Research Article

The rapamycin sensitivity of human T-cell leukaemia virus type I-induced T-cell proliferation is mediated independently of the polypyrimidine motifs in the 5' long terminal repeat

Journal of General Virology 2001; 82(2):435

PubMed

Abstract

The immunosuppressant rapamycin can regulate the translation of a subset of messenger RNAs, a phenotype which has been linked to the presence of a polypyrimidine motif [C(N)414] downstream of the mRNA cap structure. T-cell clones naturally infected with transcriptionally active human T-cell leukaemia virus, type I (HTLV-I) undergo autologous proliferation; this phenotype is inhibited by rapamycin but not FK506, which reverses the rapamycin effect. Within the R region of the HTLV-I 5' long terminal repeat (LTR) there are seven polypyrimidine motifs. We sought to determine if these were involved in the sensitivity of proliferation to the presence of rapamycin. Here we illustrate the generation of an in vitro model of this rapamycin-sensitivity and the analysis of LTR mutants which were created to determine the importance of the polypyrimidine motifs. Reporter gene assays suggest the effect is independent of the polypyrimidine motifs in the virus leader sequence.



Human T-cell leukaemia virus type I (HTLV-I) is causatively associated with an aggressive malignancy, adult T-cell leukaemia (ATL), and the demyelinating disease HTLV-I-associated myelopathy/tropical spastic paraparesis (HAM/TSP). Peripheral blood mononuclear cells (PBMCs) from HAM/TSP-affected individuals demonstrate an abnormally high level of spontaneous proliferation in vitro. The production of primary T-cell clones from PBMCs derived from HAM/TSP-infected individuals revealed the presence of uninfected and infected populations of cells. Of the cells which harbour an HTLV-I provirus some demonstrate a high level of proliferation in the absence of exogenous interleukin-2 (IL-2) whereas others do not (Höllsberg et al., 1992 ). This autonomous proliferation, which correlates with the presence of a transcriptionally active provirus (Höllsberg et al., 1992 ), is IL-2 and IL-2R independent (Wucherpfennig et al., 1992 ), and may relate to the development of T-cell malignancy. The proliferating infected cells can also trigger proliferation in bystander cells in an IL-2-dependent manner (Wucherpfennig et al., 1992 ), a mechanism which may be central to the development of HAM/TSP and other autoimmune diseases associated with HTLV-I infection.

Transcription of an HTLV-I provirus requires the viral trans-activating protein, Tax. Tax regulates transcription through indirect binding, via secondary proteins, to various motifs within the viral 5' long terminal repeat (LTR), most notably the binding of the cAMP-responsive element binding protein (CREB) to the 21 bp imperfect repeats in the U3 region (reviewed in Flint & Shenk, 1997 ). In addition Tax is increasingly recognized as affecting the regulation of a number of cellular gene promoters (reviewed in Mesnard & Devaux, 1999 ).

A striking feature of the T-cell clones is the selective inhibition of the autonomous proliferation by rapamycin (Höllsberg et al., 1992 ). This immunosuppressant (reviewed in Abraham & Wiederrecht, 1996 ) has recently been shown to selectively suppress the mitogen-induced translation of a subset of mRNAs. The translation of most mRNAs remains unaffected (Terada et al., 1994 ; Nielsen et al., 1995 ; Mendez et al., 1996 ; Jeffries et al., 1997 ). A feature of the affected mRNAs is the presence of a 5'-terminal oligopyrimidine tract (5' TOP) downstream of their N7-methylguanosine (m7G) cap structures. This motif is composed of between 5 and 15 nucleotides the first of which is invariably cytosine. It has been proposed that rapamycin binds a member of the FK506-binding protein family, FKBP-12, creating a complex which binds with the FKBP-12rapamycin-associated protein (FRAP) kinase (reviewed in Brown & Schreiber, 1996 ). Kinase activity is abrogated preventing phosphorylation, and hence activation, of eukaryotic initiation factor 4E (eIF4E)-binding protein, 4E-BP1 (Pause et al., 1994 ). eIF4E possesses helicase activity: unphosphorylated 4E-BP1 sequesters free eIF4E forming an inactive complex thus preventing association of the elongation factor with mRNA cap structures. This coupling is essential for efficient translation as it is speculated that further initiation factors are subsequently attracted whose function is to assist unwinding of secondary structure in the 5'untranslated regions of mRNAs. This pathway is distinct from previously described JakStat and RasMAP kinase pathways (Brown & Schreiber, 1996 ).

Downstream of the U3 region lies the R region of the HTLV-I 5' LTR; this region harbours six motifs conforming to 5' TOP structural constraints. The first has a thymine as the initial base but is in the most conserved position for a rapamycin effect; the other five all begin with a cytosine. We investigated whether these motifs act as control elements for rapamycin-induced translational regulation through the use of LTR- and mutant LTR-chloramphenicol acetyltransferase (CAT) reporter plasmids. The first polypyrimidine motif of the wild-type, CR-CAT construct [the CAT gene driven by the HTLV-I 5' LTR (pU3R-I; Sodroski et al., 1984 ); Fig. 1] was altered to a polypurine motif by site-directed mutagenesis (Kunkel et al., 1987 ) via a pBluescript KSII(+) (Stratagene) intermediate which harboured a 716 bp XhoIHindIII LTR-containing fragment from CR-CAT. The sequence of the antisense mutagenic oligonucleotide used was 5' GCCGGGCGCGTCCTTCCTCCCTGCGAGCCCCCTC 3'. The CR-CAT R region deletion mutant [CR(ΔR)-CAT; Fig. 1] was generated by PCR mutagenesis using Pfu. DNA polymerase (Stratagene). Sequence flanking the region to be deleted from CR-CAT was amplified using the opposing oligonucleotides ΔRa (5' CTCGCATCTCTCCTTCAggcctctgta 3') and ΔRs (5' gccccgataTCTGTTCTGCGCCGTTAC 3') where sequences in uppercase are complementary to LTR sequence and those in italics introduce a StuI (ΔRa) or an EcoRV (ΔRs) restriction site. 10 µg CR-CAT DNA was amplified in a 100 µl reaction volume comprising 1xnative reaction buffer (Stratagene), 4·5 mM MgCl2, 0·25 mM each dNTP, 0·12 µM each oligonucleotide and 0·02 units Pfu. DNA polymerase. A single incubation at 96 °C for 45 s was followed by 25 cycles comprising 96 °C for 45 s, 37 °C for 45 s and 72 °C for 10 min and an additional single extension step at 72 °C for 10 min. Gel-purified amplicon was restricted with the appropriate enzymes and circularized using a Rapid Ligase kit (Boehringer Mannheim). All plasmids were confirmed by sequencing.



(12K):

Fig. 1. HTLV-I LTR-containing constructs. CR-CAT is the parent plasmid containing the polypyrimidine motif which was mutagenized to a polypurine motif in CR(PolyPu)-CAT. Construct CR(ΔR)-CAT has R sequences downstream of the cap site-proximal motif deleted (see text for details). The U5 region in the parent and subsequent mutants is truncated as denoted by an asterisk. Oligonucleotides used to generate CR(ΔR)-CAT are shown (arrows), the black bars representing the non-complementary sequences for cloning purposes (see text). s, sense; a, antisense. Not to scale.

To determine the effect of rapamycin on the three LTRs 1 µg or 2·5 µg of each plasmid was transiently co-transfected into a 5 cm or 10 cm diameter tissue culture dish of COS-1 cells, respectively, with pcDNA3Tax/Rex [HTLV-I Tax expression vector (Rose et al., 2000 )] using the DEAE-dextran method (Sambrook et al., 1989 ). Transfected cells were grown in media [DMEM (Gibco-BRL) supplemented with 10% foetal calf serum and 1% penicillinstreptomycin] containing rapamycin (Sandoz) at a final concentration of 0, 0·1, 1, 10, 20 or 60 nM. The levels of CAT acetylation products in 5 µl supernatant were assessed 24 h post-transfection by thin-layer chromatography, quantified on an Instant Imager (Canberra Packard) and expressed as a percentage of that seen in the zero rapamycin control. The levels from all three were shown to decrease with increasing concentrations of rapamycin (Fig. 2a) despite cell numbers remaining constant. Background expression levels of the plasmids were assessed in the absence of pcDNA3Tax/Rex and rapamycin in a duplicate experiment and were comparable to the negative Tris control (Fig. 2b). Results from four single transfections in which plasmids pES-CAT [the CAT gene under control of the human cytomegalovirus (CMV) immediate early promoter] and pIEP1-CAT (minimal CMV promoter sequences upstream of the CAT gene) were used are also shown (Fig. 2a). The lack of rapamycin-induced inhibition of CAT activity when the CMV-CAT constructs were substituted for CR-CAT indicates that the decrease in activity is LTR promoter-specific and not dependent on downstream coding regions. These results also indicate that the levels of CAT mRNA are unaffected by the presence of rapamycin as suggested by the unaltered levels of acetylated CAT protein in the CMV-CAT transfection experiments.



(27K):

Fig. 2. Effect of rapamycin on reporter gene activity. (a) Levels of promoter activity in COS-1 fibroblasts as measured by levels of acetylated chloramphenicol are shown for pES-CAT, pIEP1-CAT, CR-CAT, CR(PolyPu)-CAT and CR(ΔR)-CAT over five rapamycin concentrations. Results shown are ± standard deviation of mean values from three duplicate transfections for the CR-CAT and CR(PolyPu)-CAT constructs and three individual transfections for the CR(ΔR)-CAT, pES-CAT and pIEP1-CAT constructs. Daggers indicate a significant difference between that value and that of zero rapamycin control (P<0·001). (b) Levels of promoter activity of plasmids CR-CAT, CR(PolyPu)-CAT and CR(ΔR)-CAT in the absence and presence of Tax protein in COS-1 cells are shown compared to Tris control levels. Results shown are ± standard deviation of mean values from duplicate transfections. (c) Levels of promoter activity in Jurkat T cells are shown for plasmids CR-CAT and pIEP1-CAT. Results shown are ± standard deviation of mean values from duplicate transfections.

A similar rapamycin-dependent reduction in CR-CAT activity was seen compared to unchanged pIEP1-CAT-derived activity when these plasmids were transfected into Jurkat T cells (Fig. 2c) as well as C8166-45 T cells (which generate Tax protein from integrated proviral sequences; data not shown).

Transfection efficiency was assessed by transfection of plasmid CMV-GFP [green fluorescent protein (GFP) under control of the CMV promoter] into COS-1 cells in the presence and absence of rapamycin. The percentage of cells expressing GFP across the rapamycin concentration range was assessed following image capture on an Olympus IX70 fluorescent microscope using Image Pro Plus software. The ratio of GFP-expressing to non-expressing cells was calculated in three independent transfections and did not reflect the decrease of CAT activity seen across the same rapamycin concentration gradient (data not shown).

We investigated the HTLV-I-specific protein levels derived from cotransfected cells to confirm that Tax protein levels remained constant across the rapamycin concentration. Total cellular protein from 1x106 CR-CAT-transfected cells was harvested and 1/20 vol. blotted onto a nitrocellulose membrane using standard techniques. The primary detection antibody was a rabbit polyclonal antibody raised against the C terminus of Tax applied at a 1:400 dilution. The secondary, donkey anti-rabbit horseradish peroxidase-linked antibody (Amersham), was applied at a 1:1000 dilution. Proteins were detected using ECL reagents (Amersham), according to the manufacturers instructions, followed by autoradiography. There was no significant decrease in Tax levels with increasing concentrations of rapamycin (data not shown). This indicates that the observed decrease in acetylated CAT products is not due to reduced levels of Tax protein available to activate the 5' LTR in the co-transfection experiments.

A further observation made with the T-cell clones was that, despite being sensitive to rapamycin, the autonomous proliferation was not affected by cyclosporin A or FK506 (tacrolimus). These immunosuppressants are usually able to prevent T-cell proliferation by interfering with IL-2 transcription (Sehgal, 1998 ). We have shown that FK506 (Fujisawa GmbH, Munich, Germany) restores rapamycin-mediated abrogation of acetylation levels. Using plasmids CR-CAT and pcDNA3Tax/Rex in our reporter assay, transfected cells were grown in media containing (i) neither drug, (ii) 20 nM rapamycin, (iii) 40 µM FK506 or (iv) 20 nM rapamycin+40 µM FK506. Reporter gene activity was restored to near-wild-type levels when FK506 was present with rapamycin in the culture medium. FK506 alone had no suppressive effect on promoter activity as expected (Fig. 3). This mirrors the effects witnessed in the T-cell clones (Höllsberg et al., 1992 ). FK506 and rapamycin show considerable structural similarity (Abraham & Wiederrecht, 1996 ). It is likely that FK506 binds the same receptor as rapamycin competitively and is able to restore gene expression by displacing it. As these experiments utilized a large molar excess of FK506 over that of rapamycin it is likely that FK506 saturates the binding site thus preventing binding of rapamycin. Higher concentrations of rapamycin are required to inhibit FRAP activity in vitro than in vivo (Brown et al., 1995 ; Brunn et al., 1996 ; Chen et al., 1997 ; Scott et al., 1998 ). It is therefore not unexpected that the required molar excess of FK506 over rapamycin in vitro might be larger than for the T-cell clones (Höllsberg et al., 1992 ). This observation is mirrored by the concentrations used in our study. The crystal structure of the ternary complex formed by rapamycin, FKBP-12 and the FRAP-binding domain (FRB) revealed that rapamycin binds to the hydrophobic regions of the two molecules drawing them together (Choi et al., 1996 ). It is possible that the rapamycinFKBP-12 complex has a greater affinity for FRAP than does FK506; thus abolition of the above association requires a high molar excess of FK506.



(21K):

Fig. 3. Effect of FK506 on rapamycin-induced reporter gene reduced activity. Levels of promoter activity as measured by levels of acetylated chloramphenicol are shown for CR-CAT (1), CR(PolyPu)-CAT (2) and CR(ΔR)-CAT (3) comparing 20 nM rapamycin and 40 µM FK506 concentrations and a combination of both drugs. Results shown are K standard deviation of mean values from three transfections.

We have successfully generated a tissue culture model of the rapamycin-sensitive phenomenon of HTLV-I hereto observed solely in primary T-cells from HTLV-I-affected individuals. Several avenues of investigation were explored to determine the role of polypyrimidine tract motifs in the rapamycin-induced abrogation of HTLV-I promoter activity. We initially examined the cap structure-proximal motif by substituting the run of pyrimidines for purines which might be expected to cause loss of translational inhibition in vivo as has been noted for the ribosomal protein S16 transcript (Levy et al., 1991 ); however, no significant difference in response to the presence of rapamycin was observed. The equivalent effect in CR-CAT-transfected C8166-45 cells confirms the consistency of this phenomenon. From LTR mutant analysis we conclude that the R region of the HTLV-I 5' LTR does not possess sequences which are involved in rapamycin-sensitive translation pathways. Other proteins are known to interact with the viral 5' LTR by forming a complex with Tax protein which results in transcriptional activation; thus a potential control point in this rapamycin-sensitive pathway may be the proteins with which Tax associates within the U3 region of the LTR such as CREB. Thus the effect of rapamycin, subverting the normal translational control of some mRNA species, manifests as a regulation of transcription in HTLV-I. In the absence of rapamycin-sensitive motifs within the LTR itself it is likely that the translation of one or more of these proteins may be affected by rapamycin thus indirectly affecting the transcription of HTLV-I. Current studies, employing U3 mutants, are aimed at identifying motifs in families of HTLV-I LTR-associated proteins. This rapamycin-sensitive pathway may be a potential therapeutic target in this and other retroviruses.
Plasmids CR-CAT and pcDNA3Tax/Rex were gifts from Marie-Christine Dokhélar, Institut Cochin, Paris. Plasmids pES-CAT and pIEP1CAT were kindly provided by John Sinclair. The CMV-GFP plasmid was provided by Dieter Klein. The rabbit anti-Tax antibody was a generous gift from Dr Susan Daenke.

The authors wish to acknowledge the scientific support of the HTLV European Research Network. This work was supported by a grant from the Wellcome Trust.

References

Abraham, R. & Wiederrecht, G.(1996). Immunopharmacology of rapamycin. Annual Reviews in Immunology 14, 483-510.[Medline]

Brown, E. & Schreiber, S.(1996). A signaling pathway to translational control. Cell 86, 517-520.[Medline]

Brown, E., Beal, P., Keith, C., Chen, J., Shin, T. & Schreiber, S.(1995). Control of p70 S6 kinase by kinase activity of FRAP in vivo. Nature 377, 441-446.[Medline]

Brunn, G., Williams, J., Sabers, C., Wiederrecht, G., Lawrence, J.Jr & Abraham, R.(1996). Direct inhibition of the signalling functions of the mammalian target of rapamycin by the phosphoinositide 3-kinase inhibitors, wortmannin and LY294002. EMBO Journal 15, 5256-5267.[Medline]

Chen, Y.-G., Liu, F. & Massagué, J.(1997). Mechanism of TGFβ receptor inhibition by FKBP12. EMBO Journal 16, 3866-3876.[Medline]

Choi, J., Chen, J., Schreiber, S. & Clardy, J.(1996). Structure of the FKBP12rapamycin complex interacting with the binding domain of human FRAP. Science 273, 239-242.[Abstract]

Flint, J. & Shenk, T.(1997). Viral transactivating proteins. Annual Review of Genetics 31, 177-212.[Medline]

Höllsberg, P., Wucherpfennig, K., Ausubel, L., Calvo, V., Bierer, B. & Hafler, D.(1992). Characterization of HTLV-I in vivo infected T cell clones. Journal of Immunology 148, 3256-3263.[Abstract]

Jeffries, H., Fumagalli, S., Dennis, P., Reinhard, C., Pearson, R. & Thomas, G.(1997). Rapamycin suppresses 5' TOP mRNA translation through inhibition of p70s6k. EMBO Journal 16, 3693-3704.[Medline]

Kunkel, T., Roberts, J. & Zakour, R.(1987). Rapid and efficient site-specific mutagenesis without phenotypic selection. Methods in Enzymology 154, 367-382.[Medline]

Levy, S., Avni, D., Hariharan, N., Perry, R. & Meyuhas, O.(1991). Oligopyrimidine tract at the 5' end of mammalian ribosomal protein mRNAs is required for their translational control. Proceedings of the National Academy of Sciences, USA 88, 3319-3323.[Abstract/Free Full Text]

Mendez, R., Myers, M., White, M. & Rhoads, R.(1996). Stimulation of protein synthesis, eukaryotic translation initiation factor 4E phosphorylation and PHAS-1 phosphorylation by insulin requires insulin receptor substrate 1 and phosphatidylinositol 3-kinase. Molecular and Cellular Biology 16, 2857-2864.[Abstract]

Mesnard, J.-M. & Devaux, C.(1999). Multiple control levels of cell proliferation by human T-cell leukemia virus type 1 tax protein. Virology 257, 277-284.[Medline]

Nielsen, F., Østergaard, L., Niesene, J. & Christiansen, J.(1995). Growth-dependent translation of IGF-II mRNA by a rapamycin-sensitive pathway. Nature 377, 358-362.[Medline]

Pause, A., Belsham, G. J., Gingras, A. C., Donze, O., Lin, T. A., Lawrence, J. C.Jr & Sonenberg, N.(1994). Insulin-dependent stimulation of protein synthesis by phosphorylation of a regulator of 5'-cap function. Nature 371, 762-767.[Medline]

Rose, N., Richardson, J., Desselberger, U. & Lever, A.(2000). Virus inactivation in a proportion of human T-cell leukaemia virus type I-infected T-cell clones arises through naturally occurring mutations. Journal of General Virology 81, 97-104.[Abstract/Free Full Text]

Sambrook, J., Fritsch, E. & Maniatis, T. (1989). Molecular Cloning: A Laboratory Manual, 2nd edn. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.

Scott, P. H., Brunn, G. J., Kohn, A. D., Roth, R. A. & Lawrence, J. C.Jr(1998). Evidence of insulin-stimulated phosphorylation and activation of the mammalian target of rapamycin mediated by a protein kinase B signaling. Proceedings of the National Academy of Sciences, USA 95, 7772-7777.[Abstract/Free Full Text]

Sehgal, S.(1998). Rapamune (RAPA, rapamycin, sirolimus): mechanism of action immunosuppressive effect results from blockade of signal transduction and inhibition of cell cycle progression. Clinical Biochemistry 31, 335-340.[Medline]

Sodroski, J., Rosen, C. & Haseltine, W.(1984). Trans-acting transcriptional activation of the long terminal repeat of human T lymphotropic viruses in infected cells. Science 225, 381-385.[Abstract/Free Full Text]

Terada, N., Patel, H., Takase, K., Kohno, K. & Nairn, A.(1994). Rapamycin selectively inhibits translation of mRNAs encoding elongation factors and ribosomal proteins. Proceedings of the National Academy of Sciences, USA 91, 11477-11481.[Abstract/Free Full Text]

Wucherpfennig, K., Höllsberg, P., Richardson, J., Benjamin, D. & Hafler, D.(1992). T-cell activation by autologous human T-cell leukemia virus type I-infected T-cell clones. Proceedings of the National Academy of Sciences, USA 89, 2110-2114.[Abstract/Free Full Text]

Received 11 September 2000; accepted 25 October 2000.