C for 30 s, with a final extension of 72 °C for 5 min. These PCRs were employed to study the tissue distribution of virus in ten naturally ENA-affected animals (six goats and four sheep, aged from 14 years old and showing clinical signs of ENA) and in two unaffected controls (a goat and a sheep, neither of which had ever been exposed to the disease). At necropsy, in all cases, a neoplastic mass was observed within the nasal cavity, and adenocarcinoma of the nasal glands was confirmed histologically. Samples of ENA or nasal turbinate, heparinized venous blood, tonsil, lung, mediastinal lymph nodes, pre-scapular lymph nodes, retropharyngeal lymph nodes, spleen, thymus, femoral bone marrow, kidney, Peyer's patch, skin, and testis or mammary gland, were collected during the post-mortem examination. Stringent measures were observed to prevent cross-contamination of samples using new gloves, instruments etc., for each sample. Peripheral blood mononuclear cells (PBMC) were isolated from venous blood using lymphoprep (Nycomed) according to the manufacturer's instructions. Genomic DNA was extracted from 2025 mg of tissue or from 5x106 PBMC using the Qiagen Tissue Amp kit or the Gentra Capture Column kit, following the manufacturers' instructions. Triplicate PCR reactions were made of 500 ng of each sample. PCR products were analysed by electrophoresis of 30 µl of PCR product on a 2 % agarose gel containing 100 µg ethidium bromide ml-1.

Sequence of the ENTV-2 genome
The complete sequence of ENTV-2 genome (see supplementary Fig. 1 at https://vir.sgmjournals.org/) has been assigned GenBank accession number AY197548. Analysis of the sequence shows that ENTV-2 is closely related to ENTV-1 and JSRV. The gag, pro, pol and env genes encode proteins with more than 92 % similarity between these viruses (Table 2), and the predicted env mRNA splice donor and acceptor sites are conserved (; Palmarini et al., 2002). For all three viruses, the order of the domains in the Gag-Pro-Pol polyprotein is the same as for human endogenous retrovirus-K and for the type D simian retroviruses: gag, matrix (MA), capsid (CA), nucleocapsid (NC); pro, dUTPase, aspartyl protease, G-patch domain; pol, reverse transcriptase (RT), RNaseH, integrase (RPS-BLAST and CDART at ). In ENTV-2 (and also JSRV21) the pro open reading frame (ORF) begins downstream of that previously predicted for JSRV and ENTV-1 (York et al., 1992; Cousens et al., 1999). However, in all these viruses there is a consensus frameshift signal sequence (G GGA AAC) (Jacks et al., 1988) just upstream of a potential RNA pseudoknot. This closely resembles the gag/pro frameshift site of mouse mammary tumour virus (MMTV) (Chamorro et al., 1992) and is probably the real start of pro. The pro/pol frameshift site is less clear but is likely to be at the conserved GGGG or TTTCCCT just downstream of the start of the pol ORF. In contrast to the highly conserved regions of these viruses, there are distinct variable regions (VR) of divergence between them (Palmarini et al., 2000); VR1 and VR2 lie between the Gag MA and CA domains and are proline-rich regions of unknown function. VR3 encompasses the TM and intra-cytoplasmic domains of the Env TM subunit. Within VR3, the YXXM motif implicated in transformation of mammalian cells in vitro by JSRV Env (Palmarini et al., 2001) is present in all three exogenous viruses but not in ovERVs. Another conserved motif in Env, but outwith VR3, is the sequence LDLLQL, which aligns with part of an immunosuppressive motif that has been identified for many retroviruses (Blaise et al., 2001; Denner, 1998). ENTV-2 and JSRV have 73 % identity within the Env TM 48 amino acids (aa) cytoplasmic domain. However, ENTV-1 has only 49 % amino acid identity with ENTV-2 or JSRV in this region. A 2 bp deletion in env of ENTV-1 compared to JSRV and ENTV-2 means that the C-terminal 12 aa of JSRV/ENTV-2 and 14 aa of ENTV-1 Env proteins are different. The lowest sequence similarity for any of the ORFs is in orfX. In ENTV-2 the hypothetical OrfX protein is 167 aa long, calculated from the first methionine, while that of JSRV is 166 aa long. However alignment of the sequences shows that ENTV-2 has an additional 13 aa at the C-terminal end and is 12 aa shorter at the N-terminal end. The first methionine of the ENTV-1 OrfX aligns with that of JSRV but stop codons result in a hypothetical OrfX protein of only 72 aa. The U3 regions of these viruses are the most divergent of all and probably direct cell tropism since these viruses all appear to use the same cellular receptor. Hyal2 has been demonstrated to be the receptor for JSRV and ENTV-1 (Alberti et al., 2002; Rai et al., 2001) and the Env SU similarity predicts the same receptor usage by ENTV-2. Indeed cell tropism with respect to which cells can be infected may be exactly the same for these viruses, but tropism concerning target cells for permissive replication is different. Infected cells which are transformable may be those in which expression from the LTR is most strongly activated. Many potential transcription factor binding sites (data not shown) can be predicted in U3; some are conserved between the viruses in this group, e.g. two ikaros binding sequences and an NFκ-B site at the 5' end of U3 and others are unique (http://transfac.gbf.de.cgi-bin/natSearch). The validation of these predictions awaits experimentation. The LTRs of JSRV and ovERVs have been shown to be active in different cell types and respond to different transcriptional activator proteins (Palmarini et al., 2000). The ENTV-1 and ENTV-2 LTRs have yet to be studied in this way. One would predict that they would be most active in the secretory epithelial cells of the ethmoid turbinate. Indeed, it may be possible to characterize transcription factors unique to those cells by their activity on ENTV-1 and ENTV-2 LTRs and not JSRV LTR.


Table 2. Amino acid similarities between the proteins of ENTV-2, ENTV-1 and JSRV calculated using the BESTFIT program (Genetics Computer Group, 1994)


Sequence variability studies
To investigate the variability of ENTV-2 and ENTV-1, the TM region of env from ENA genomic DNA of three goats and three sheep was cloned and sequenced. Sequencing of the TM region (Fig. 2) showed little variability between the different isolates of these viruses (ENTV-1<4 %, ENTV-2<0·5 %) and even less between the three clones from a single animal (<0·1 %) suggesting low rates of variation. In addition, the TM sequences of ENTV-2 and ENTV-1 are less similar to each other (86 % amino acid identity) than JSRVI (York et al., 1992) is to JSRVII (Palmarini et al., 1999) (90 % amino acid identity). These results suggest that ENTV-2 and ENTV-1 are distinct viruses rather than geographical variants like JSRVI and JSRVII (Bai et al., 1996). The sheep and goat cases were all from the same region of Spain, yet the differences between ENTV-1 and ENTV-2 were maintained, suggesting species specificity.



(111K):

Fig. 2. Alignment of the env-LTR sequences obtained from three goats and three sheep affected by ENA. TNC 294, TNC 396 and TNC 196 were from ENA-affected goats and TNO 28, TNO 29 and TNO 35 were from ENA-affected sheep. Matches in the consensus sequence are shown as (.). Gaps in the alignment are shown as (-). GenBank accession numbers for these sequences are AY196354AY196359. The sequences were aligned using ALIGNX (Vector NTI Suite).

Tissue distribution studies
In order to investigate the distribution of ENTV-2 and ENTV-1 within the infected host, specific PCRs to amplify part of the U3 region were developed to detect provirus in genomic DNA. The locations of the primers used are shown in Fig. 3. These PCRs were employed to study virus distribution in different organs of six goats and four sheep naturally affected by ENA and in two negative controls, a goat and a sheep. The specificity of the PCRs was confirmed by Southern blotting and hybridization (data not shown). The sensitivity of the ENTV-1 and ENTV-2 PCRs was similar (less than 20 copies in 500 ng of DNA) (data not shown), so the results should enable a faithful comparison of the dissemination of these viruses in their hosts. The results are detailed in Table 3 and summarized in Fig. 4. All samples of the negative control sheep and goat were negative for virus. All samples were positive for amplification of the GADPH gene (Palmarini et al., 1996), demonstrating the integrity of the DNA in every case. The proviral load was highest in tumours as ENTV-1 and ENTV-2 were detectable in ENA tissue of sheep or goat, respectively, after only one round of PCR. Hemi-nested PCR was needed for the detection of proviral DNA in any other tissues. Outwith the tumour, ENTV-1 was only detected in a single replicate of tracheobronchial lymph node, mammary gland, skin and kidney of one animal, and in one lung sample. It was not found in bone marrow or PBMCs. In contrast, the presence of ENTV-2 in the ENA-affected goats was widespread; ENTV-2 proviral DNA was found consistently in the tonsil (4/4), retropharyngeal lymph node (6/6), and PBMC (6/6) of ENA-affected goats. In addition, proviral DNA was found in 3/5 prescapular lymph nodes, 3/4 tracheobronchial lymph nodes, 3/6 mediastinal lymph nodes, 3/6 spleens, 3/6 lungs, 1/6 bone marrows and 1/5 Peyer's patches but not in kidney. Therefore ENTV-2 appears to be more disseminated in the infected host than ENTV-1. The ENTV-2 dissemination pattern resembles that seen with JSRV, where the virus is detectable in lymph nodes and PBMCs (González et al., 2001; Palmarini et al., 1996). Further studies will determine whether detection in PBMCs could be a possible preclinical diagnostic test for ENTV-2 infection, as tests based on detection of antibody are impossible due to the lack of a detectable immune response to these viruses (Ortín et al., 1998).



(40K):

Fig. 3. Alignment of LTR sequences of ENTV-2 and caERV with ENTV-1, ovERV and JSRV. caERV: consensus of two sequences (GenBank accession numbers AY196532 and AY196353). ovERV: consensus of nine sequences (Bai et al., 1996; Palmarini et al., 1996). JSRV1: York et al. (1992), JSRV2: consensus of two US and three UK sequences (Bai et al., 1996; M. Palmarini, personal communication.). ENTV-1: Cousens et al. (1996). Matches with the consensus sequence are shown as (.). Gaps in the alignment are shown as (-). The locations of the specific PCR primers used to determine host distribution of ENTV-2 (PCI, PCII, PCIII) and ENTV-1 (POI, POII, POIII) are indicated by underlining.

Table 3. ENTV-2 and ENTV-1 distribution in the tissues of ENA-affected animals Six goats and four sheep naturally affected by ENA were studied and a total of 1·5 µg of DNA was analysed from each tissue. Results are given as number of samples positive per number tested. NT, Not tested; ln, lymph node.



(58K):

Fig. 4. ENTV-1 and ENTV-2 distribution in the tissues of ENA-affected animals. Lymph nodes, spleen, and Peyer's patch are presented together as lymphoid tissues. Six goats and four sheep affected by ENA were studied and a total of 1·5 µg of DNA was analysed from each tissue. (a) Percentage of ENA-affected animals which were ENTV-1 or ENTV-2 positive for each tissue. (b) Percentage of total replicates which were positive.

Despite the apparent differences in the extent of virus dissemination in the host, both ENTV-1 and ENTV-2 nevertheless cause similar diseases on a similar time scale suggesting that infection of non-target organs is not necessarily a prerequisite for disease progression. Some differences in the sequences could account for the fact that ENTV-2 and JSRV are more alike with respect to dissemination. ENTV-1 potentially encodes a considerably truncated OrfX protein compared to JSRV or ENTV-1. A role for OrfX in transformation by JSRV has already been ruled out in vitro (Maeda et al., 2001), but the role of OrfX in dissemination in the host is not known. An obvious experiment when a ENTV-2 molecular clone is developed will be to mutate the orfX reading frame, or replace it with ENTV-1 orfX, in order to truncate the expressed protein, and to determine whether the in vivo distribution pattern is altered. ENTV-2 is also more like JSRV than ENTV-1 in the C-terminal region of the EnvTM cytoplasmic tail, so it is possible that some aspect of this region is also important in dissemination.

In summary, we propose that ENTV-2 is a new member of the family of small ruminant exogenous β-retroviruses that includes JSRV and ENTV-1. Specific PCRs were developed for ENTV-2 and ENTV-1 and utilized to show that both viruses generate a disseminated infection. The importance of dissemination in the virus life-cycle/pathogenesis remains to be proven, particularly as ENTV-1 and ENTV-2 induce very similar diseases even though dissemination in the host appears to be more limited for ENTV-1.

This work was supported by grants from: Commission of the European Communities (QLK2-CT1999-00983; Framework Programme 5), Scottish Executive Environment and Rural Affairs Department (ROAME MRI/066/01) and Comisión Interministerial de Ciencia y Tecnología, Spain (AGL 2001-1812 GAN). A. Ortín and C. Cousens contributed equally to this work.

Footnotes

Present address: Veterinary Laboratories Agency, Pentlands Science Park, Bush Loan, Edinburgh, UK.

References

Alberti, A., Murgia, C., Liu, S. L., Mura, M., Cousens, C., Sharp, J. M., Miller, A. D. & Palmarini, M. (2002). Envelope induced cell transformation by ovine β-retroviruses. J Virol 76, 53875394.[Abstract/Free Full Text]

Bai, J., Zhu, R. Y., Stedman, K., Cousens, C., Carlson, J., Sharp, J. M. & DeMartini, J. C. (1996). Unique long terminal repeat U3 sequences distinguish exogenous jaagsiekte sheep retroviruses associated with ovine pulmonary carcinoma from endogenous loci in the sheep genome. J Virol 70, 31593168.[Abstract]

Blaise, S., Mangeney, M. & Heidmann, T. (2001). The envelope of MasonPfizer monkey virus has immunosuppressive properties. J Gen Virol 82, 15971600.[Abstract/Free Full Text]

Chamorro, M., Parkin, N. & Varmus, H. E. (1992). An RNA pseudoknot and an optimal heptameric shift site are required for highly efficient ribosomal frameshifting on a retroviral messenger RNA. Proc Natl Acad Sci U S A 89, 713717.[Abstract/Free Full Text]

Chomczynsky, P. & Sacchi, N. (1987). Single step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 162, 156159.[Medline]

Cousens, C., Minguijón, E., García, M., Ferrer, L. M., Dalziel, R. G., Palmarini, M., De las Heras, M. & Sharp, J. M. (1996). PCR-based detection and partial characterization of a retrovirus associated with contagious intranasal tumors of sheep and goats. J Virol 70, 75807583.[Abstract]

Cousens, C., Minguijón, E., Dalziel, R. G., Ortín, A., García, M., Park, J., González, L., Sharp, J. M. & De las Heras, M. (1999). Complete sequence of enzootic nasal tumor virus, a retrovirus associated with transmissible intranasal tumors of sheep. J Virol 73, 39863993.[Abstract/Free Full Text]

De las Heras, M., García de Jalón, J. A. & Sharp, J. M. (1991a). Pathology of enzootic intranasal tumour in thirty-eight goats. Vet Pathol 28, 474481.[Abstract]

De las Heras, M., Sharp, J. M., García de Jalon, J. A. & Dewar, P. (1991b). Enzootic nasal tumour of goats; demonstration of a type D-related retrovirus in nasal fluids and tumours. J Gen Virol 72, 25332535.[Abstract/Free Full Text]

De las Heras, M., Sharp, J. M., Ferrer, L. M., García de Jalón, J. A. & Cebrian, L. M. (1993). Evidence for a type D-like retrovirus in enzootic nasal tumor of sheep. Vet Rec 132, 441.[Medline]

De las Heras, M., Ortín, A., Cousens, C., Minguijón, E. & Sharp, J. M. (2003). Jaagsiekte sheep retrovirus and lung cancer. Enzootic nasal adenocarcinoma of sheep and goats. In Current Topics in Microbiology and Immunology, vol 275, chapter 2, Edited by H. Fan. New York: Springer-Verlag.

Denner, J. (1998). Immunosuppression by retroviruses: implications for xenotransplantation. Ann N Y Acad Sci 862, 7586.[Abstract/Free Full Text]

Genetics Computer Group (1994). Program manual for the Wisconsin package, version 8.

González, L., García-Goti, M., Cousens, C., Dewar, P., Cortabarría, N., Extramiana, A. B., Ortín, A., De las Heras, M. & Sharp, J. M. (2001). Jaagsiekte sheep retrovirus can be detected in the peripheral blood during the pre-clinical period of sheep pulmonary adenomatosis. J Gen Virol 82, 13551358.[Abstract/Free Full Text]

Hecht, S. J., Carlson, J. O. & DeMartini, J. C. (1994). Analysis of a type D retroviral capsid gene expressed in ovine pulmonary carcinoma and present in both affected and unaffected sheep genomes. Virology 202, 480484.[CrossRef][Medline]

Herring, A. J., Sharp, J. M., Scott, F. M. M. & Angus, K. W. (1983). Further evidence for a retrovirus as the aetiological agent of sheep pulmonary adenomatosis (jaagsiekte). Vet Microbiol 8, 237249.[CrossRef][Medline]

Jacks, T., Madhani, H. D., Masiarz, F. R. & Varmus, H. E. (1988). Signals for ribosomal frameshifting in the Rous sarcoma virus gag-pol region. Cell 55, 447458.[CrossRef][Medline]

Maeda, N., Palmarini, M., Murgia, C. & Fan, H. (2001). Direct transformation of rodent fibroblasts by jaagsiekte sheep retrovirus DNA. Proc Natl Acad Sci U S A 98, 44494454.[Abstract/Free Full Text]

Ortín, A., Minguijón, E., Dewar, P., Garcia, M., Ferrer, L. M., Palmarini, M., González, L., Sharp, J. M. & De las Heras, M. (1998). Lack of a specific immune response against a recombinant capsid protein of jaagsiekte sheep retrovirus in sheep and goats naturally affected by enzootic nasal tumour or sheep pulmonary adenomatosis. Vet Immunol Immunopathol 61, 229237.[CrossRef][Medline]

Palmarini, M., Holland, M. J., Cousens, C., Dalziel, R. G. & Sharp, J. M. (1996). Jaagsiekte retrovirus establishes a disseminated infection of the lymphoid tissues of sheep affected by pulmonary adenomatosis. J Gen Virol 77, 29912998.[Abstract/Free Full Text]

Palmarini, M., Sharp, J. M., De las Heras, M. & Fan, H. (1999). Jaagsiekte sheep retrovirus is necessary and sufficient to induce a contagious lung cancer in sheep. J Virol 73, 69646972.[Abstract/Free Full Text]

Palmarini, M., Hallwirth, C., York, D., Murgia, C., De Oliveira, T., Spencer, T. & Fan, H. (2000). Molecular cloning and functional analysis of three type D endogenous retroviruses of sheep reveal a different cell tropism from that of the highly related exogenous jaagsiekte sheep retrovirus. J Virol 74, 80658076.[Abstract/Free Full Text]

Palmarini, M., Maeda, N., Murgia, C., De-Fraja, C., Hofracre, A. & Fan, H. (2001). A phosphatidylinositol 3-kinase docking site in the cytoplasmic tail of jaagsiekte sheep retrovirus transmembrane protein is essential for envelope-induced transformation of NIH 3T3 cells. J Virol 75, 1100211009.[Abstract/Free Full Text]

Palmarini, M., Murgia, C. & Fan, H. (2002). Spliced and prematurely polyadenylated jaagsiekte sheep retrovirus-specific RNAs from infected or transfected cells. Virology 294, 180188.[CrossRef][Medline]

Rai, S. K., Duh, F. M., Vigdorovich, V., Danilkovitch-Miagkova, A., Lerman, M. I. & Miller, D. (2001). Candidate tumor suppressor HYAL2 is a glycosylphosphatidylinositol (GPI)-anchored cell surface receptor for jaagsiekte sheep retrovirus, the envelope protein of which mediates oncogenic transformation. Proc Natl Acad Sci U S A 98, 44434448.[Abstract/Free Full Text]

Vitelozzi, G., Mughetti, L., Palmarini, M., Mandara, M. T., Mechelli, L., Sharp, J. M. & Manocchio, I. (1993). Enzootic intranasal tumour of goats in Italy. J Vet Med Ser B 40, 459468.

Wu, Q., Chen, M., Buchwald, M. & Phillips, R. A. (1995). A simple rapid method for isolation of high quality genomic DNA from animal tissues. Nucleic Acids Res 23, 50875088.[Free Full Text]

York, D. F., Vigne, R., Verwoerd, D. W. & Querat, G. (1992). Nucleotide sequence of the jaagsiekte retrovirus, an exogenous and endogenous type D and B retrovirus of sheep and goats. J Virol 66, 49304939.[Abstract/Free Full Text]

Received 28 January 2003; accepted 4 April 2003.